D2Got332 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Got332

Symbol: D2Got332
Previously known as: oxsts3121; OT12.45; 
RGD ID: 1636528
Expected Size: 131 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21176,516,326 - 76,516,356 (-)MAPPERmRatBN7.2
mRatBN7.2449,702,123 - 49,702,153 (+)MAPPERmRatBN7.2
mRatBN7.22144,619,698 - 144,619,827 (+)MAPPERmRatBN7.2
mRatBN7.24177,930,759 - 177,930,789 (-)MAPPERmRatBN7.2
mRatBN7.2X65,355,276 - 65,355,306 (+)MAPPERmRatBN7.2
mRatBN7.2297,121,938 - 97,121,971 (-)MAPPERmRatBN7.2
Rnor_6.02150,678,119 - 150,678,251NCBIRnor6.0
Rnor_5.02170,097,446 - 170,097,578UniSTSRnor5.0
RGSC_v3.42149,813,734 - 149,813,866UniSTSRGSC3.4
Cytogenetic Map2 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTGCTAAGAATAGAGTATACTTG
Reverse Primer GAATCAATTGACTTAACAGATATC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
71081Cldn11claudin 112112207745112221050Rat
70912P2ry14purinergic receptor P2Y142143372697143413213Rat
2120Anxa5annexin A52119314007119344703Rat
3349Pld1phospholipase D12110849205111047692Rat
620047Il2interleukin 22120004862120009566Rat
2391Cpb1carboxypeptidase B12102755241102785628Rat
68391Pde7aphosphodiesterase 7A2101714767101806853Rat
628779Clrn1clarin 12143084030143130948Rat
620283Foxo1forkhead box O12136312168136390603Rat
631398Kcnmb2potassium calcium-activated channel subfamily M regulatory beta subunit 22114670027114975406Rat
631440Aadacarylacetamide deacetylase2144163436144186086Rat
620961Prkciprotein kinase C, iota2112321919112382305Rat
2390Cpa3carboxypeptidase A32102712483102744219Rat
621356Nudt6nudix hydrolase 62120289908120306197Rat
2387Cpceruloplasmin2102439433102498075Rat
620790Serp1stress-associated endoplasmic reticulum protein 12142757254142761243Rat
621397Ghsrgrowth hormone secretagogue receptor2110268489110271865Rat
621399SkilSKI-like proto-oncogene2112247047112275176Rat
727973Acad9acyl-CoA dehydrogenase family, member 92118943170118966150Rat
620916Pik3caphosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha2115175275115249034Rat
620134Zmat3zinc finger, matrin type 32115106050115136863Rat
621784Tm4sf4transmembrane 4 L six family member 42141570321141621263Rat
2609Fgf2fibroblast growth factor 22120236328120290673Rat
735030Igsf10immunoglobulin superfamily, member 102143575710143605044Rat
708407Pex5lperoxisomal biogenesis factor 5-like2115694868115908338Rat
621117Nlgn1neuroligin 12108256236109181530Rat
620505Crhcorticotropin releasing hormone2102143055102144919Rat
621681P2ry12purinergic receptor P2Y122143481468143523340Rat
621059Ccna2cyclin A22119427239119433645Rat
2483Cyp7b1cytochrome P450 family 7 subfamily B member 12100502791100669713Rat
1303193Sucnr1succinate receptor 12144219066144230568Rat
1304917Arslarylsulfatase L2119038803119047579Rat
1304936Mtfr1mitochondrial fission regulator 12101678331101713547Rat
628734Tnfsf10TNF superfamily member 102110199835110227239Rat
620778Siah2siah E3 ubiquitin protein ligase 22142913924142931752Rat
727802Terctelomerase RNA component2112815654112816041Rat
61973Trpc3transient receptor potential cation channel, subfamily C, member 32119481313119619333Rat
621826Pfn2profilin 22142067102142072938Rat
621785Gyg1glycogenin 12102611888102653916Rat
621276Trpc4transient receptor potential cation channel, subfamily C, member 42138307676138476856Rat
728380Qrfprpyroglutamylated RFamide peptide receptor2119053511119096792Rat
3705Slc2a2solute carrier family 2 member 22111609798111639930Rat
621460Mfn1mitofusin 12115313380115359651Rat
1307509Larp1bLa ribonucleoprotein 1B2123936074123969254Rat
1307812Supt20hSPT20 homolog, SAGA complex component2138897316138930495Rat
68437Dclk1doublecortin-like kinase 12139417234139710956Rat
1304890Ufm1ubiquitin-fold modifier 12137969476137977620Rat
1306920Jade1jade family PHD finger 12124543259124596361Rat
71004Smad9SMAD family member 92138956326139006315Rat
1306044Usp13ubiquitin specific peptidase 132115576912115689153Rat
1306277Ccdc39coiled-coil domain containing 392116665261116703364Rat
1307747Actl6aactin-like 6A2115492374115508401Rat
1307595RGD1307595similar to RIKEN cDNA 1700018B242132570276132573582Rat
1306528Hspa4lheat shock protein family A (Hsp70) member 4 like2123740384123793088Rat
1307384Il21interleukin 212120119598120126941Rat
1310615Mccc1methylcrotonyl-CoA carboxylase subunit 12118799147118851181Rat
1308524Ect2epithelial cell transforming 22109975813110037911Rat
1305900Spartspartin2139292630139319248Rat
1305390Plk4polo-like kinase 42123802512123820942Rat
1309517Rpl22l1ribosomal protein L22 like 12111754687111756623Rat
1305870Pcdh18protocadherin 182133831996133845992Rat
1303283Cog6component of oligomeric golgi complex 62137062127137099176Rat
1307225Egfem1EGF-like and EMI domain containing 12113721236114324547Rat
1305909Ndufb5NADH:ubiquinone oxidoreductase subunit B52115519248115533589Rat
1311090Stoml3stomatin like 32137572691137582402Rat
1311104Nceh1neutral cholesterol ester hydrolase 12110074985110135592Rat
1560498Eif3i-ps1eukaryotic translation initiation factor 3, subunit I, pseudogene 12140669273140670304Rat
1309275Slc7a11solute carrier family 7 member 112134382002134517622Rat
1308862Sec62SEC62 homolog, preprotein translocation factor2112570810112607576Rat
1310984Naa15N(alpha)-acetyltransferase 15, NatA auxiliary subunit2135458018135520756Rat
1311665Ankrd50ankyrin repeat domain containing 502121466275121500758Rat
1308353Rab33bRAB33B, member RAS oncogene family2135528116135538719Rat
1310997MecomMDS1 and EVI1 complex locus2112909353113464583Rat
1309031Hltfhelicase-like transcription factor2102549724102609492Rat
1560393Armc1armadillo repeat containing 12101608173101652180Rat
1310478Spata5spermatogenesis associated 52120306412120497707Rat
1309264Bbs7Bardet-Biedl syndrome 72119434760119474665Rat
1310639Ccna1cyclin A12139231738139278066Rat
1306169Exosc8exosome component 82138930405138937009Rat
1308900Alg5ALG5, dolichyl-phosphate beta-glucosyltransferase2138936998138951228Rat
1305234Ythdf3YTH N(6)-methyladenosine RNA binding protein 329835030498384608Rat
1308177Maml3mastermind-like transcriptional coactivator 32135722585136136975Rat
1305451Bhlhe22basic helix-loop-helix family, member e222100486400100489510Rat
1307888Exosc9exosome component 92119416028119426981Rat
1307889Mynnmyoneurin2112779654112797188Rat
1309403Proser1proline and serine rich 12137542378137561767Rat
1309293Spry1sprouty RTK signaling antagonist 12120557276120561918Rat
1307998Phc3polyhomeotic homolog 32112408709112483719Rat
1310102Hnf4ghepatocyte nuclear factor 4, gamma29788577398036954Rat
1308931Samd7sterile alpha motif domain containing 72112624942112639549Rat
1307100Bltp1bridge-like lipid transfer protein family member 12119708114119924697Rat
1307852Gpr87G protein-coupled receptor 872143439741143440901Rat
1306943Trim55tripartite motif-containing 552102100229102142173Rat
1307531Mrpl47mitochondrial ribosomal protein L472115507842115520093Rat
1309446Intuinturned planar cell polarity protein2123600972123685331Rat
1310132Mfsd8major facilitator superfamily domain containing 82123822042123882913Rat
1310548Hps3HPS3, biogenesis of lysosomal organelles complex 2 subunit 12102484574102527580Rat
1309652Tm4sf1transmembrane 4 L six family member 12141456950141466146Rat
1308804Pgrmc2progesterone receptor membrane component 22124068257124084155Rat
1305285Postnperiostin2138527714138559098Rat
1310585Elf2E74 like ETS transcription factor 22135292291135385942Rat
1309668Dcun1d1defective in cullin neddylation 1 domain containing 12118721275118772606Rat
1306196Eif5a2eukaryotic translation initiation factor 5A22111728587111746087Rat
1310045Ttc14tetratricopeptide repeat domain 142116653543116665072Rat
1311733Fxr1FMR1 autosomal homolog 12116884167116937586Rat
1562486Dnajc5bDnaJ heat shock protein family (Hsp40) member C5 beta2101973726102066275Rat
2071Agtr1bangiotensin II receptor, type 1b2102844969102920232Rat
1561457Actrt3actin-related protein T32112799061112801021Rat
1563943Mcm4-ps1minichromosome maintenance complex component 4, pseudogene 12141550579141554296Rat
1565052Lrrc34leucine rich repeat containing 342112752294112774463Rat
1563109Tmem212transmembrane protein 2122110775950110813313Rat
1561499Lrrc31leucine rich repeat containing 312112702844112725431Rat
1564472Rexo1l1-ps1REX1, RNA exonuclease 1 homolog-like 1, pseudogene 12138834049138838838Rat
1311218Mgst2microsomal glutathione S-transferase 22135679524135715828Rat
1563987Abhd18abhydrolase domain containing 182123872299123920987Rat
1563197Aadacl2arylacetamide deacetylase-like 22144123557144144159Rat
1561998RGD1561998similar to hypothetical protein C130079G132143883313143910452Rat
1560200Gpr160G protein-coupled receptor 1602112483364112563072Rat
1560220Dnajc19DnaJ heat shock protein family (Hsp40) member C192116923272116945312Rat
1559622RGD1559622similar to hypothetical protein C130079G132143761288143800486Rat
1563726Spata16spermatogenesis associated 162109485287109865665Rat
1560053Tbl1xr1TBL1X/Y related 12104788950104929055Rat
1563847Kpna1-ps5karyopherin subunit alpha 1, pseudogene 52125884647125886767Rat
1359321Gnb4G protein subunit beta 42115360746115400680Rat
1559451Erich6glutamate-rich 62142851905142878010Rat
1559609Wwtr1WW domain containing transcription regulator 12141651159141766919Rat
1359508C2h4orf33similar to human chromosome 4 open reading frame 332124764263124830001Rat
1311673Fndc3bfibronectin type III domain containing 3B2110311439110617504Rat
1359128Selenotselenoprotein T2142804387142821438Rat
1359309Adad1adenosine deaminase domain containing 12119948809120005920Rat
628721Sclt1sodium channel and clathrin linker 12124605445124763964Rat
1559967Pkm-ps6pyruvate kinase M1/2, pseudogene 62126044233126045499Rat
1359533LOC365778similar to RIKEN cDNA 1700034I232123877836123880083Rat
1564291Fat4FAT atypical cadherin 42121928188122056711Rat
1560162RGD1560162similar to hypothetical protein C130079G132144077936144098546Rat
1560177Lhfpl6LHFPL tetraspan subfamily member 62137126485137324442Rat
1560081LOC499584LRRGT002022107519605107542884Rat
1311852Kcnmb3potassium calcium-activated channel subfamily M regulatory beta subunit 32115255788115270142Rat
1560324RGD1560324similar to hypothetical protein C130079G132143936599143975506Rat
1359174LOC365791similar to T-cell activation Rho GTPase-activating protein isoform b2133471326133509594Rat
1302941P2ry13purinergic receptor P2Y132143470437143476360Rat
1565351Rfxapregulatory factor X-associated protein2139008052139012235Rat
1566235Rpl36al-ps1ribosomal protein L36A, pseudogene 12141892707141893102Rat
1585689Zfp639zinc finger protein 6392115292431115305798Rat
1585271Gpr171G protein-coupled receptor 1712143360187143366665Rat
1586489Cetn4centrin 42120199951120203311Rat
1561709Rps18-ps2ribosomal protein S18, pseudogene 22118892149118894037Rat
1564926LOC499607similar to GTPase activating protein testicular GAP12131750076131797706Rat
1587573Rpl18a-ps6ribosomal protein L18A, pseudogene 62134326599134329443Rat
1562890RGD1562890RGD15628902102083834102087515Rat
1584592Rrs1-ps9ribosome biogenesis regulator 1 homolog, pseudogene 92102363614102365829Rat
1561719Atp11bATPase phospholipid transporting 11B (putative)2118585348118691076Rat
1561608Bbs12Bardet-Biedl syndrome 122120203396120221024Rat
1564378RGD1564378similar to 60S ribosomal protein L23a2121429593121434236Rat
1565414Nhlrc3NHL repeat containing 32137527843137542258Rat
1565811Pcdh10protocadherin 102128617212128683354Rat
1583489Eif4g1-ps1eukaryotic translation initiation factor 4 gamma 1, pseudogene 12102692061102697515Rat
1561817TnikTRAF2 and NCK interacting kinase2111184352111587993Rat
1563562RGD1563562similar to GTPase activating protein testicular GAP12131029791131092039Rat
1562629Nbeaneurobeachin2139780021140338639Rat
1566012Frem2FRAS1 related extracellular matrix 22137602784137740785Rat
1565646Sox2SRY-box transcription factor 22117536929117539338Rat
1565989RGD1565989similar to FLJ10378 protein2123969408124031645Rat
1588592Prdx1-ps8peroxiredoxin 1, pseudogene 82137826256137826912Rat
1586346Setd7SET domain containing 7, histone lysine methyltransferase2135562683135605468Rat
1589577Sohlh2spermatogenesis and oogenesis specific basic helix-loop-helix 22139362246139384700Rat
1586362Ndufc1NADH:ubiquinone oxidoreductase subunit C12135447067135450950Rat
1586369Mgarpmitochondria-localized glutamic acid-rich protein2135431283135439425Rat
1589984Mab21l1mab-21 like 12139943496139945885Rat
1587344Noctnocturnin2135271189135291407Rat
1587345Hspa8-ps18heat shock protein family A (Hsp70) member 8, pseudogene 182129109508129111050Rat
1590821Dusp14l1dual specificity phosphatase 14-like 12138738130138739538Rat
1591091Dmtf1-ps1cyclin D binding myb-like transcription factor 1, pseudogene 12129668961129671126Rat
1593169Tsc22d2TSC22 domain family, member 22142646778142697977Rat
1593170Ccdc169coiled-coil domain containing 1692139321644139351161Rat
1592212Med12lmediator complex subunit 12L2143253048143576507Rat
1592323Riox2-ps6ribosomal oxygenase 2, pseudogene 62128448551128451089Rat
1589591Eif2aeukaryotic translation initiation factor 2A2142761303142794767Rat
1589592Mrpl54-ps1mitochondrial ribosomal protein L54, pseudogene 12110138456110138965Rat
1588810Commd2COMM domain containing 22141848661141852907Rat
1587056Mapk6-ps1mitogen-activated protein kinase 6, pseudogene 12106158901106167330Rat
1559517Pabpc4lpoly(A) binding protein, cytoplasmic 4-like2129807755129809745Rat
1590660Cnot8-ps1CCR4-NOT transcription complex, subunit 8, pseudogene 12102238885102239831Rat
1585492Ccdc144bcoiled-coil domain containing 144B2118862790118924638Rat
1585003Phgdh-ps5phosphoglycerate dehydrogenase, pseudogene 52120910507120917522Rat
1583237Eif4e-ps6eukaryotic translation initiation factor 4E, pseudogene 62112677634112680165Rat
1582963Eif4a1-ps6eukaryotic translation initiation factor 4A1, pseudogene 62122325531122326261Rat
1589949LOC689629similar to GTPase activating protein testicular GAP12131691178131736078Rat
1565147Naaladl2N-acetylated alpha-linked acidic dipeptidase-like 22106639146107992218Rat
1583267Gpx2-ps1glutathione peroxidase 2, pseudogene 12112645776112646636Rat
1589926Phb1-ps17prohibitin 1, pseudogene 172131812324131822672Rat
1588275Eif4e-ps3eukaryotic translation initiation factor 4E, pseudogene 32136283646136284398Rat
1593206Aldoa-ps6aldolase, fructose-bisphosphate A, pseudogene 62128740774128742056Rat
1593207Phgdh-ps7phosphoglycerate dehydrogenase, pseudogene 72122368911122370490Rat
1593209Rpl7-ps22ribosomal protein L7, pseudogene 222119579381119580218Rat
1592032LOC365803hypothetical LOC3658032144606370144613638Rat
1596195Slc25a31solute carrier family 25 member 312123695387123711275Rat
1597355Sertm1serine-rich and transmembrane domain containing 12139086905139106528Rat
1594062Rnf13ring finger protein 132141927887142061801Rat
1595598LOC678817similar to GTPase activating protein testicular GAP12131215856131280563Rat
1593204Hspa8-ps8heat shock protein family A (Hsp70) member 8, pseudogene 82133005896133007805Rat
1593205Hdac1-ps19Histone deacetylase 1, pseudogene 192132478743132480642Rat
1592058Lgals9-ps1galectin 9, pseudogene 12120683705120684762Rat
1588992LOC685894similar to heterogeneous nuclear ribonucleoprotein A32117500942117501994Rat
1593483Wdr61-ps1WD repeat domain 61, pseudogene 12127443608127444600Rat
1595487Tpm3-ps2tropomyosin 3, pseudogene 229897571098984032Rat
1594375Slc7a14solute carrier family 7, member 142112065286112171319Rat
1594376Pgk1-ps8phosphoglycerate kinase 1, pseudogene 82101036642101038488Rat
1591779Rpl13-ps12ribosomal protein L13, pseudogene 122101949431101950909Rat
1598354Hspa8-ps33heat shock protein family A (Hsp70) member 8, pseudogene 332105493828105495874Rat
2319355Adrm1-ps1ADRM1 26S proteasome ubiquitin receptor, pseudogene 12134333526134334743Rat
2318910C1h15orf40-ps1similar to human chromosome 15 open reading frame 40, pseudogene 12137775820137776319Rat
2319549Samd3-ps1sterile alpha motif domain containing 3, pseudogene 12134161363134162203Rat
2320352Rps13-ps8ribosomal protein S13, pseudogene 82142636554142636927Rat
2322140Nt5c2-ps35'-nucleotidase, cytosolic II, pseudogene 32123256219123257818Rat
2320718LOC100361143ribosomal protein L30-like2100718361100718702Rat
2321502Ewsr1-ps1EWS RNA-binding protein 12127988248127990520Rat
2322289Cnn3-ps1calponin 3, pseudogene 12104303471104304322Rat
2320862Mrpl42-ps2mitochondrial ribosomal protein L42, pseudogene 229879353498794355Rat
2321697Spryd7-ps1SPRY domain containing protein 7, pseudogene 12126157686126158233Rat
2321698Pacrgl-ps1parkin coregulated like, pseudogene 12133152880133154412Rat
2323100Zfp267zinc finger protein 2672119017244119035885Rat
2323202Lrriq4leucine-rich repeats and IQ motif containing 42112729298112756338Rat
2321897Mynn-ps1myoneurin, pseudogene 12123685457123688592Rat
2321898Ran-ps3RAN, member RAS oncogene family, pseudogene 32128705723128707749Rat
2320491Ankub1ankyrin repeat and ubiquitin domain containing 12141857623141894624Rat
2323451Rnps1-ps2RNA binding protein with serine rich domain 1, pseudogene 22118373339118374187Rat
2323618Paics-ps2phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase, pseudogene 229775675197760325Rat
2323670Rsrc2-ps1arginine and serine rich coiled-coil 2, pseudogene 12116424180116425501Rat
2325355Mir551bmicroRNA 551b2113989203113989300Rat
2325576Mir124-2microRNA 124-22100134866100134974Rat
6486316Hnrnpf-ps1heterogeneous nuclear ribonucleoprotein F, pseudogene 12126606819126618488Rat
6501927Cdk1-ps1cyclin-dependent kinase 1, pseudogene 12110685743110688183Rat
6495614Rpl24-ps3ribosomal protein L24, pseudogene 32112399234112405155Rat
6503572Rpl12-ps2ribosomal protein L12, pseudogene 22141784371141785085Rat
6504224Pramel7-ps1preferentially expressed antigen in melanoma-like 7, pseudogene 12118236522118237038Rat
6500885Nono-ps2non-POU domain containing, octamer-binding, pseudogene 22142109424142112044Rat
6501036LOC100909949N-lysine methyltransferase SETD8-like2142289672142292195Rat
7515013LOC102555118uncharacterized LOC1025551182109923841109934955Rat
7523289LOC102547647uncharacterized LOC1025476472112308364112309498Rat
7525762LOC102549474uncharacterized LOC1025494742103096291103101357Rat
7541068LOC102551737cell wall protein PRY3-like2135569573135573180Rat
7507353Nsa2-ps23NSA2 ribosome biogenesis factor, pseudogene 232140781011140781859Rat
7510030Rpl29-ps12ribosomal protein L29, pseudogene 122120447434120447890Rat
7512608LOC102549579uncharacterized LOC1025495792128597382128617081Rat
7516215LOC102555991uncharacterized LOC1025559912131292205131645662Rat
7516893LOC102553773uncharacterized LOC1025537732124459201124469318Rat
7538134LOC102549153uncharacterized LOC1025491532115935747115964267Rat
7631535Nhp2-ps1NHP2 ribonucleoprotein, pseudogene 12137531853137534519Rat
7631924LOC102553085uncharacterized LOC1025530852118767266118780506Rat
7663391LOC102547111uncharacterized LOC1025471112136942896137033178Rat
7664166LOC102552778uncharacterized LOC1025527782139990888139994618Rat
7623948LOC102549721uncharacterized LOC1025497212138182296138232451Rat
7656055LOC102555566uncharacterized LOC1025555662110790193110795730Rat
7642297LOC102550446rho GTPase-activating protein 20-like2133296630133407312Rat
7608682LOC102547718uncharacterized LOC1025477182112309535112312861Rat
7590540LOC102551358uncharacterized LOC1025513582106301790106305272Rat
7573616LOC102550593uncharacterized LOC1025505932123397907123402098Rat
7581938LOC102552324uncharacterized LOC1025523242139569183139577314Rat
7552390LOC102555450uncharacterized LOC1025554502110180475110181932Rat
7608249LOC102546847uncharacterized LOC1025468472136685343136695240Rat
7690977LOC102555656uncharacterized LOC1025556562130948096131285979Rat
7736144LOC102551458uncharacterized LOC1025514582144249483144259818Rat
7726710LOC102552834uncharacterized LOC1025528342139906425139915076Rat
7733168LOC102546477uncharacterized LOC1025464772115436848115439292Rat
9101027LOC10369156360S ribosomal protein L31 pseudogene2132272163132272636Rat
9191676LOC103691547histone H3-like2129998520129998912Rat
9158000LOC103691561activated RNA polymerase II transcriptional coactivator p15 pseudogene2143786767143787385Rat
9202401LOC103691527uncharacterized LOC1036915272116967994117589148Rat
9269847LOC10369511960S ribosomal protein L34 pseudogene2142026133142030412Rat
9271705LOC103691515uncharacterized LOC1036915152101871139101906931Rat
9384455LOC103691533uncharacterized LOC1036915332121577718121606017Rat
9245979LOC103695116serine/arginine-rich splicing factor 3 pseudogene2123371369123371904Rat
9251158LOC103691517uncharacterized LOC1036915172104425901104428062Rat
9251686LOC103691539uncharacterized LOC1036915392131121784131190097Rat
9303217LOC103691520U1 small nuclear ribonucleoprotein C pseudogene2110249020110249711Rat
9437635LOC103691564uncharacterized LOC1036915642135604509135608407Rat
9444651LOC103690087uncharacterized LOC1036900872102968007103010870Rat
9452260LOC10369151960S ribosomal protein L9 pseudogene2104075117104075724Rat
11368573LOC108350015uncharacterized LOC1083500152141852931141862943Rat
11362385Mindy4bMINDY family member 4B2143026685143061966Rat
11356258LOC10835000060S ribosomal protein L26 pseudogene2120769981120770431Rat
11461178LOC10835023760S ribosomal protein L17 pseudogene2110714287110716284Rat
11461857LOC108350212uncharacterized LOC1083502122108700309108722522Rat
11464133LOC108349988uncharacterized LOC1083499882103943205104031795Rat
11465045LOC10835024760S ribosomal protein L35 pseudogene2132271714132272066Rat
11467539Trnay-gua2transfer RNA tyrosine (anticodon GUA) 22102088114102088203Rat
11469315LOC108349999glyceraldehyde-3-phosphate dehydrogenase pseudogene2120637580120646553Rat
11438648LOC108350241uncharacterized LOC1083502412117604873117615829Rat
11440273LOC108349993uncharacterized LOC1083499932117917466117923638Rat
11373430ribosomal protein S6, pseudogene 3""2121167632121248902Rat
11431841Trnar-acg1transfer RNA arginine (anticodon ACG) 12102087287102087359Rat
11453452LOC108349992uncharacterized LOC1083499922117170935117210196Rat
11433166LOC10835024260S ribosomal protein L7a pseudogene2120515068120515888Rat
11417786LOC108350239serine/arginine-rich splicing factor 7 pseudogene2112821804112822748Rat
11423168LOC108350235succinate dehydrogenase [ubiquinone] cytochrome b small subunit, mitochondrial pseudogene2102277631102278359Rat
11425228LOC108350240uncharacterized LOC1083502402116798678116804305Rat
11426711Trnap-ugg2transfer RNA proline (anticodon UGG) 22135401149135401220Rat
11384727Smim43small integral membrane protein 432119366977119386664Rat
11384865LOC108349983uncharacterized LOC10834998329958496799985951Rat
11385321LOC10835000860S ribosomal protein L35a pseudogene2135531741135532151Rat
11386619LOC10835018760S ribosomal protein L39 pseudogene2137421238137421432Rat
11410912Trnav-aac1transfer RNA valine (anticodon AAC) 12112797857112797929Rat
11379162LOC108350184keratin-associated protein 4-4-like2121142630121143406Rat
11380114Rpl7a-ps21ribosomal protein L7a, pseudogene 212143142439143143338Rat
11392116LOC108350009uncharacterized LOC1083500092135662680135667922Rat
11502478LOC108350245uncharacterized LOC1083502452124106720124122168Rat
11483277Trnak-cuu5transfer RNA lysine (anticodon CUU) 52136753070136753142Rat
11513955LOC108350243uncharacterized LOC1083502432120709996120711737Rat
11486967Trnap-agg4transfer RNA proline (anticodon AGG) 42135402136135402207Rat
41320820LOC120101257small nucleolar RNA SNORA512120460702120460834Rat
41355076LOC120101180U6 spliceosomal RNA2118570694118570798Rat
41379557LOC120100831uncharacterized LOC1201008312143363352143370752Rat
41088702LOC120100823uncharacterized LOC1201008232139556313139565405Rat
41112660LOC120101351small nucleolar RNA SNORA172105199664105199775Rat
41206294LOC120101267small nucleolar RNA SNORA482130780074130780217Rat
41251936NEWGENE_40961720transfer RNA tyrosine (anticodon GUA)2102087698102087791Rat
41284427LOC120100576uncharacterized LOC1201005762121636924121653275Rat
41284728LOC120101387U1 spliceosomal RNA2122696074122696229Rat
41325496LOC120100807uncharacterized LOC1201008072123403964123505271Rat
41385681Cul2-ps1cullin 2, pseudogene 12109228805109231740Rat
41091330LOC120100812uncharacterized LOC1201008122128494120128525138Rat
41115179LOC120101292small nucleolar RNA SNORA172120737785120737921Rat
41253353Tgif1-ps1TGFB-induced factor homeobox 1, pseudogene 12144497737144530432Rat
41145339LOC120100824uncharacterized LOC1201008242140835560140873684Rat
41327895Gabarapl2-ps3GABA type A receptor associated protein like 2, pseudogene 32118499300118500311Rat
41328011LOC120101250small nucleolar RNA SNORA42/SNORA80 family2108935155108935294Rat
41092931LOC120093152rho GTPase-activating protein 20-like2133570229133603645Rat
41146639LOC120093098arylacetamide deacetylase-like 22144000814144045928Rat
41174350LOC120100797uncharacterized LOC1201007972115454205115463343Rat
41329676LOC120101218U7 small nuclear RNA2141562874141562937Rat
41095331LOC120101114U2 spliceosomal RNA2103674535103674695Rat
41095389LOC120100799uncharacterized LOC1201007992115921265115935617Rat
41120827LOC120100573uncharacterized LOC1201005732117933586117941915Rat
41175922LOC120101379U1 spliceosomal RNA2112190391112190553Rat
41187843Hspa8-ps28heat shock protein family A (Hsp70) member 8, pseudogene 282112694872112700652Rat
41261916LOC120100829uncharacterized LOC1201008292142219161142229855Rat
41264623LOC120100830uncharacterized LOC1201008302142885611142893347Rat
41366851Rbmxl1-ps1Rbmx like 1, pseudogene 12118217422118225582Rat
41366980LOC120100784spindlin-1-like2104591976104592840Rat
41392418LOC120101116U2 spliceosomal RNA2142505335142505414Rat
41098583Surf6-ps3surfeit 6, pseudogene 32119017398119027282Rat
41179476LOC120101127U4 spliceosomal RNA2134528655134528788Rat
41343568LOC120100819uncharacterized LOC1201008192137269261137286537Rat
41101418LOC120101158U6 spliceosomal RNA2120627911120628017Rat
41156453LOC120100828uncharacterized LOC1201008282142177984142189551Rat
41193090LOC120100789uncharacterized LOC1201007892111022776111026560Rat
41193353Cox16-ps1cytochrome c oxidase assembly factor COX16, pseudogene 12136414089136417675Rat
41216218LOC120100832uncharacterized LOC1201008322144589149144602088Rat
41289236LOC120100802uncharacterized LOC1201008022117368023117386859Rat
41396004LOC120101335small nucleolar RNA SNORA172130664190130664323Rat
41127021LOC120100786uncharacterized LOC1201007862104579402104641521Rat
41183015LOC120101309small nucleolar RNA SNORA172120976196120976326Rat
41370461Pou5f1-ps3POU class 5 homeobox 1, pseudogene 32119087448119088134Rat
41397384LOC120100577uncharacterized LOC1201005772124222575124229453Rat
41398125LOC120101148U6 spliceosomal RNA2139378366139378472Rat
41127827Ssr4-ps1signal sequence receptor subunit 4, pseudogene 12120622463120625865Rat
41183565LOC120100803uncharacterized LOC1201008032117717939117769039Rat
41184903LOC120101169U6 spliceosomal RNA2144435226144435328Rat
41372747LOC120100818uncharacterized LOC1201008182137032199137034329Rat
41373813Fundc2-ps1FUN14 domain containing 2, pseudogene 12123853238123855281Rat
41186814Htd2hydroxyacyl-thioester dehydratase type 22105222958105223419Rat
41105572LOC120101226small nucleolar RNA SNORD222124425037124425161Rat
41163150LOC120100809histone H3.v1-like2124209284124215591Rat
41163397Rpl36-ps10ribosomal protein L36, pseudogene2104583202104583569Rat
41198720LOC120101341small nucleolar RNA SNORA172116803654116803785Rat
41350943LOC120100796uncharacterized LOC1201007962113072218113085970Rat
41375602LOC120101388U1 spliceosomal RNA2109874776109874920Rat
41164169LOC120100568uncharacterized LOC12010056829875975998761425Rat
41164989LOC120101107U2 spliceosomal RNA2131736220131736350Rat
41199834LOC120101329small nucleolar RNA SNORA172109994487109994611Rat
41275022LOC120101339small nucleolar RNA SNORA1729773968397739817Rat
41320266LOC120100791uncharacterized LOC1201007912111084532111099039Rat
41377065LOC120100569uncharacterized LOC1201005692101100447101112987Rat
41403567LOC120101270small nucleolar RNA SNORA482115455806115455946Rat
41109826LOC120100792uncharacterized LOC1201007922111081877111107974Rat
41233265LOC120100814rho GTPase-activating protein 20-like2133422096133454718Rat
40946467LOC120100827uncharacterized LOC1201008272142355389142413239Rat
40947213LOC120100822uncharacterized LOC1201008222139451181139455877Rat
40974057LOC120100811uncharacterized LOC1201008112125776559125802118Rat
40951160LOC120100793uncharacterized LOC1201007932112464844112475848Rat
40975337LOC120100815rho GTPase-activating protein 20-like2133520135133559812Rat
40952217NEWGENE_40934091transfer RNA alanine (anticodon AGC)2138840829138840903Rat
41012974LOC12010057840S ribosomal protein S21-like2125345379125346298Rat
40954669LOC120100816uncharacterized LOC1201008162134801684134810909Rat
40977691LOC120101306small nucleolar RNA SNORA172134854326134854445Rat
41014742LOC120100794uncharacterized LOC1201007942112624574112639790Rat
40927050LOC120100572uncharacterized LOC1201005722112859750112862038Rat
40999832LOC120101356small nucleolar RNA SNORA172137598603137598719Rat
40930350LOC120101259small nucleolar RNA SNORA482115082698115082841Rat
40957973LOC120101264small nucleolar RNA SNORA482101035275101035413Rat
40982245Med14-ps2mediator complex subunit 14, pseudogene 22103120850103132587Rat
40931824LOC120101231small nucleolar RNA SNORA702115536406115536531Rat
40958534Arpc1a-ps1actin related protein 2/3 complex, subunit 1A, pseudogene 129958158399583561Rat
40958933LOC120101297small nucleolar RNA SNORA172112863681112863811Rat
40960807LOC120100778uncharacterized LOC1201007782100126406100138972Rat
40934532LOC120100798uncharacterized LOC1201007982115875669115907955Rat
40936546LOC120100826uncharacterized LOC1201008262142100003142122325Rat
40963518Tvp23b-ps2trans-golgi network vesicle protein 23 homolog B, pseudogene 22131442186131449289Rat
40964933NEWGENE_40926764transfer RNA proline (anticodon AGG)2142013652142013733Rat
40964986Trnaa-ggctransfer RNA alanine (anticodon GGC)2138866655138866735Rat
41010119LOC120100800uncharacterized LOC1201008002116825354116880012Rat
40992880LOC120100820uncharacterized LOC1201008202138991377138999932Rat
40992991LOC120101332small nucleolar RNA SNORA1729920127799201403Rat
40993430Thumpd1-ps1THUMP domain containing 1, pseudogene 12119841868119842977Rat
40969953Rpl15-ps12ribosomal protein L15, pseudogene 122111062794111073127Rat
40995327Rab5c-ps1RAB5C, member RAS oncogene family, pseudogene 12101841519101843700Rat
41047054LOC120100783uncharacterized LOC1201007832104142697104168971Rat
41242725LOC120100810uncharacterized LOC1201008102124384875124400228Rat
41311750LOC120101269small nucleolar RNA SNORA482104246207104246348Rat
41024370LOC120101133U4 spliceosomal RNA2144593202144593324Rat
41024587LOC120100780uncharacterized LOC1201007802101807523101830044Rat
41049202LOC120101089uncharacterized LOC1201010892111173736111184657Rat
41026528LOC120100787uncharacterized LOC1201007872110168359110176379Rat
41050540LOC120100781uncharacterized LOC1201007812102111026102124407Rat
41050852LOC120100821specifically androgen-regulated gene protein-like2139242890139244131Rat
41079209LOC120100795uncharacterized LOC1201007952112654970112670357Rat
41318849LOC120101275small nucleolar RNA SNORA482107574094107574240Rat
41053528Zfp296-ps1zinc finger protein 296, pseudogene 12104997253104998556Rat
41136118LOC120101396U1 spliceosomal RNA2130425871130426046Rat
41143528LOC120101334small nucleolar RNA SNORA172122823020122823149Rat
41338786LOC120100825uncharacterized LOC1201008252141606147141636054Rat
41338792LOC120101249small nucleolar RNA SNORA4429982670099826807Rat
41055679LOC120101273small nucleolar RNA SNORA482116165324116165449Rat
41016982Eif2s3-ps1eukaryotic translation initiation factor 2 subunit gamma, pseudogene 129967190399686497Rat
41065891Hnrnpk-ps3heterogeneous nuclear ribonucleoprotein K, pseudogene 329955215599552870Rat
41066188LOC120100788uncharacterized LOC1201007882110414980110421799Rat
41237368LOC120101340small nucleolar RNA SNORA172140311336140311463Rat
41043122LOC120101398U2 spliceosomal RNA2105678120105678309Rat
41043477LOC120100804uncharacterized LOC1201008042118573599118581782Rat
41068108LOC120101285small nucleolar RNA SNORA172129578379129578510Rat
41069193Gapdh-ps85Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 852109075012109075960Rat
41307398LOC120100579uncharacterized LOC1201005792130410255130411375Rat
41307645LOC120101174U6 spliceosomal RNA2102241494102241597Rat
41021129Ppid-ps11peptidylprolyl isomerase D, pseudogene 112117022912117024754Rat
41045573LOC120100575uncharacterized LOC1201005752121117806121124162Rat
41073287LOC120100782uncharacterized LOC1201007822103099138103118399Rat
41074493Prpf38a-ps1pre-mRNA processing factor 38A, pseudogene 12100370140100371030Rat
41310748LOC120101266small nucleolar RNA SNORA482109290944109291087Rat
41022771LOC120101343small nucleolar RNA SNORA172140617246140617361Rat
3639Scnn1asodium channel epithelial 1 subunit alpha4158122962158146184Rat
3651Cxcl12C-X-C motif chemokine ligand 124150388326150401173Rat
61807Foxm1forkhead box M14161639561161652012Rat
3552Reg1aregenerating family member 1 alpha4110892451110895115Rat
3573Rhorhodopsin4148975597148988693Rat
2738Grin2bglutamate ionotropic receptor NMDA type subunit 2B4168580824169044110Rat
3594Rpn1ribophorin I4120543667120565069Rat
3706Slc2a3solute carrier family 2 member 34155960944156026000Rat
62022Tmsb10thymosin, beta 104105009959105011095Rat
619983C1scomplement C1s4157430249157442438Rat
3960Vhlvon Hippel-Lindau tumor suppressor4146772483146779376Rat
71067Gpr27G protein-coupled receptor 274132328364132329497Rat
2953Kcna5potassium voltage-gated channel subfamily A member 54159354689159358173Rat
3180Klrk1killer cell lectin like receptor K14163079887163092434Rat
3726Smosmoothened, frizzled class receptor45834410158372828Rat
3253Cntn3contactin 34134841268135214460Rat
2773Gys2glycogen synthase 24175365054175406228Rat
68332Pde1cphosphodiesterase 1C48530085885777948Rat
70547Crhr2corticotropin releasing hormone receptor 248422289784265924Rat
2554Eno2enolase 24157572085157580971Rat
61296Aoc1amine oxidase, copper containing 147781226077831846Rat
2316Cd8aCD8a molecule4103365804103370041Rat
2317Cd8bCD8b molecule4103312596103328523Rat
2318Cd9CD9 molecule4158256328158289136Rat
70884Eif2ak3eukaryotic translation initiation factor 2 alpha kinase 34102805495102866914Rat
2141Aqp1aquaporin 148448251284494690Rat
2814Hoxa4homeo box A448128967781291685Rat
2256Cald1caldesmon 146326578163446936Rat
69274Casp2caspase 247114963271167388Rat
619998Tmem150atransmembrane protein 150A4104410271104414630Rat
3256Reg3gregenerating family member 3 gamma4110922805110927803Rat
3444Ptnpleiotrophin46529373165375572Rat
619907Serbp1Serpine1 mRNA binding protein 149640158796421816Rat
2797Hk2hexokinase 24115234509115283530Rat
3903Trhthyrotropin releasing hormone4124742111124777094Rat
61978Klrg1killer cell lectin like receptor G14155455465155467301Rat
70918Klf15Kruppel-like factor 154122965718122978403Rat
70938Il5rainterleukin 5 receptor subunit alpha4139630652139664593Rat
70998Fxyd4FXYD domain-containing ion transport regulator 44151109779151113659Rat
71008Gpnmbglycoprotein nmb47801024778031491Rat
69335Trpv6transient receptor potential cation channel, subfamily V, member 647050734770523013Rat
69339Nup210nucleoporin 2104123511559123609874Rat
2096Alox5arachidonate 5-lipoxygenase4149531329149578696Rat
2947Kapkidney androgen regulated protein4166674595166677639Rat
2830Hrh1histamine receptor H 14147564781147649353Rat
2854Iappislet amyloid polypeptide4175237013175244373Rat
619728Ntf3neurotrophin 34158914984158984453Rat
3092Mitfmelanocyte inducing transcription factor4130409020130621145Rat
3413Prp15proline-rich protein 154165740611165832004Rat
620064Chd4chromodomain helicase DNA binding protein 44157898503157931632Rat
3455Ptprz1protein tyrosine phosphatase, receptor type Z145139731651595220Rat
3896Tpi1triosephosphate isomerase 14157615283157618813Rat
2771Gucy2cguanylate cyclase 2C4169568505169649092Rat
69300Slco1b2solute carrier organic anion transporter family member 1B24174551463174619988Rat
69304Slco1a6solute carrier organic anion transporter family, member 1a64175072143175107950Rat
69062Cdkn1bcyclin-dependent kinase inhibitor 1B4167760067167765177Rat
620023Chrm2cholinergic receptor, muscarinic 246501540865149104Rat
620026Il12rb2interleukin 12 receptor subunit beta 249642461596515327Rat
3197Npyneuropeptide Y47888129478888495Rat
3760Ssbp1single stranded DNA binding protein 146926602469276135Rat
3787Abcc9ATP binding cassette subfamily C member 94175531854175655849Rat
3371Ppargperoxisome proliferator-activated receptor gamma4148423102148548471Rat
2664Gata2GATA binding protein 24120654205120667763Rat
69079Wnt7aWnt family member 7A4123863108123908981Rat
2933Itpr1inositol 1,4,5-trisphosphate receptor, type 14141187377141554240Rat
2245Cacna1ccalcium voltage-gated channel subunit alpha1 C4151764138152379454Rat
2271Capza3capping actin protein of muscle Z-line subunit alpha 34172929273172930486Rat
2281Cav3caveolin 34145582168145598142Rat
2975Klrb1bkiller cell lectin-like receptor subfamily B member 1B4161949061161961505Rat
2977Klrc2killer cell lectin like receptor C24163122700163133843Rat
68439Bhlhe40basic helix-loop-helix family, member e404141618453141624154Rat
68393Kcnd2potassium voltage-gated channel subfamily D member 244977581250277746Rat
2176Atp2b2ATPase plasma membrane Ca2+ transporting 24146896332147140665Rat
2654Gadd45agrowth arrest and DNA-damage-inducible, alpha49615478996157091Rat
2661Gapdhglyceraldehyde-3-phosphate dehydrogenase4157962312157967158Rat
3679St8sia1ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 14175782989175921338Rat
2038Adcyap1r1ADCYAP receptor type I48459355884642700Rat
2042Add2adducin 24118444594118538505Rat
3239Oxtroxytocin receptor4145598549145614674Rat
628765Gimap4GTPase, IMAP family member 447763640177643315Rat
621878Podxlpodocalyxin-like46013512460181829Rat
628797Prpmp5proline-rich protein MP54165537147165540256Rat
628850Wnt5bWnt family member 5B4152609566152733790Rat
621062Clec4fC-type lectin domain family 4, member F4116129023116138744Rat
620280Prok2prokineticin 24132346681132361754Rat
708437Prss3bprotease, serine, 3B46987181069875518Rat
708443Prokr1prokineticin receptor 14120022301120033379Rat
621237Tnfrsf1aTNF receptor superfamily member 1A4158150815158163592Rat
620736Tas2r107taste receptor, type 2, member 1074165299663165300589Rat
620737Tas2r114taste receptor, type 2, member 1144165358191165359120Rat
620740Tas2r13taste receptor, type 2, member 134166078913166079857Rat
620231Pik3c2gphosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma4172483752172851623Rat
621133Vax2ventral anterior homeobox 24116195576116219597Rat
629473Camk1calcium/calmodulin-dependent protein kinase I4146481196146492039Rat
631345Abcg2ATP binding cassette subfamily G member 248767624187802757Rat
632283Ghrlghrelin and obestatin prepropeptide4146865712146869621Rat
727853Tas2r126taste receptor, type 2, member 12647133382171334747Rat
71039Mgllmonoglyceride lipase4121192187121294187Rat
628669Ly49i2Ly49 inhibitory receptor 24164470840164495461Rat
620718Arhgef5Rho guanine nucleotide exchange factor 547208720572112316Rat
2360Clcn1chloride voltage-gated channel 147117194971201483Rat
628660Slco1c1solute carrier organic anion transporter family, member 1c14174466621174513290Rat
621168Ogg18-oxoguanine DNA glycosylase4146474701146481959Rat
620480Cand2cullin-associated and neddylation-dissociated 2 (putative)4148835050148864039Rat
621700Sftpbsurfactant protein B4104359303104368439Rat
628871Gimap5GTPase, IMAP family member 547769341777701025Rat
621278Arf5ADP-ribosylation factor 545703852157041447Rat
621294Aldh1l1aldehyde dehydrogenase 1 family, member L14123059989123106471Rat
621668Grip2glutamate receptor interacting protein 24124271456124356538Rat
3811Tacr1tachykinin receptor 14114920844115089733Rat
628796Prb1proline-rich protein BstNI subfamily 14165509269165512387Rat
620383Calucalumenin45794908657976589Rat
620386Prb3proline-rich protein BstNI subfamily 34165564424165569229Rat
620070Clec2dC-type lectin domain family 2, member D4162216052162239530Rat
620076Mkln1muskelin 145981591260124047Rat
708509Vom1r90vomeronasal 1 receptor 904122139053122148056Rat
628685Fbln2fibulin 24123704289123763857Rat
620229Zfp422zinc finger protein 4224149885805149893287Rat
620408N5DNA binding protein N545890039858902597Rat
620419Vamp5vesicle-associated membrane protein 54104423813104435059Rat
620660Ptpn6protein tyrosine phosphatase, non-receptor type 64157526034157550783Rat
3000Lepleptin45766112757675262Rat
628707Zfand4zinc finger AN1-type containing 44149327339149399490Rat
628724LipogeninLipogenin45735629857357553Rat
621175Plekha5pleckstrin homology domain containing A54173333891173503546Rat
2997Ldhblactate dehydrogenase B4175428382175446403Rat
620257Akr1b7aldo-keto reductase family 1, member B746305356063100934Rat
68321Sec61a1SEC61 translocon subunit alpha 14120973519120987871Rat
2451Cycscytochrome c, somatic47965189479653994Rat
621452Klrh1killer cell lectin-like receptor subfamily H, member 14163288228163301977Rat
2590Fabp1fatty acid binding protein 14103191015103194791Rat
3826Tbxas1thromboxane A synthase 146766496367837096Rat
61919Slc13a1solute carrier family 13 member 145256917952647126Rat
708344Gnb3G protein subunit beta 34157639468157645171Rat
708346Zfp384zinc finger protein 3844157810263157840052Rat
620547Spam1sperm adhesion molecule 145330274553312913Rat
628694Zc3hav1zinc finger CCCH-type containing, antiviral 146701215167062406Rat
620468Igkv28immunoglobulin kappa chain variable 284101302903101303452Rat
620159Skap2src kinase associated phosphoprotein 248094883281100900Rat
620160BidBH3 interacting domain death agonist4154113198154136353Rat
620172Frmd4bFERM domain containing 4B4129895401130222070Rat
620551Tmf1TATA element modulatory factor 14129759952129785705Rat
620552Ninj2ninjurin 24153306439153408618Rat
727874Rtknrhotekin4115640801115657952Rat
620130Fgf6fibroblast growth factor 64159854913159863447Rat
621605Nat8bN-acetyltransferase 8B4118359445118364351Rat
708572Arl6ip5ADP-ribosylation factor like GTPase 6 interacting protein 54129810650129838628Rat
620445Tgoln2trans-golgi network protein 24104663356104671208Rat
620698Zyxzyxin47123676771246553Rat
620421Vamp8vesicle-associated membrane protein 84104442383104452884Rat
727880Tas2r123taste receptor, type 2, member 1234166276923166277924Rat
621361Cntn4contactin 44138624584139622499Rat
621366Mug1murinoglobulin 14155076270155130051Rat
621516Gng12G protein subunit gamma 1249601111896134767Rat
735018Bpgmbisphosphoglycerate mutase46313973063168581Rat
735022Vom2r52vomeronasal 2 receptor, 524156918262156956543Rat
620533Slc6a1solute carrier family 6 member 14147448961147482295Rat
619835Pdia4protein disulfide isomerase family A, member 447680319876822245Rat
2546Egr4early growth response 44118047869118050328Rat
620735Tas2r118taste receptor, type 2, member 11845244920852450107Rat
3418Prss2protease, serine, 247027830470283385Rat
620140Chn2chimerin 248314861683407711Rat
620741Tas2r105taste receptor, type 2, member 1054165354682165355611Rat
2688Ghrhrgrowth hormone releasing hormone receptor48449815984532847Rat
620960Hint1-ps1histidine triad nucleotide binding protein 1, pseudogene 149210099492101568Rat
62083Kcna6potassium voltage-gated channel subfamily A member 64159542941159576189Rat
3155Ndufa5NADH:ubiquinone oxidoreductase subunit A545299732753005685Rat
628733Erc1ELKS/RAB6-interacting/CAST family member 14152763664153055706Rat
628737Slc6a11solute carrier family 6 member 114147297972147413319Rat
3531Raf1Raf-1 proto-oncogene, serine/threonine kinase4148679534148740265Rat
2960Kcnj8potassium inwardly-rectifying channel, subfamily J, member 84175508908175515829Rat
628802Retsatretinol saturase4104653306104662069Rat
621153Clstn3calsyntenin 34157331494157364769Rat
708579Tax1bp1Tax1 binding protein 148182199181877906Rat
621203Rpl32ribosomal protein L324148864048148867612Rat
2976Klrc1killer cell lectin like receptor C14163142142163152425Rat
2978Klrd1killer cell lectin like receptor D14163044920163056568Rat
631379Cyp26b1cytochrome P450, family 26, subfamily b, polypeptide 14117041808117058628Rat
621056Ybx3Y box binding protein 34165129747165153101Rat
620433Pax4paired box 445705845357065995Rat
68373Ruvbl1RuvB-like AAA ATPase 14120932486120967400Rat
68383Ggcxgamma-glutamyl carboxylase4104469737104485631Rat
619821Suclg1succinate-CoA ligase GDP/ADP-forming subunit alpha4105308236105337595Rat
619806Mtpnmyotrophin46415927364186686Rat
727903Klre1killer cell lectin-like receptor, family E, member 14163032938163041641Rat
708351Kdm3alysine demethylase 3A4103630907103675073Rat
61832Atn1atrophin 14157554287157568092Rat
1304680Epha1Eph receptor A147124640971260920Rat
621707Pbp2phosphatidylethanolamine binding protein 24168155827168157121Rat
628647Ppp1r17protein phosphatase 1, regulatory subunit 1748521359585230607Rat
3417Prss1serine protease 147036458970367792Rat
620537C3ar1complement C3a receptor 14156074747156084680Rat
621759Vwfvon Willebrand factor4158360152158491539Rat
621387Slco1a3solute carrier organic anion transporter family member 1A34174975119175018640Rat
621609Nat8N-acetyltransferase 84118279521118284671Rat
1303230Senp18Sumo1/sentrin/SMT3 specific peptidase 184161066262161067689Rat
621084Uba3ubiquitin-like modifier activating enzyme 34129789526129810707Rat
620788Slc6a13solute carrier family 6 member 134154539246154577784Rat
1304581Hebp1heme binding protein 14167974318168003859Rat
620515Olr1oxidized low density lipoprotein receptor 14162926436162949057Rat
619848Gpr37G protein-coupled receptor 3745413886054160927Rat
619857Grm7glutamate metabotropic receptor 74143730862144613230Rat
619858Grm8glutamate metabotropic receptor 845580576256731690Rat
62068Ptproprotein tyrosine phosphatase, receptor type, O4170164071170374790Rat
621607Nat8f3N-acetyltransferase 8 (GCN5-related) family member 34118241792118246010Rat
1303251Mkrn1makorin ring finger protein 146817590968197216Rat
2306Cd4Cd4 molecule4157668878157695366Rat
70927Mgst1microsomal glutathione S-transferase 14171029666171044893Rat
620636Trpv5transient receptor potential cation channel, subfamily V, member 547053643270562743Rat
620471Sox5SRY-box transcription factor 54176781375177736833Rat
1303238Atp6v0e2ATPase, H+ transporting V0 subunit e247748486877488016Rat
735014Gkn1gastrokine 14119790101119795389Rat
621389Slco1a4solute carrier organic anion transporter family, member 1a44174710004174764810Rat
708585LOC286960preprotrypsinogen IV46981510769826206Rat
620178Fgf23fibroblast growth factor 234159914393159922073Rat
621083Ccnd2cyclin D24159966883159989261Rat
2949Kcna1potassium voltage-gated channel subfamily A member 14159464223159472905Rat
71045Gpr19G protein-coupled receptor 194167710944167739232Rat
1304825Fam136afamily with sequence similarity 136, member A4118805129118811046Rat
620366Hnrnpfheterogeneous nuclear ribonucleoprotein F4151083262151104464Rat
628643Pzppregnancy-zone protein4161759176161805271Rat
1304876Ggctgamma-glutamyl cyclotransferase48412292184129327Rat
621171Anxa4annexin A44119184378119241183Rat
620738Tas2r121taste receptor, type 2, member 1214165987429165988346Rat
708391Vom1r97vomeronasal 1 receptor 974122361863122364034Rat
620255Slc6a12solute carrier family 6 member 124154585386154603750Rat
70985Slco1a5solute carrier organic anion transporter family, member 1A54175172390175254598Rat
621529Ptmsparathymosin4157722384157726575Rat
70946Pipprolactin induced protein47078762770791921Rat
620586Rnf103ring finger protein 1034103526456103542529Rat
620609Hoxa5homeo box A548130234181306234Rat
628706Sfxn5sideroflexin 54117750213117869826Rat
1303047Fscn3fascin actin-bundling protein 345704279757052224Rat
1303054Prss58serine protease 5846975265169757306Rat
3023Klra22killer cell lectin-like receptor subfamily A, member 224164036378164057805Rat
1304817Atg7autophagy related 74147718663147925656Rat
620875St3gal5ST3 beta-galactoside alpha-2,3-sialyltransferase 54104134553104192560Rat
735134Klra5killer cell lectin-like receptor, subfamily A, member 54164761839164824367Rat
2133Apobec1apolipoprotein B mRNA editing enzyme catalytic subunit 14155800030155828515Rat
1304561Chchd6coiled-coil-helix-coiled-coil-helix domain containing 64121803501122024209Rat
1302947Prss59protease, serine 5946976420669785111Rat
1302962Mug2murinoglobulin 24155164061155236765Rat
1304952PianpPILR alpha associated neural protein4157796425157804842Rat
708384Vom1r102vomeronasal 1 receptor 1024122536742122545602Rat
708395Vom1r101vomeronasal 1 receptor 1014122499102122500235Rat
708399Hibadh3-hydroxyisobutyrate dehydrogenase48164918081747244Rat
708403Tmem176btransmembrane protein 176B47776692877774740Rat
61318Cd69Cd69 molecule4162725446162733364Rat
708475Akr1b8aldo-keto reductase family 1, member B846299724163009815Rat
2004A2malpha-2-macroglobulin4154897770154947787Rat
61912Slc6a6solute carrier family 6 member 64124195186124268880Rat
1302936C1rlcomplement C1r subcomponent like4157394183157410771Rat
735188Gstk1glutathione S-transferase kappa 147111897971123298Rat
1303009Slc4a5solute carrier family 4 member 54115710101115810330Rat
1303339Clec4dC-type lectin domain family 4, member D4156589591156598969Rat
708556Chmp3charged multivesicular body protein 34103576453103622566Rat
2552Emp1epithelial membrane protein 14168212901168233039Rat
620858Tpra1transmembrane protein adipocyte associated 14121364093121375275Rat
3201Nr2c2nuclear receptor subfamily 2, group C, member 24124610216124666813Rat
3254Reg3bregenerating family member 3 beta4110861775110865015Rat
621141Wnk1WNK lysine deficient protein kinase 14153128334153253905Rat
620752Akr1d1aldo-keto reductase family 1, member D146615424666187505Rat
1304592C2cd5C2 calcium-dependent domain containing 54175969544176055597Rat
1304910Zfp775zinc finger protein 77547755703777575296Rat
62008Cntn6contactin 64137354886137751712Rat
621606Nat8f1N-acetyltransferase 8 (GCN5-related) family member 14118336208118342923Rat
621401Reg3aregenerating islet-derived 3 alpha4110872398110875157Rat
69240Mogsmannosyl-oligosaccharide glucosidase4115621623115625026Rat
621610Nat8f5N-acetyltransferase 8 (GCN5-related) family member 54118260323118285038Rat
620867Sval1seminal vesicle antigen-like 147084522870856192Rat
620869Sval2seminal vesicle antigen-like 247080936670813330Rat
735071RSA-14-44RSA-14-44 protein49525165795253029Rat
621033Opn1swopsin 1, short wave sensitive45797731757980457Rat
1304603Nrf1nuclear respiratory factor 145866493258772328Rat
735193Fam3cFAM3 metabolism regulating signaling molecule C45083992950887276Rat
621791Exoc4exocyst complex component 446180770662584316Rat
621797Dnah6dynein, axonemal, heavy chain 64105064123105284361Rat
3729Sncasynuclein alpha48969642089797240Rat
3798Syn2synapsin II4148178846148347010Rat
3849Tgfatransforming growth factor alpha4118618043118700897Rat
61908Rab7aRAB7A, member RAS oncogene family4120461966120510756Rat
1304616Nop2NOP2 nucleolar protein4157932731157944462Rat
61815Npvfneuropeptide VF precursor47971252079716236Rat
69251Hpgdshematopoietic prostaglandin D synthase49436842694397931Rat
619908BrafB-Raf proto-oncogene, serine/threonine kinase46837548468510652Rat
620824Polr1aRNA polymerase I subunit A4103950051104014022Rat
628652Pcyox1prenylcysteine oxidase 14118832114118842951Rat
628729Fkbp4FKBP prolyl isomerase 44161703379161711833Rat
735230Washc2cWASH complex subunit 2C4149267851149325850Rat
620122Chl1cell adhesion molecule L1-like4136291504136505830Rat
68368Grid2glutamate ionotropic receptor delta type subunit 249241501993892472Rat
1304740Tspan9tetraspanin 94160813879160995574Rat
3948Vamp1vesicle-associated membrane protein 14158012634158019350Rat
3088Mgpmatrix Gla protein4169766290169769612Rat
735130Doxl2diamine oxidase-like protein 247793455177938333Rat
621807CnbpCCHC-type zinc finger, nucleic acid binding protein4120302768120311694Rat
1304842Mtmr14myotubularin related protein 144146386949146429990Rat
62038Dctn1dynactin subunit 14115671024115703824Rat
1307803Herc3HECT and RLD domain containing E3 ubiquitin protein ligase 348795220288042492Rat
1306271RGD1306271similar to KIAA1549 protein46684067466968407Rat
1305008Suclg2succinate-CoA ligase GDP-forming subunit beta4128067031128337146Rat
1306723Prickle2prickle planar cell polarity protein 24124869552125214862Rat
1305577Mcm2minichromosome maintenance complex component 24121346434121360962Rat
1307233Aebp2AE binding protein 24173527881173593100Rat
1305851Tex261testis expressed 2614116253547116260730Rat
1306012Klf14Kruppel-like factor 1445955401159556933Rat
1304792Gcfc2GC-rich sequence DNA-binding factor 24114481613114519268Rat
1304799Dguokdeoxyguanosine kinase4115987101116014733Rat
2388Cpa1carboxypeptidase A145925741759263544Rat
1305589Fgd5FYVE, RhoGEF and PH domain containing 54124497061124594564Rat
1307014Mob1aMOB kinase activator 1A4115831581115848561Rat
1305699P3h3prolyl 3-hydroxylase 34157646238157662035Rat
1306392Il17rcinterleukin 17 receptor C4146618321146631444Rat
1305742Tia1TIA1 cytotoxic granule-associated RNA binding protein4118852765118883252Rat
1305105Smyd1SET and MYND domain containing 14103195330103252989Rat
1305815Podxl2podocalyxin-like 24121306224121338070Rat
1306040Creb3l2cAMP responsive element binding protein 3-like 246590757066112078Rat
1306053Necap1NECAP endocytosis associated 14156103935156119068Rat
1306408Elmod3ELMO domain containing 34104614665104653122Rat
1307307Ndufa9NADH:ubiquinone oxidoreductase subunit A94159659242159688034Rat
1305563Cpa2carboxypeptidase A245916035759183677Rat
1307076Cntnap2contactin associated protein 247410945576366434Rat
1307077RybpRING1 and YY1 binding protein4132876260132929075Rat
1307077RybpRING1 and YY1 binding protein4132876361132927580Rat
1305760XpcXPC complex subunit, DNA damage recognition and repair factor4123993670124020922Rat
1306746RGD1306746similar to Hypothetical protein MGC255294118887688118916808Rat
1306750RGD1306750LOC3624514165928441165931317Rat
1303098Cpa5carboxypeptidase A545922975459249503Rat
1307312Ppp4r2protein phosphatase 4, regulatory subunit 24133454555133495486Rat
61942Pde3aphosphodiesterase 3A4174172804174443944Rat
1306985Bcl2l13Bcl2-like 134154056116154112890Rat
1306993Rad18RAD18 E3 ubiquitin protein ligase4145735654145821102Rat
1306278Zfp282zinc finger protein 28247688492476911370Rat
1302990Lag3lymphocyte activating 34157712665157722229Rat
1307582Rpusd3RNA pseudouridine synthase D34146553230146562794Rat
1306294Mlf2myeloid leukemia factor 24157739651157744325Rat
1306422Cct7chaperonin containing TCP1 subunit 74117989232118006478Rat
1309939Sumf1sulfatase modifying factor 14141078735141160711Rat
1308857Trnt1tRNA nucleotidyl transferase 14139681115139703611Rat
1307065Mrpl35mitochondrial ribosomal protein L354103865812103876687Rat
1307592Lin28clin-28 homolog C (C. elegans)49541756695420497Rat
1306546Gsg1germ cell associated 14168090773168107039Rat
1305055Atp6v0a4ATPase H+ transporting V0 subunit a446676015966842110Rat
1305057NagkN-acetylglucosamine kinase4116281179116293870Rat
1305060Ctnna2catenin alpha 24109293978110443413Rat
1305082Prp2proline rich protein 24165600085165603662Rat
727860Asb15ankyrin repeat and SOCS box containing 1545302155353050846Rat
1307688Isy1ISY1 splicing factor homolog4120276535120297227Rat
1306557Hdhd5haloacid dehalogenase like hydrolase domain containing 54153701026153753303Rat
1306559Il17rainterleukin 17 receptor A4153667534153690174Rat
1304749Lrp6LDL receptor related protein 64167266581167400155Rat
1304779Lrrc23leucine rich repeat containing 234157581285157592188Rat
1304879Zfp956zinc finger protein 95647694323976967238Rat
1307612Pex5peroxisomal biogenesis factor 54157270671157296432Rat
1304961Wbp1WW domain binding protein 14115625168115627567Rat
735144WaslWASP like actin nucleation promoting factor45308353653132061Rat
1307730Nfe2l3NFE2 like bZIP transcription factor 348050675680534629Rat
1306456Art4ADP-ribosyltransferase 44169740331169751571Rat
1310610Shq1SHQ1, H/ACA ribonucleoprotein assembly factor4133213357133305586Rat
3753Sprsepiapterin reductase4117671948117676292Rat
1305041Gimap6GTPase, IMAP family member 647765370377659112Rat
735157Atp6v1e1ATPase H+ transporting V1 subunit E14154022360154044486Rat
735049Dgkidiacylglycerol kinase, iota46541087865872733Rat
727871Gsdmegasdermin E47925879979321129Rat
1308770Mrps25mitochondrial ribosomal protein S254124668320124680086Rat
1306697Wdr91WD repeat domain 9146355436463591733Rat
735181Prr4proline rich 44166605104166608901Rat
1307624Borcs5BLOC-1 related complex subunit 54167458640167543556Rat
1306030Atf7ipactivating transcription factor 7 interacting protein4169385872169471652Rat
1306645Znrf2zinc and ring finger 248395040684032676Rat
1307038Dusp11dual specificity phosphatase 114118367673118385183Rat
1306800Dyrk4dual specificity tyrosine phosphorylation regulated kinase 44159715658159757660Rat
1306777Gimap1GTPase, IMAP family member 147768758177691468Rat
1307785Rassf4Ras association domain family member 44149897525149932658Rat
1305836Rasgef1aRasGEF domain family, member 1A4151187533151267982Rat
1305250Pdzrn3PDZ domain containing RING finger 34133770736133996959Rat
1307437Gpr162G protein-coupled receptor 1624157662200157668341Rat
1303123Apold1apolipoprotein L domain containing 14167768437167825706Rat
1305424Tspan11tetraspanin 114160738149160805522Rat
2027Actg2actin gamma 2, smooth muscle4116021832116046475Rat
708559Wipf3WAS/WASL interacting protein family, member 348355007583629929Rat
1305523Fbxl14F-box and leucine-rich repeat protein 144152662542152666360Rat
1307793Pole4DNA polymerase epsilon 4, accessory subunit4115165285115171097Rat
1306709Mrpl53mitochondrial ribosomal protein L534115615329115616219Rat
1305383ArhgdibRho GDP dissociation inhibitor beta4169822951169841884Rat
1310447Irf5interferon regulatory factor 545812757758140665Rat
1333950Olr808olfactory receptor 80847174019371741149Rat
1311102Tspan12tetraspanin 1245031376850389246Rat
1311108Impdh1inosine monophosphate dehydrogenase 145780184257817434Rat
1334150Olr822-psolfactory receptor pseudogene 8224105479255105480121Rat
1308628Parp12poly (ADP-ribose) polymerase family, member 1246782654867885356Rat
1311705Fkbp14FKBP prolyl isomerase 1448370553183721515Rat
1311706Hdac11histone deacetylase 114123645873123667407Rat
1303178NanogNanog homeobox4155943737155951116Rat
1308501Ppm1kprotein phosphatase, Mg2+/Mn2+ dependent, 1K48761219887638993Rat
1333504Olr809olfactory receptor 80947175974771760682Rat
1308938Tnpo3transportin 345814295458220365Rat
1309746Zfp638zinc finger protein 6384116355934116479845Rat
1560552Eefseceukaryotic elongation factor, selenocysteine-tRNA-specific4120719616120915801Rat
1310403Hnrnpa2b1heterogeneous nuclear ribonucleoprotein A2/B148053465980545297Rat
1308438Usp5ubiquitin specific peptidase 54157619643157634711Rat
1333381Olr804olfactory receptor 80447145036371451316Rat
1305225Ccdc174coiled-coil domain containing 1744124392183124419035Rat
1308013Fam180afamily with sequence similarity 180, member A46399286764008047Rat
1308103Usp39ubiquitin specific peptidase 394104373908104406413Rat
1308906Htra2HtrA serine peptidase 24115556914115560202Rat
1359400Try10trypsin 1047024431470247819Rat
1359401Vom1r95vomeronasal 1 receptor 954122285444122286388Rat
1359404Rhno1RAD9-HUS1-RAD1 interacting nuclear orphan 14161634047161639437Rat
1359405Fam115efamily with sequence similarity 115, member E47151027871524582Rat
1309584Irak2interleukin-1 receptor-associated kinase 24146786004146842615Rat
1309144Thnsl2threonine synthase-like 24103112974103132122Rat
1309153Smyd5SMYD family member 54117969615117984082Rat
1333902Olr823olfactory receptor 8234149602129149610213Rat
1309807Fam13afamily with sequence similarity 13, member A48805652188155782Rat
1560707Lrrtm4leucine rich repeat transmembrane neuronal 44112545874113338713Rat
1311724Capgcapping actin protein, gelsolin like4104594743104611856Rat
1332631Olr827olfactory receptor 8274149717772149718755Rat
1309786TprkbTp53rk binding protein4118342910118357908Rat
1333171Olr832olfactory receptor 8324149839430149840362Rat
1303172Fancd2FA complementation group D24146679014146743422Rat
1306865Clec2hC-type lectin domain family 2, member H4162493307162503318Rat
1310827TrilTLR4 interactor with leucine-rich repeats48292232782927172Rat
1312013Nt5c3a5'-nucleotidase, cytosolic IIIA48616164286204671Rat
1306889Adamts9ADAM metallopeptidase with thrombospondin type 1 motif, 94125290633125462988Rat
1303222Aicdaactivation-induced cytidine deaminase4155774132155783972Rat
1333628Olr831olfactory receptor 8314149818596149819528Rat
1311336Rbm28RNA binding motif protein 2845772222357761935Rat
1310433Setd5SET domain containing 54146217172146294896Rat
1333098Olr816olfactory receptor 81647194234371943275Rat
1311080Ndnfneuron-derived neurotrophic factor49494474994987414Rat
1549782Pcgf1polycomb group ring finger 14115576165115587019Rat
1359153Usp18ubiquitin specific peptidase 184154471634154499154Rat
1333188Olr802olfactory receptor 80247137786971378810Rat
1310804Gprc5aG protein-coupled receptor, class C, group 5, member A4167903542167922276Rat
1310710Ccdc77coiled-coil domain containing 774153534184153566059Rat
1310721Dusp16dual specificity phosphatase 164167546780167629949Rat
1310722Ubn2ubinuclein 246716527867251562Rat
1333772Olr814-psolfactory receptor pseudogene 81447189871971899655Rat
1560499Cd27CD27 molecule4158030700158035862Rat
1310325Chchd3coiled-coil-helix-coiled-coil-helix domain containing 346136035261616850Rat
1310854Spsb2splA/ryanodine receptor domain and SOCS box containing 24157612921157615293Rat
1311302Ift122intraflagellar transport 1224148905031148975458Rat
1359205Klri2killer cell lectin-like receptor family I member 24163252844163261484Rat
1359210Ly49i5Ly49 inhibitory receptor 54163983731164009424Rat
1359215Vom1r89vomeronasal 1 receptor 8949594262695943550Rat
1310346Slc37a3solute carrier family 37, member 346810931468153590Rat
1303194Hyal4hyaluronidase 445325617953274819Rat
1333327Olr815-psolfactory receptor pseudogene 81547190616971906509Rat
1310925Snrnp27small nuclear ribonucleoprotein U4/U6.U5 subunit 274119123676119133234Rat
1308368Mgam2maltase-glucoamylase 246962402469715782Rat
1332594Olr806olfactory receptor 80647168893671689889Rat
1310725Tmem176atransmembrane protein 176A47777494077778620Rat
69077Timp4TIMP metallopeptidase inhibitor 44148306021148312558Rat
1310932Dppa3developmental pluripotency-associated 34155851461155854845Rat
1310809Lancl2LanC like 248744182187483707Rat
1310811Aassaminoadipate-semialdehyde synthase45160646151663136Rat
1311566Emc3ER membrane protein complex subunit 34146663065146678976Rat
1311114Strapserine/threonine kinase receptor associated protein4170646042170660291Rat
1310746Chchd4coiled-coil-helix-coiled-coil-helix domain containing 44123968264123977398Rat
1359354Clec4b2C-type lectin domain family 4, member B24156462742156486240Rat
1359355M6prmannose-6-phosphate receptor, cation dependent4155501080155510219Rat
1359357EogtEGF domain specific O-linked N-acetylglucosamine transferase4129718897129756558Rat
1359363Abtb1ankyrin repeat and BTB domain containing 14121299302121305667Rat
1308363Txnrd3thioredoxin reductase 34122072548122112493Rat
1333367Olr811olfactory receptor 81147179998271800917Rat
1359163Clec4a2C-type lectin domain family 4, member A24156262438156321695Rat
1310889Mad2l1mitotic arrest deficient 2 like 149590669295918885Rat
1310911Cmascytidine monophosphate N-acetylneuraminic acid synthetase4175718808175737128Rat
1307911Wbp11WW domain binding protein 114169680984169694431Rat
1307916RGD1307916LOC3624334157157264157241805Rat
1308651Luc7l2LUC7-like 2 pre-mRNA splicing factor46728759367347986Rat
1308655Lsm5LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated48595107385954289Rat
1308669Foxp1forkhead box P14131559599132155092Rat
1311653Vgll4vestigial-like family member 44147925630148038514Rat
1311446Prss3serine protease 347020308870206562Rat
1309413Nup205nucleoporin 20546385493463920852Rat
1549777Vom1r71vomeronasal 1 receptor 7148653684786538197Rat
1549781Vom1r96vomeronasal 1 receptor 964122334287122335270Rat
1308985Slc35b4solute carrier family 35 member B446277699362799013Rat
1332872Olr819olfactory receptor 81947201281972013760Rat
1332875Olr829olfactory receptor 8294149777747149778730Rat
1306163Ephb6Eph receptor B647049197370507230Rat
1309212Cpne9copine family member 94146429961146454335Rat
1309217Mrps33mitochondrial ribosomal protein S3346859672968605547Rat
1307823Nfu1NFU1 iron-sulfur cluster scaffold4119458981119480162Rat
1306512Igf2bp3insulin-like growth factor 2 mRNA binding protein 347806049478195007Rat
1305230Reep1receptor accessory protein 14103746004103862347Rat
1309792Klhdc10kelch domain containing 1045902130059079118Rat
1310001Hoxa9homeobox A948132323581329344Rat
1308277Akr1b10aldo-keto reductase family 1 member B1046303845963060336Rat
1310070Cops7aCOP9 signalosome subunit 7A4157766626157792632Rat
1310618Mkrn2makorin, ring finger protein, 24148661529148679580Rat
1310619Atp6v1b1ATPase H+ transporting V1 subunit B14116223799116242475Rat
1310096Arpc4actin related protein 2/3 complex, subunit 44146522255146532784Rat
1333975Olr810olfactory receptor 81047177536871776300Rat
1307891Adipor2adiponectin receptor 24152524604152588848Rat
1304975Rad52RAD52 homolog, DNA repair protein4153106062153128598Rat
1309407Ing4inhibitor of growth family, member 44157841882157850519Rat
1311313Mthfd2methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase4115811135115822663Rat
1309499Dok1docking protein 14115537453115540464Rat
1308130Ndufb2NADH:ubiquinone oxidoreductase subunit B246836752668374609Rat
1309091C1rcomplement C1r4157412718157423483Rat
1311589Prr15proline rich 1548343200283435582Rat
1311590Alms1ALMS1, centrosome and basal body associated protein4118125581118226005Rat
1309203Phc1polyhomeotic homolog 14155510274155532636Rat
1306967Krba1KRAB-A domain containing 147734165477363075Rat
1310223Lpcat3lysophosphatidylcholine acyltransferase 34157468397157509889Rat
1305971Lsm3LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated4124021023124027269Rat
1305975Bola3bolA family member 34115853350115862797Rat
1308204Etnk1ethanolamine kinase 14176126056176170325Rat
1307836Zfp212Zinc finger protein 21247692363876936076Rat
1308257Iffo1intermediate filament family orphan 14157945075157962302Rat
1306686Mrpl51mitochondrial ribosomal protein L514157991756157994715Rat
1307893TapbplTAP binding protein-like4158021454158028905Rat
1308157Cul1cullin 147655195276625830Rat
1306494Vopp1VOPP1 WW domain binding protein48736367887432747Rat
1306495Krcc1lysine-rich coiled-coil 14103261566103274672Rat
1308074Plxna4plexin A446072024661162206Rat
1307144Antxr1ANTXR cell adhesion molecule 14119590770119778232Rat
1311377Rpiaribose 5-phosphate isomerase A4102723712102749374Rat
1306936Malsu1mitochondrial assembly of ribosomal large subunit 147805109078059913Rat
1306788Lrig1leucine-rich repeats and immunoglobulin-like domains 14127130899127230956Rat
1305429Kdm5alysine demethylase 5A4153565909153643912Rat
1309682Tmem209transmembrane protein 20945910165659128687Rat
1307856Gars1glycyl-tRNA synthetase 148417159684212609Rat
1305768Cfap100cilia and flagella associated protein 1004122914693122938994Rat
1309339Marchf8membrane associated ring-CH-type finger 84149415642149530771Rat
1309349Hipk2homeodomain interacting protein kinase 246743932767619223Rat
1310317Kbtbd2kelch repeat and BTB domain containing 248602794786050266Rat
1310318Cnot4CCR4-NOT transcription complex, subunit 446371277063814355Rat
1305782Snx10sorting nexin 1048061264880677005Rat
2092Akr1b1aldo-keto reductase family 1 member B146293203362946126Rat
1309640Smarcad1SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1`49431144194379184Rat
1310684Immtinner membrane mitochondrial protein4103880482103919116Rat
1309236Zc3hav1lzinc finger CCCH-type containing, antiviral 1 like46699419267003207Rat
1308850Tmem72transmembrane protein 724149946296149973550Rat
1309874Rarres2retinoic acid receptor responder 247752254977525733Rat
619963StambpStam binding protein4116055563116083563Rat
1307665Emg1EMG1 N1-specific pseudouridine methyltransferase4157509258157517540Rat
1332818Olr826olfactory receptor 8264149696014149696997Rat
1310437Ddx47DEAD-box helicase 474167845652167858115Rat
1309502Crebl2cAMP responsive element binding protein-like 24167673359167699299Rat
1309448Ltbrlymphotoxin beta receptor4158108884158115339Rat
1310533Crbncereblon4139701154139719949Rat
1333433Olr798-psolfactory receptor pseudogene 79846936072369361664Rat
1308043Bms1BMS1 ribosome biogenesis factor4151558163151595187Rat
1308734Plbd1phospholipase B domain containing 14169472983169529277Rat
1309412Creld1cysteine-rich with EGF-like domains 14146631883146641493Rat
1308963Lmcd1LIM and cysteine-rich domains 14145393153145452049Rat
1308226Lrgukleucine-rich repeats and guanylate kinase domain containing46264722262770268Rat
1307919Mfap5microfibril associated protein 54155727925155750458Rat
1307930Paip2bpoly(A) binding protein interacting protein 2B4116291376116323422Rat
1308807Flncfilamin C45803408858061882Rat
1308811Slc25a26solute carrier family 25 member 264127036704127131022Rat
1309946Tsen2tRNA splicing endonuclease subunit 24148602805148638219Rat
1310590Eps8epidermal growth factor receptor pathway substrate 84170388378170486873Rat
1310691Golt1bgolgi transport 1B4175333056175346156Rat
1332716Olr813olfactory receptor 81347187857871879519Rat
1306142Dennd2aDENN domain containing 2A46823301668332235Rat
1306151Fam234bfamily with sequence similarity 234, member B4168048313168124017Rat
1305520Aak1AP2 associated kinase 14119300128119451834Rat
1306209Zfp746zinc finger protein 74647705500877078968Rat
1310556Ing3inhibitor of growth family, member 345047795450505168Rat
1309766Rmnd5arequired for meiotic nuclear division 5 homolog A4103375846103432890Rat
619985Mat2amethionine adenosyltransferase 2A4104489877104495447Rat
1305397Rbsnrabenosyn, RAB effector4124682228124712578Rat
1310382Cd163CD163 molecule4157085080157118470Rat
1563788LOC500124similar to RIKEN cDNA 4921507P0747966337579688282Rat
1562113Cideccell death-inducing DFFA-like effector c4146569288146582173Rat
1562986Bmp10bone morphogenetic protein 104119872066119877694Rat
1564525Mxd1max dimerization protein 14119097353119118080Rat
1563166Kbtbd8kelch repeat and BTB domain containing 84127675967127688785Rat
1563896LOC500354similar to C030030A07Rik protein4169716821169731532Rat
1560871Plxna1plexin A14121737934121782901Rat
1563848LOC312273Trypsin V-A46979766169803606Rat
1564880Acrbpacrosin binding protein4157851149157864211Rat
1562034Cep41centrosomal protein 4145927121859312343Rat
1563148Clec2gC-type lectin domain family 2, member G4162617827162626608Rat
1563152Srgap3SLIT-ROBO Rho GTPase activating protein 34145839369146070556Rat
1560480Fezf1Fez family zinc finger 145176275151766078Rat
1560487Clec12bC-type lectin domain family 12, member B4162827462162843821Rat
735023Doxl1diamine oxidase-like protein 147787942877883044Rat
1561131Itprid1ITPR interacting domain containing 148501526485172457Rat
1359667Klra2killer cell lectin-like receptor, subfamily A, member 24164873735164985429Rat
1359715Slc13a4solute carrier family 13 member 446394336963988852Rat
1359728Ly49s5Ly49 stimulatory receptor 54163937897163960288Rat
1359730Ly49i3Ly49 inhibitory receptor 34164362029164384325Rat
1560283Try5trypsin 547021376070217034Rat
1560289RGD1560289similar to chromosome 3 open reading frame 204124422033124470657Rat
1562720Tex37testis expressed 374102885695102892934Rat
1563660Csgalnact2chondroitin sulfate N-acetylgalactosaminyltransferase 24151271774151308856Rat
1564754Figlafolliculogenesis specific bHLH transcription factor4118432517118436846Rat
1563940Plekha8pleckstrin homology domain containing A848372347083774081Rat
1563492Abcf2-ps2ATP binding cassette subfamily F member 2, pseudogene 24137093916137096351Rat
1562258Ino80bINO80 complex subunit B4115627907115631069Rat
1562010Ssuh2ssu-2 homolog4145502942145521881Rat
1563175Fam221afamily with sequence similarity 221, member A47833729678358918Rat
1560795Spr-ps1sepiapterin reductase, pseudogene 14117689458117693286Rat
1559797Eva1aeva-1 homolog A, regulator of programmed cell death4114593773114643011Rat
1561981Dnajb8DnaJ heat shock protein family (Hsp40) member B84120681918120685108Rat
1561995Agbl3AGBL carboxypeptidase 346344878963535538Rat
1563887Gprc5dG protein-coupled receptor, class C, group 5, member D4167943523167955616Rat
1561800Lrrc61leucine rich repeat containing 6147750385777523909Rat
1561814Garin1agolgi associated RAB2 interactor 1A45788001957890824Rat
1563719Cracr2acalcium release activated channel regulator 2A4160428987160517427Rat
1561551RGD1561551similar to Hypothetical protein MGC756644175745824175764400Rat
1564605Hoxa11homeobox A1148134252781346189Rat
1562563Tra2atransformer 2 alpha47822083878239737Rat
1564615Avl9AVL9 cell migration associated48596149386008347Rat
1561547LOC500180similar to IG KAPPA CHAIN V-V REGION K2 PRECURSOR4100511688100512362Rat
1563352RGD1563352similar to ribosomal protein S1147836759778368077Rat
1561200Ankrd53ankyrin repeat domain 534116245561116253018Rat
1561363Ttc26tetratricopeptide repeat domain 2646709062267154707Rat
1560915Tspan33tetraspanin 3345830537858330013Rat
1561512Atoh8atonal bHLH transcription factor 84104259992104292168Rat
1564925Slc15a5solute carrier family 15, member 54170878021170971620Rat
1561816Foxi3forkhead box I34102933487102937655Rat
1560652Smco3single-pass membrane protein with coiled-coil domains 34169719962169728849Rat
1560653Fam131bfamily with sequence similarity 131, member B47120103771210292Rat
1563986Dennd11DENN domain containing 1146919716169266013Rat
1564178Gdf3growth differentiation factor 34155831572155835953Rat
1565913Cd207CD207 molecule4116155229116161587Rat
1566019C4h2orf81similar to human chromosome 2 open reading frame 814115661617115667929Rat
1565709A2ml1alpha-2-macroglobulin-like 14161815111161857286Rat
1562580Lpar5lysophosphatidic acid receptor 54157870493157883970Rat
1562716Tcp1-ps1t-complex protein 1, pseudogene 14120705645120707491Rat
1566107Creb5cAMP responsive element binding protein 548239309182794320Rat
1562214Dcp1bdecapping mRNA 1B4152358267152395747Rat
1560026Lrrc4leucine rich repeat containing 445743351857437114Rat
1560028RGD1560028similar to RIKEN cDNA C130060K24 gene49467837094757034Rat
1303080Senp17Sumo1/sentrin/SMT3 specific peptidase 174161126901161128328Rat
1562972Ly49s8Ly49 stimulatory receptor 84164697264164721302Rat
1563231RGD1563231similar to immunoglobulin kappa-chain VK-14102208069102208647Rat
1562314Tas2r144taste receptor, type 2, member 14447108618271087141Rat
1561494Wdr54WD repeat domain 544115654968115677979Rat
1564159Eef1e1-ps2eukaryotic translation elongation factor 1 epsilon 1, pseudogene 24154775536154776601Rat
1560120Akr1b1-ps2aldo-keto reductase family 1, member B1 (aldose reductase), pseudogene 24150078484150079434Rat
1564002Emx1empty spiracles homeobox 14117725148117741616Rat
1564009Tada3transcriptional adaptor 34146510213146521975Rat
1560851Rimklbribosomal modification protein rimK-like family member B4155664392155706888Rat
1359698Rnf181ring finger protein 1814104414586104421433Rat
1565700Depp1DEPP1, autophagy regulator4149910794149913013Rat
1564145Lrrn1leucine rich repeat neuronal 14140476752140520210Rat
1561296ZxdcZXD family zinc finger C4122882389122914486Rat
1560852Thumpd3THUMP domain containing 34146185422146209802Rat
1563238Cyrencell cycle regulator of NHEJ46354731163553394Rat
1561565Ier3ip1immediate early response 3 interacting protein 14132331372132342316Rat
1565719Tuba3atubulin, alpha 3A4158075083158083972Rat
1565731Ccser1coiled-coil serine-rich protein 149015387391391441Rat
1560038TigarTP53 induced glycolysis regulatory phosphatase4159927138159946094Rat
1560859Asprv1aspartic peptidase, retroviral-like 14119076169119078887Rat
1564459Ccdc136coiled-coil domain containing 13645799782558027598Rat
1564464LOC500331similar to osteoclast inhibitory lectin4162009857162024626Rat
1561779Ccdc142coiled-coil domain containing 1424115606151115616223Rat
1563162ribosomal protein S7, pseudogene 20""48759277387602036Rat
1561056B4galnt3beta-1,4-N-acetyl-galactosaminyl transferase 34153410907153509019Rat
1549721Vom1r68vomeronasal 1 receptor 6848638056786381478Rat
1549722Vom1r69vomeronasal 1 receptor 6948639457186395479Rat
1359487Ly49si1immunoreceptor Ly49si14163514541163600528Rat
1561171Ccdc126coiled-coil domain containing 12647829762578318655Rat
1561172Lbx2ladybird homeobox 24115591974115593859Rat
1311011Loxl3lysyl oxidase-like 34115540640115556958Rat
1564219Hyal6hyaluronoglucosaminidase 645323811853250783Rat
1560971Igbp1bimmunoglobulin (CD79A) binding protein 1b4171528962171530312Rat
1562066RGD1562066similar to odorant receptor ORZ647067126670672635Rat
1565750Gimap7GTPase, IMAP family member 747767052277674692Rat
1564211Styk1serine/threonine/tyrosine kinase 14165047613165097890Rat
1563929NoboxNOBOX oogenesis homeobox47212893172134436Rat
1359498Tacstd2tumor-associated calcium signal transducer 249670795096709650Rat
1564147Garin1bgolgi associated RAB2 interactor 1B45791518457938593Rat
1311023Dysfdysferlin4116490877116690709Rat
735148Il17reinterleukin 17 receptor E4146604547146618206Rat
1560090RerglRERG like4172383688172392778Rat
1560999Scrn1secernin 148363212583694225Rat
1559885Prrt4proline-rich transmembrane protein 445776605457777087Rat
1561791Parp11poly (ADP-ribose) polymerase family, member 114160298040160344369Rat
1562696Pot1protection of telomeres 145420533054263137Rat
1333811Olr803olfactory receptor 80347138952671390464Rat
1332737Olr799olfactory receptor 79946940160669402550Rat
1562777Bcl2l14Bcl2-like 144167217561167258723Rat
1561319Pcbp1poly(rC) binding protein 14118972698118974722Rat
621552Atp6v1fATPase H+ transporting V1 subunit F45806766658070628Rat
1562419Prrt3proline-rich transmembrane protein 34146641173146650487Rat
1359503Ly49s7Ly49 stimulatory receptor 74164761847164779735Rat
1359504Mical3microtubule associated monooxygenase, calponin and LIM domain containing 34154152776154353274Rat
1359505Clec6a-ps1C-type lectin domain family 6, member A, pseudogene 14156539408156559032Rat
1311934Gkn2gastrokine 24119778326119824366Rat
1549735Ly49s6Ly49 stimulatory receptor 64164080442164104904Rat
1359098Vom1r94vomeronasal 1 receptor 944122274165122275145Rat
1359109Clec4a1C-type lectin domain family 4, member A14156173894156186009Rat
1359257Vom1r79vomeronasal 1 receptor 7948691076686912251Rat
1359265Gmcl1germ cell-less 1, spermatogenesis associated4119140598119179891Rat
1359093Cdca3cell division cycle associated 34157634775157638799Rat
1359344Klri1killer cell lectin-like receptor family I member 14163183675163218903Rat
1562269Nod1nucleotide-binding oligomerization domain containing 148406087184111668Rat
631340Snd1staphylococcal nuclease and tudor domain containing 145709520557494501Rat
1334034Olr830olfactory receptor 8304149793474149794436Rat
1311823Prss37serine protease 3746932297769334555Rat
1562825Chst13carbohydrate sulfotransferase 134122824712122837935Rat
1562829RergRAS-like, estrogen-regulated, growth-inhibitor4169981634170089777Rat
1562830Arl8bADP-ribosylation factor like GTPase 8B4141748634141792605Rat
1562831Clec2d2C-type lectin domain family 2 member D24162058998162071130Rat
1564292Nop2-ps4NOP2 nucleolar protein, pseudogene 44128479630128481920Rat
1311671Tcf7l1transcription factor 7 like 14104680734104846086Rat
1549694Vom1r98vomeronasal 1 receptor 984122375961122376993Rat
1549695Vom1r74vomeronasal 1 receptor 7448674378186744692Rat
1549696Vom1r86vomeronasal 1 receptor 8648719852587199433Rat
1549699Vom1r88vomeronasal 1 receptor 8848734693387347826Rat
1549700Mturnmaturin, neural progenitor differentiation regulator homolog48380752883828494Rat
1549703Gfpt1glutamine fructose-6-phosphate transaminase 14119496691119546472Rat
1549704Vom1r78vomeronasal 1 receptor 7848687204986872966Rat
1549705Cbx3chromobox 348054545080559284Rat
1549707Repin1replication initiator 147754872277554242Rat
1549708Vom1r67vomeronasal 1 receptor 6748626771986268663Rat
1549709Vom1r72vomeronasal 1 receptor 7248662671886627617Rat
1549710Vom1r70vomeronasal 1 receptor 7048644777886449039Rat
1549711Tmem43transmembrane protein 434123977680123992823Rat
1549714Vom1r76vomeronasal 1 receptor 7648678181586782714Rat
1549715Vom1r73vomeronasal 1 receptor 7348668476586685682Rat
1549716SspoSCO-spondin47739491577450526Rat
1559850Zfp637zinc finger protein 6374150984940151010079Rat
1560637Klrc3killer cell lectin like receptor C34163105081163112737Rat
1560638Exoc6bexocyst complex component 6B4117094741117550221Rat
1560649Tas2r138taste receptor, type 2, member 13846942834469429339Rat
1311255Ttll3tubulin tyrosine ligase like 34146532958146558425Rat
1562852Stra8stimulated by retinoic acid 846360144363624777Rat
1359298Clec4eC-type lectin domain family 4, member E4156606927156612911Rat
1359302Ly49i7Ly49 inhibitory receptor 74164853287164871902Rat
1359240Ly49si2immunoreceptor Ly49si24163672025163845961Rat
3556Retret proto-oncogene4151325969151368176Rat
70933Pde6hphosphodiesterase 6H4169857793169872969Rat
1334194Olr801olfactory receptor 80147136649071367431Rat
1564182Cecr2CECR2, histone acetyl-lysine reader4153890310153998078Rat
1311058Adck2aarF domain containing kinase 246834885368362725Rat
1311071RecqlRecQ like helicase4175308337175332965Rat
1559669Slbp-ps1stem-loop binding protein, pseudogene 14156563058156563967Rat
1549740Vom1r93vomeronasal 1 receptor 934122234616122242958Rat
1549744Vom1r66vomeronasal 1 receptor 6648628841586289326Rat
1549746Vom1r82vomeronasal 1 receptor 8248704874187049637Rat
1549747Vom1r80vomeronasal 1 receptor 8048695493286955833Rat
1560596Trim24tripartite motif-containing 2446666486466717244Rat
1559532RGD1559532RGD15595324165737744165740304Rat
1559537Etv6ETS variant transcription factor 64166849031167085211Rat
1310796Plxnd1plexin D14149002784149043097Rat
1564770RGD1564770similar to CD69 antigen (p60, early T-cell activation antigen)4162768988162779951Rat
1359528Clec4a3C-type lectin domain family 4, member A34156214030156224818Rat
1359218Vom1r77vomeronasal 1 receptor 7748680140086802317Rat
1359662Clec4aC-type lectin domain family 4, member A4156340439156434212Rat
1559476Fmc1formation of mitochondrial complex V assembly factor 146727410467282140Rat
1559795ribosomal protein S7, pseudogene 22""4159831330159832152Rat
1559800Hmces5-hydroxymethylcytosine binding, ES cell specific4120392812120415616Rat
1549723Ly49s4Ly49 stimulatory receptor 44164122071164144931Rat
1549727Vom1r100vomeronasal 1 receptor 1004122468150122471495Rat
1549731Vom1r83vomeronasal 1 receptor 8348711393687114844Rat
1549732Vom1r85vomeronasal 1 receptor 8548716095987161867Rat
1310736Ankrd26ankyrin repeat domain containing 264151670604151740032Rat
1563030Tafa1TAFA chemokine like family member 14128738028129244223Rat
1562038Cacna2d4calcium voltage-gated channel auxiliary subunit alpha2delta 44152408657152524614Rat
1562046Agkacylglycerol kinase46911485069193989Rat
1560602Tas2r137taste receptor, type 2, member 13746927927669286935Rat
1560353Rpl13-ps10ribosomal protein L13, pseudogene 104136905705136907969Rat
1549753Vom1r84vomeronasal 1 receptor 8448713607487136982Rat
1549756Vom1r87vomeronasal 1 receptor 8748725550387256755Rat
1549757Fkbp9FKBP prolyl isomerase 948610625686156723Rat
1549758Ly49i4Ly49 inhibitory receptor 44164166784164188380Rat
1334415Olr812olfactory receptor 81247185608471857016Rat
1562105Arhgap25Rho GTPase activating protein 254119896844119974982Rat
1333047Olr828olfactory receptor 8284149752294149753277Rat
1333048Olr824olfactory receptor 8244149648444149649427Rat
1563055Elob-ps10elongin B, pseduogene 1046133418761334902Rat
1311944Itfg2integrin alpha FG-GAP repeat containing 24161684249161698315Rat
708424Svs1seminal vesicle secretory protein 147795547877960376Rat
1564286Moxd2monooxygenase, DBH-like 246972469369733188Rat
1561194Tas2r108taste receptor, type 2, member 10846928766769288581Rat
1562129Zfp398zinc finger protein 39847684967276881075Rat
1334159Olr821olfactory receptor 82147204632872047290Rat
727967Lhfpl4LHFPL tetraspan subfamily member 44146313539146340113Rat
1559747RGD1559747similar to Zinc finger and SCAN domain containing protein 2 (Zinc finger protein 29)47757987777585815Rat
1334371Olr805-psolfactory receptor pseudogene 80547166247171662682Rat
1564699Hmgb1-ps19high-mobility group box 1, pseudogene 1949574279595743265Rat
1564712RGD1564712RGD156471247865228978679549Rat
1334209Olr818olfactory receptor 81847197902671979958Rat
1333011Olr820olfactory receptor 82047203190972032871Rat
1311909Tmcc1transmembrane and coiled-coil domain family 14149069252149239585Rat
1549759Tmem140transmembrane protein 14046353647763547478Rat
1549762Gimap9GTPase, IMAP family member 947762655377629386Rat
1549765Vom1r81vomeronasal 1 receptor 8148697716786978099Rat
1563842M1apmeiosis 1 associated protein4115445910115536745Rat
1562253Wnt16Wnt family member 1645082096850831380Rat
1560157Zfp800zinc finger protein 80045679832656849766Rat
1359735Akap3A-kinase anchoring protein 34159688049159714067Rat
1303253Pyroxd1pyridine nucleotide-disulphide oxidoreductase domain 14175292124175311143Rat
1333677Olr807olfactory receptor 80747170732671708276Rat
1311833Pals2protein associated with LIN7 2, MAGUK p55 family member47917348879257542Rat
1333814Olr825olfactory receptor 8254149673586149674569Rat
1359586Klra1killer cell lectin-like receptor, subfamily A, member 14164606626164628406Rat
1311164RGD1311164similar to DNA segment, Chr 6, Wayne State University 163, expressed4159772693159809322Rat
1559440Cadps2calcium dependent secretion activator 245178041552309641Rat
1560845Vom1r-ps73vomeronasal 1 receptor pseudogene 7348706579587066329Rat
1564838Tas2r102taste receptor, type 2, member 1024166042808166043851Rat
1560316LOC500350LRRGT001394169254249169290060Rat
1359567Plcz1phospholipase C, zeta 14172873110172929191Rat
1566236H1f8H1.8 linker histone4148993133148998254Rat
1564384Stk31serine threonine kinase 3147837069178467599Rat
1585671Tead4TEA domain transcription factor 44161474122161572837Rat
1587580LOC689800similar to osteoclast inhibitory lectin4162306322162339839Rat
3658Sema4fssemaphorin 4F4115411411115437721Rat
1587506Rhox5-ps1Rhox homeobox family member 5, pseudogene 14162614042162615965Rat
1586093Eif1-ps3eukaryotic translation initiation factor 1, pseudogene 346048509460485620Rat
1583000Eef1g-ps15eukaryotic translation elongation factor 1 gamma, pseudogene 154127841801127847162Rat
1587381Mrpl19mitochondrial ribosomal protein L194114521824114526053Rat
3700Slco1a1solute carrier organic anion transporter family, member 1a14174877045174950857Rat
1587188Eif4g1-ps3eukaryotic translation initiation factor 4 gamma 1, pseudogene 349559026595592593Rat
1587189Nono-ps10non-POU domain containing, octamer-binding, pseudogene 1049415739794158751Rat
1587190Vom1r-ps74vomeronasal 1 receptor pseudogene 7448723150487232398Rat
1587193Dab2ip-ps1DAB2 interacting protein, pseudogene 147784161377844707Rat
1587194St13-ps9ST13, Hsp70 interacting protein, pseudogene 947393531073937677Rat
1587195Olr437olfactory receptor 43747196511871966047Rat
1587495Klrg2killer cell lectin like receptor G246736021667374867Rat
1584828Brpf1bromodomain and PHD finger containing, 14146456344146472781Rat
1559612Tigd2tigger transposable element derived 248841436688417458Rat
1565470KelKell metallo-endopeptidase (Kell blood group)47056824170585666Rat
1565474Tcaf1TRPM8 channel-associated factor 147158967471639309Rat
1585860Smokxl-ps3sperm motility kinase X like, pseudogene 34117569008117569987Rat
1564885Rps2-ps33ribosomal protein S2, pseudogene 334159815079159815810Rat
1584754Rpl6-ps15ribosomal protein L6, pseudogene 154108858856108967329Rat
1584755Clec5aC-type lectin domain containing 5A46940712569416872Rat
1584118Tsga13testis specific, 1345950177359522925Rat
1585901Hnrnpc-ps3heterogeneous nuclear ribonucleoprotein C, pseudogene 34107575688107585650Rat
1565524PyurfPIGY upstream open reading frame48750185987505494Rat
1563551RGD1563551similar to ribosomal protein L314156096896156097888Rat
1587197Wee2WEE2 oocyte meiosis inhibiting kinase46923904369261576Rat
1585993Ppp1r15b-ps1protein phosphatase 1, regulatory subunit 15B, pseudogene 14149756752149759826Rat
1585995Kpna1-ps6karyopherin subunit alpha 1, pseudogene 64136818724136820326Rat
1585997Elob-ps12elongin B, pseduogene 124126816689126817049Rat
1585998Hmgb2-ps2high mobility group box 2, pseudogene 24122120684122121727Rat
1585999Kbtbd12kelch repeat and BTB domain containing 124121014636121088701Rat
1586000Rps15-ps12ribosomal protein S15, pseudogene 124116373761116374229Rat
1586001Plin3-ps2perilipin 3, pseudogene 24113755510113756823Rat
1586002Cactin-ps3cactin, spliceosome C complex subunit, pseudogene 34106867095106868859Rat
1586003LOC502825hypothetical LOC5028254101805860101806662Rat
1586004Fbl-ps6fibrillarin, pseudogene 64101510664101511950Rat
1583112Pradc1protease-associated domain containing 14117984732117989710Rat
1584713Snrpgsmall nuclear ribonucleoprotein polypeptide G4118812278118819827Rat
1586441Rplp0-ps15ribosomal protein lateral stalk subunit P0, pseudogene 154126179018126180835Rat
1584727Rpl4-ps7ribosomal protein L4, pseudogene 74153376053153378932Rat
1585259Tulp3TUB like protein 34161590478161632514Rat
1586482Gxylt2glucoside xylosyltransferase 24133347230133449708Rat
1587245Tuba1b-ps8tubulin, alpha 1B, pseudogene 84103340394103341605Rat
1587247Fbl-ps5fibrillarin, pseudogene 54101138821101139593Rat
1587248Mmrn1multimerin 148987540889950814Rat
1587249Ppid-ps16peptidylprolyl isomerase D, pseudogene 1648785508187856880Rat
1583233LOC685069similar to H2A histone family, member V isoform 14151152904151153567Rat
1583234Gemin7l1gem (nuclear organelle) associated protein 7-like 147826989578270697Rat
1561712Vom2r51vomeronasal 2 receptor, 514156834644156884468Rat
1587250Tubg1-ps4tubulin, gamma 1, pseudogene 448695738286958820Rat
1587253Hoxa7homeobox A748131573081317629Rat
1584123Nap1l5nucleosome assembly protein 1-like 548802267088024988Rat
1587511Tas2r140taste receptor, type 2, member 1404166323842166324780Rat
1587527Clec2eC-type lectin domain family 2, member E4162535278162540527Rat
1583218LOC685085similar to 40S ribosomal protein S254120933765120934259Rat
1564924Lmod3leiomodin 34129843964129858684Rat
1587563Klrb1killer cell lectin like receptor B14162456294162474989Rat
1586149Klrb1akiller cell lectin-like receptor subfamily B, member 1A4161890577161904050Rat
1586150Tamm41TAM41 mitochondrial translocator assembly and maintenance homolog4148070388148103728Rat
1587427Sh2d6SH2 domain containing 64104566210104574176Rat
1585226Hnrnpa1-ps32heterogeneous nuclear ribonucleoprotein A1, pseudogene 3248621647386218622Rat
1566056Zfp777zinc finger protein 77747701636377044008Rat
1562513Clec9aC-type lectin domain containing 9A4162859742162875742Rat
1561357Lmo3LIM domain only 34171234686171297677Rat
1563609Cpvlcarboxypeptidase, vitellogenic-like48298142183091730Rat
1561431Hoxa3homeobox A348126924381313218Rat
1561722RGD1561722similar to immunoglobulin light chain49813078798131675Rat
1561270Zfp248zinc finger protein 2484151605433151630249Rat
1561603Zfp467zinc finger protein 46747738575277394709Rat
1562483Hoxa13homeo box A1348135895681361091Rat
1564696RGD1564696similar to immunoglobulin light chain variable region4102304440102305139Rat
1566215Copg2COPI coat complex subunit gamma 245936608659501591Rat
1565415RGD1565415similar to ribosomal protein L27a47963353979634311Rat
1566290Tas2r143taste receptor, type 2, member 14347128785771288741Rat
1566313Cpamd8C3 and PZP-like, alpha-2-macroglobulin domain containing 84155332827155413098Rat
1582950Vom1r-ps71vomeronasal 1 receptor pseudogene 7148671349186714388Rat
1563619Cpa4carboxypeptidase A445918828459212255Rat
1566130Fbxo41F-box protein 414118007517118039547Rat
1562910Notonotochord homeobox4117961163117965402Rat
1566165Vom2r50vomeronasal 2 receptor, 504156801318156823561Rat
1562515JkamplJNK1/MAPK8 associated membrane protein like4105520442105521542Rat
1565292Copg1COPI coat complex subunit gamma 14120366540120392502Rat
1566041Tuba8tubulin, alpha 84154440045154456918Rat
1564070Fgfr1-ps1fibroblast growth factor receptor 1, pseudogene 147727960477282022Rat
1561341RGD1561341similar to Translocase of outer mitochondrial membrane 20 homolog48060334280603836Rat
1561099Zc3hc1zinc finger, C3HC-type containing 145898998959011925Rat
1562793Neurod6neuronal differentiation 648484665984849905Rat
1561636RGD1561636similar to 60S ribosomal protein L3846029635860296687Rat
1564419Hoxa11-asHOXA11 antisense RNA48134641681350190Rat
1565171Atoh1atonal bHLH transcription factor 149391206893914163Rat
1566053SvoplSVOP like46669755066751699Rat
1565997Fancd2osFANCD2 opposite strand4146740863146747547Rat
1565582Ptcd3Pentatricopeptide repeat domain 34103922440103957445Rat
1584130Vom1r-ps70vomeronasal 1 receptor pseudogene 7048634301886343928Rat
1561739Herc6HECT and RLD domain containing E3 ubiquitin protein ligase family member 648752447087566895Rat
1565557Aplfaprataxin and PNKP like factor4120070471120122656Rat
1563491Cped1cadherin-like and PC-esterase domain containing 145051671250789651Rat
1561715C1s-ps1complement C1s, pseudogene 14157059237157061211Rat
1566110Clec1aC-type lectin domain family 1, member A4162875360162902571Rat
1565690Gprin3GPRIN family member 348856370888657603Rat
1584384LOC684976hypothetical protein LOC6849764118986414118988248Rat
1566275Hyal5hyaluronoglucosaminidase 545334110553412280Rat
1561078Tas2r135taste receptor, type 2, member 13547129291271293877Rat
1583518Mrpl17-ps2mitochondrial ribosomal protein L17, pseudogene 247725297477253783Rat
1565435Hmgb1-ps5high-mobility group box 1, pseudogene 546180596461806669Rat
1582927LOC688980hypothetical protein LOC6889804162337285162338246Rat
1562590Mindy4MINDY lysine 48 deubiquitinase 448435866084469189Rat
1564573Vom1r92vomeronasal 1 receptor 924122222550122225303Rat
1565263Rab19RAB19, member RAS oncogene family46815715968166889Rat
1565488Jagn1jagunal homolog 14146591577146596287Rat
1562596Ncapd2non-SMC condensin I complex, subunit D24157968814157992314Rat
1565882SetmarSET domain and mariner transposase fusion gene4141046058141058183Rat
1565140Clec7aC-type lectin domain containing 7A4162902731162913931Rat
1565596H1f10H1.10 linker histone4120440515120444705Rat
1564895Ahcyl2adenosylhomocysteinase-like 245838129058531061Rat
1561119Kcpkielin cysteine rich BMP regulator45808285658118170Rat
1564287Osbpl3oxysterol binding protein-like 347934658379523523Rat
1565101Foxj2forkhead box J24156047043156073540Rat
1565107Rpsa-ps19ribosomal protein SA, pseudogene 1948586753285868460Rat
1563633Edem1ER degradation enhancing alpha-mannosidase like protein 14141797631141829717Rat
1563294Eno1-ps20enolase 1, pseudogene 204150927402150929143Rat
1565367RGD1565367similar to Solute carrier family 23, member 2 (Sodium-dependent vitamin C transporter 2)46363129263679687Rat
1565373Clec2lC-type lectin domain family 2, member L46739211867414539Rat
1565381Erp27endoplasmic reticulum protein 274169804656169821660Rat
1359555Sec13SEC13 homolog, nuclear pore and COPII coat complex component4146877739146891130Rat
1564570Gimap8GTPase, IMAP family member 847760010477611593Rat
1565300Rab43RAB43, member RAS oncogene family4120249878120269174Rat
1565302Tmem121btransmembrane protein 121B4153695193153700497Rat
1563517Clec1bC-type lectin domain family 1, member B4162847978162856291Rat
1561619Nat8f2N-acetyltransferase 8 (GCN5-related) family member 24118319984118323159Rat
1592991Clec12aC-type lectin domain family 12, member A4162798125162816757Rat
1590212Tmem229atransmembrane protein 229A45344028953445327Rat
1585938Tmem178btransmembrane protein 178B46865942569035690Rat
1592965Rps27a-ps18ribosomal protein S27a, pseudogene 184115353266115353807Rat
1586368Il23rinterleukin 23 receptor49658056896672540Rat
1591392Prr20eproline rich 20E4121566632121574734Rat
1593790Rps3-ps7ribosomal protein S3, pseudogene 745168221851683038Rat
1591364Impdh2-ps1inosine monophosphate dehydrogenase 2, pseudogene 145273881252740348Rat
1589573Slc41a3solute carrier family 41, member 34123109555123154766Rat
1587025Tmem40transmembrane protein 404148791509148819382Rat
1589986Vom2r49vomeronasal 2 receptor, 494156733978156781086Rat
1591108LOC689519similar to Transcriptional enhancer factor TEF-3 (TEA domain family member 4) (TEAD-4) (ETF-related factor 2) (ETFR-2) (TEF-1-related factor 1) (TEF-1-related factor FR-19) (RTEF-1)4161468780161472861Rat
1591115Klra4-ps2killer cell lectin-like receptor, subfamily A, member 4, pseudogene 24164214032164242000Rat
1586185Eif4e3eukaryotic translation initiation factor 4E family member 34132258502132301808Rat
1586985Efcab12EF-hand calcium binding domain 124148869381148892922Rat
1588635Eef1g-ps3eukaryotic translation elongation factor 1 gamma, pseudogene 34173700496173701775Rat
1590584Tet3tet methylcytosine dioxygenase 34115867412115964433Rat
1591097Eno1-ps7enolase 1, pseudogene 748987254889873844Rat
1590470Slc25a18solute carrier family 25 member 184154000808154021373Rat
1585214Vom1r65vomeronasal 1 receptor 6548623591286245705Rat
1585921LRRTM1leucine rich repeat transmembrane neuronal 14109701815109718924Rat
1592944LOC680385similar to Sjogren syndrome antigen B4149078162149079669Rat
1592322Rpl13-ps14ribosomal protein L13, pseudogene 144134558719134564121Rat
1592176H2ajH2A.J histone4169675718169676202Rat
1592312Senp2-ps4SUMO specific peptidase 2, pseudogene 44161394959161398658Rat
1592092Lmod2leiomodin 245306742853075124Rat
1593850LOC685406LRRGT0006248168222481688735Rat
1585190Klra4killer cell lectin-like receptor, subfamily A, member 44163319139163340140Rat
1587777Uroc1urocanate hydratase 14122844933122876584Rat
1587811LOC685964hypothetical protein LOC6859644122817681122822175Rat
1587471LOC691113hypothetical protein LOC6911134104402553104408317Rat
1584703Ass1-ps2argininosuccinate synthase 1, pseudogene 24117912849117927565Rat
1586882Senp2-ps8SUMO specific peptidase 2, pseudogene 84161286038161289049Rat
1586016Hsp90aa1-ps14heat shock protein 90 alpha family class A member 1, pseudogene 144149745787149748099Rat
1586017Tatdn2TatD DNase domain containing 24146845156146865708Rat
1586018Psmc4-ps3proteasome 26S subunit, ATPase 4, pseudogene 34142081325142082608Rat
1586019Pgk1-ps9phosphoglycerate kinase 1, pseudogene 94139263587139265702Rat
1586020G3bp1-ps8G3BP stress granule assembly factor 1, pseudogene 84136952803136954495Rat
1588434Rhebl1-ps1RHEB like 1, pseudogene 146481823964819039Rat
1588437Strip2striatin interacting protein 245853603458578279Rat
1588449LOC498750similar to cDNA sequence BC0055374101258112101260037Rat
1585178Klra5-ps3killer cell lectin-like receptor, subfamily A, member 5, pseudogene 34163368684163389413Rat
1586032Shc1-ps1SHC adaptor protein 1, pseudogene 14105988811105991749Rat
1586033Ptbp1-ps3polypyrimidine tract binding protein 1, pseudogene 34105696627105698961Rat
1587829Vom1r104vomeronasal 1 receptor 1044122768885122769850Rat
1587677Prmt8protein arginine methyltransferase 84160535813160618193Rat
1589884ribosomal protein S7, pseudogene 6""4140380731140381276Rat
1559502Ssmem1serine-rich single-pass membrane protein 145912873059139029Rat
1587548Havcr1-ps1hepatitis A virus cellular receptor 1, pseudogene 149563296895633283Rat
1584998Pex26peroxisomal biogenesis factor 264154414332154426954Rat
1584999LOC297568alpha-1-inhibitor III4154980279155036688Rat
1589836Deradeoxyribose-phosphate aldolase4170663646170742469Rat
1587791LOC685984similar to H3 histone, family 3B45684980056862528Rat
1359669Ly49si3immunoreceptor Ly49si34163480531163502045Rat
1583604Chmp4bl1chromatin modifying protein 4B-like 146804974268050791Rat
1584855Sord-ps3sorbitol dehydrogenase, pseudogene 34169713596169715356Rat
1584856LOC502907similar to immunoreceptor Ly49si14163805956163825355Rat
1584041LOC690127similar to Ly49 stimulatory receptor 54163894571163906310Rat
1584868Chtopl1chromatin target of PRMT1-like 14162804334162805482Rat
1584874Nudc-ps1nuclear distribution C, dynein complex regulator, pseudogene 14165491141165492129Rat
1584876Senp2-ps7SUMO specific peptidase 2, pseudogene 74161482938161484893Rat
1583336Klrb1ckiller cell lectin like receptor B1C4162380773162394688Rat
1585874Mbd4methyl-CpG binding domain 4 DNA glycosylase4148893049148904833Rat
1587001Lrtm2leucine-rich repeats and transmembrane domains 24152485863152508248Rat
1585116Ly49si4-ps1immunoreceptor Ly49si4, pseudogene 14163724510163782315Rat
1585167Ly49si4immunoreceptor Ly49si44163428619163455232Rat
1587448Spxspexin hormone4175356044175362082Rat
1584878Sav1-ps1salvador family WW domain containing protein 1, pseudogene 14155048501155049735Rat
1585454Vom2r48vomeronasal 2 receptor, 484156661971156702951Rat
1589006Vom1r99vomeronasal 1 receptor 994122430887122431711Rat
1589007Jazf1JAZF zinc finger 148187950182183241Rat
1586021Tuba1b-ps2tubulin, alpha 1B, pseudogene 24134342304134343235Rat
1586024Hnrnpa1-ps45heterogeneous nuclear ribonucleoprotein A1, pseudogene 454127704697127705507Rat
1586025Magi1membrane associated guanylate kinase, WW and PDZ domain containing 14126205667126811354Rat
1586026Emilin1-ps1elastin microfibril interfacer 1, pseudogene 14118262387118266491Rat
1586028Ldha-ps9lactate dehydrogenase A, pseudogene 94113345717113349041Rat
1597980Smarca2-ps1SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2, pseudogene 147762142377622617Rat
1598054Zfp862zinc finger protein 86247745293077481981Rat
1593458Mansc1MANSC domain containing 14167438817167459047Rat
1597830LOC683849similar to Anionic trypsin II precursor (Pretrypsinogen II)47034433870348069Rat
1588731LOC689757similar to osteoclast inhibitory lectin4162099067162107301Rat
1588732Tnip3TNFAIP3 interacting protein 349486725894908780Rat
1591759LOC680441similar to 60S ribosomal protein L23a4149492385149492849Rat
1596143Gabarapl1GABA type A receptor associated protein like 14162980309162989452Rat
1597354Tas2r130taste receptor, type 2, member 1304165272827165273765Rat
1597399Zfand6-ps1zinc finger AN1-type containing 6, pseudogene14159826591159827232Rat
1597087Inmtindolethylamine N-methyltransferase48431819784322493Rat
1588718LOC689770similar to osteoclast inhibitory lectin4162150431162166457Rat
1593191Iqsec3IQ motif and Sec7 domain ArfGEF 34154610933154707310Rat
1596167Vom1r-ps72vomeronasal 1 receptor pseudogene 7248701153087012437Rat
1595417Rnf148ring finger protein 14845214579852152508Rat
1592069Rab11fip5RAB11 family interacting protein 54117871301117908819Rat
1597384Magohbmago homolog B, exon junction complex subunit4165034131165041977Rat
1597453Hsp90aa1-ps1heat shock protein 90 alpha family class A member 1, pseudogene 148679106886796467Rat
1597431Rad51ap1RAD51 associated protein 14159759454159772524Rat
1597443Tafa4TAFA chemokine like family member 44129437466129671320Rat
1597444LOC689042hypothetical protein LOC68904246064592160652324Rat
1597362Lpal2lipoprotein(a) like 2, pseudogene4165207378165264321Rat
1596060Tas2r120taste receptor, type 2, member 1204165952266165953153Rat
1596089LOC690418similar to Acidic proline-rich protein PRP25 precursor4165672249165675160Rat
1591766Dqx1DEAQ box RNA-dependent ATPase 14115563497115572598Rat
1592353Smtn-ps1smoothelin, pseudogene 14133742253133744275Rat
1589959Nrip2nuclear receptor interacting protein 24161673964161684055Rat
1594589Mestmesoderm specific transcript45935444559364919Rat
1593482Acbd5-ps1acyl-CoA binding domain containing 5, pseudogene 148826755188268264Rat
1592227Eif5-ps10eukaryotic translation initiation factor 5, pseudogene 104101363702101365081Rat
1596030Tas2r125taste receptor, type 2, member 1254166188550166189485Rat
1596038Tas2r124taste receptor, type 2, member 1244166030544166031473Rat
1590236Hoxa6homeobox A648130491881313184Rat
1595436Tas2r139taste receptor, type 2, member 13947098528070986239Rat
1588989Tomm20-ps1translocase of outer mitochondrial membrane 20, pseudogene 14155881523155882431Rat
1588991Tk1-ps1thymidine kinase 1, pseudogene 145476723154775827Rat
1596846Rps25-ps8ribosomal protein S25, pseudogene 84115473792115474236Rat
1596849Vom1r-ps111vomeronasal 1 receptor pseudogene 11148730700087307908Rat
1589408Tpk1thiamin pyrophosphokinase 147217013472557707Rat
1592878LOC681658similar to CCAAT displacement protein isoform b48026982180271956Rat
1594818LOC689234similar to catechol-O-methyltransferase domain containing 146261638962632132Rat
1588783Ptma-ps1prothymosin alpha, pseudogene 149406540194065784Rat
1588740Tmem213transmembrane protein 21346682495866831070Rat
1591053Stmp1short transmembrane mitochondrial protein 146392752363937355Rat
1594775Ndufab1-ps2NADH:ubiquinone oxidoreductase subunit AB1, pseudogene 246287878162879361Rat
1595506Tlx2T-cell leukemia homeobox 24115573736115576097Rat
1595510Llcfc1LLLL and CFNLAS motif containing 147056620670567592Rat
1593814Aurka-ps3aurora kinase A, pseudogene 347981143179812875Rat
1588698Clec2dl1C-type lectin domain family 2 member D-like 14162263578162274882Rat
1588700Prdm5PR/SET domain 549507573695237921Rat
1591606Ano2anoctamin 24158514200158855639Rat
1586337Tmem52btransmembrane protein 52B4162954025162959220Rat
1590185Suv39h2-ps1SUV39H2 histone lysine methyltransferase, pseudogene 145377885553779842Rat
1590113LOC687056hypothetical protein LOC6870564127274472127275699Rat
1594753Rpl10a-ps15ribosomal protein L10A, pseudogene 154166337090166337915Rat
1591490Kcmf1potassium channel modulatory factor 14104888452104950234Rat
1594187Tmem139transmembrane protein 13947114707271149151Rat
1591777Aup1AUP1, lipid droplet regulating VLDL assembly factor4115560274115563346Rat
1591778Tcaf2cTRPM8 channel associated factor 2C47155370071567820Rat
1597311Gtdc1-ps1glycosyltransferase-like domain containing 1, pseudogene 14102443892102445203Rat
1596695Rnf133ring finger protein 13345214058452143357Rat
1596703Ube2m-ps1ubiquitin-conjugating enzyme E2M, pseudogene 14150686815150745259Rat
1595049Tpt1-ps7tumor protein, translationally-controlled 1 pseudogene 745119572651196520Rat
1595057LOC685391LRRGT0006348169291681699598Rat
1598136Brk1BRICK1 subunit of SCAR/WAVE actin nucleating complex4146750821146766050Rat
1595860Ezh2enhancer of zeste 2 polycomb repressive complex 2 subunit47662439976687362Rat
1561601Gp9glycoprotein IX (platelet)4120235539120236874Rat
1597753Dppa3-ps3developmental pluripotency-associated 3, pseudogene 34151323404151325118Rat
1597754Gkn3gastrokine 34119828859119833924Rat
1594689Tas2r109taste receptor, type 2, member 1094166114120166115082Rat
1597729Polr2l-ps2RNA polymerase II, I and III subunit L, pseudogene 24151425481151425881Rat
1596494Efcc1EF-hand and coiled-coil domain containing 14120188202120223464Rat
1595483ribosomal protein S9, pseudogene 10""4113401645113402234Rat
1596313Iqsec1IQ motif and Sec7 domain ArfGEF 14123168719123488300Rat
1594207LOC680224similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)4114189936114190548Rat
1592650Kdm7alysine demethylase 7A46789940767974264Rat
620203Phb2prohibitin 24157517662157522268Rat
1598148Prss2-ps1protease, serine, 2, pseudogene 147031769070320752Rat
2291887LOC497796hypothetical protein LOC4977964163837392163865260Rat
2293498Zfp9zinc finger protein 94151638724151656740Rat
2293500Zfp786zinc finger protein 78647682238376840943Rat
2314255Tas2r113taste receptor, type 2, member 1134166210496166211425Rat
2314257Tas2r129taste receptor, type 2, member 1294166144657166145619Rat
2314258Tas2r117taste receptor, type 2, member 1174166106800166107756Rat
2314259Tas2r104taste receptor, type 2, member 1044165335957165336865Rat
2314260Tas2r106taste receptor, type 2, member 1064165313210165314133Rat
2314261Tas2r116taste receptor, type 2, member 1164166266984166267958Rat
2314262Tas2r136taste receptor, type 2, member 1364166098848166099840Rat
2314263Tas2r110taste receptor, type 2, member 1104166252371166253372Rat
2314265Tas2r103taste receptor, type 2, member 1034166297968166333604Rat
2314878Mir592microRNA 59245650528056505375Rat
2314882Mir196bmicroRNA 196b48133048781330571Rat
2316381Vom1r-ps87vomeronasal 1 receptor pseudogene 874123930673123931299Rat
2316382Vom1r-ps86vomeronasal 1 receptor pseudogene 864122686949122687878Rat
2316383Vom1r-ps85vomeronasal 1 receptor pseudogene 854122625876122626474Rat
2316384Vom1r-ps84vomeronasal 1 receptor pseudogene 844122613355122614266Rat
2316385Vom1r-ps83vomeronasal 1 receptor pseudogene 834122608252122609154Rat
2316386Vom1r-ps82vomeronasal 1 receptor pseudogene 824122595522122596518Rat
2316387Vom1r-ps81vomeronasal 1 receptor pseudogene 814122586021122586924Rat
2316388Vom1r-ps80vomeronasal 1 receptor pseudogene 804122396580122396744Rat
2316389Vom1r-ps79vomeronasal 1 receptor pseudogene 794122394932122395749Rat
2316390Vom1r-ps78vomeronasal 1 receptor pseudogene 784122370207122371034Rat
2316391Vom1r-ps77vomeronasal 1 receptor pseudogene 774122311684122312578Rat
2316392Vom1r-ps76vomeronasal 1 receptor pseudogene 764108297905108298689Rat
2316407Vom1r-ps69vomeronasal 1 receptor pseudogene 6948632957886330574Rat
2316408Vom1r103vomeronasal 1 receptor 1034122729553122730533Rat
2318544Plekhg6pleckstrin homology and RhoGEF domain containing G64158163443158182628Rat
2319759Tmem94-ps1transmembrane protein 94, pseudogene 14104043649104046004Rat
2319160LOC100361920dynein light chain 1-like4126581955126582940Rat
2319177Zfp42lZinc finger protein 42-like4157344350157345416Rat
2319193Rpl36a-ps13ribosomal protein L36A, pseudogene 1347985997579860338Rat
2319874Reg3b-ps1regenerating family member 3 beta, pseudogene 14110867647110870075Rat
2319288Ube2hubiquitin-conjugating enzyme E2H45883467458930156Rat
2319900Hilpdahypoxia inducible lipid droplet-associated45787107657875206Rat
2318121Hax1-ps4HCLS1 associated protein X-1, pseudogene 44163249103163250300Rat
2319333Apoo-ps2apolipoprotein O, pseudogene 24146587525146589978Rat
2319954Gcc1GRIP and coiled-coil domain containing 145703081757042682Rat
2318170LOC100362418killer cell lectin-like receptor subfamily B member 1C4162565111162569981Rat
2318745Ivns1abp-ps1influenza virus NS1A binding protein, pseudogene 14161576440161585763Rat
2319409Rpl30-ps9ribosomal protein L30, pseudogene 947957764879578130Rat
2319464Edf1-ps2endothelial differentiation-related factor 1, pseudogene 24148247091148258212Rat
2320107Snx11-ps1sorting nexin 11, pseudogene 145491521154915991Rat
2318882LOC100365500mCG142154-like4101432815101433399Rat
2319475Ggact-ps2gamma-glutamylamine cyclotransferase, pseudogene 24146504023146505562Rat
2319531Cct3-ps6chaperonin containing TCP1 subunit 3, pseudogene 64146490625146500878Rat
2320195Ssbp1-ps1single stranded DNA binding protein 1, pseudogene 14126884577126890225Rat
2318975Grcc10gene rich cluster, C10 gene4157551276157552924Rat
2319013Supt4h1-ps2SPT4 homolog, DSIF elongation factor subunit, pseudogene 246409466264097040Rat
2319569LOC100361705rCG64259-like4100487837100488968Rat
2319042LOC100365438mCG141619-like4101478715101479376Rat
2320327Igkvl-ps21immunoglobulin kappa variable like, pseudogene 214100209006100209643Rat
2320349Tra2b-ps2transformer 2 beta, pseudogene 24108405683108421146Rat
2321310LOC100360848rCG64259-like4102343796102344458Rat
2322105Senp6-ps1SUMO specific peptidase 6, pseudogene 148855134588555553Rat
2323419Polr2m-ps3RNA polymerase II subunit M, pseudogene 34122141718122144244Rat
2320685Slc25a39-ps8solute carrier family 25 member 39, pseudogene 84107360735107361799Rat
2322825LOC100363522hypothetical protein LOC10036352249780939697810460Rat
2322840Rplp2-ps2ribosomal protein lateral stalk subunit P2, pseudogene 24166702138166703247Rat
2320714Mkrn2osMKRN2 opposite strand4148644489148653396Rat
2321500Prdx1-ps1peroxiredoxin 1, pseudogene 147114152971143722Rat
2322888LOC100360057ribosomal protein L22-like4119350406119350886Rat
2322992Esd-ps2esterase D, pseudogene 24166689082166693523Rat
2323009Mdfic2MyoD family inhibitor domain containing 24130845260130948054Rat
2323010Aoc1-ps1amine oxidase, copper containing 147794799777948862Rat
2320855Mak16-ps1MAK16 homolog, pseudogene 149936447499369594Rat
2322439LOC100363712proteasome (prosome, macropain) assembly chaperone 4-like4159216759159217124Rat
2320908LOC100361052rCG64257-like4102446979102447648Rat
2323070Selenot-ps1selenoprotein T, pseudogene 148639863886399185Rat
2322480Tas2r124-ps1taste receptor, type 2, member 124, pseudogene 14166073129166074058Rat
2322482Snrpb-ps2small nuclear ribonucleoprotein polypeptides B and B1, pseudogene 247649790576498598Rat
2321730Dazap2-ps1DAZ associated protein 2, pseudogene 14150905260150905887Rat
2322558Rpl26-ps6ribosomal protein L26, pseudogene 64160278486160278928Rat
2323199LOC100363344SMR2 protein-like4166474153166476399Rat
2321092LOC100360968mCG142527-like49994200399942688Rat
2323279Dtl-ps1denticleless E3 ubiquitin protein ligase, pseudogene 147075251370753615Rat
2323280Ddx50-ps1DExD-box helicase 50, pseudogene 145122310151296237Rat
2321912Ppp6c-ps1protein phosphatase 6, catalytic subunit, pseuidogene 148997047089997261Rat
2323329Ndufa2-ps2NADH:ubiquinone oxidoreductase subunit A2, pseudogene 247060065270601022Rat
2322729Smim10l1small integral membrane protein 10 like 14166341699166345530Rat
2323358LOC100363282Igk protein-like49938974799390292Rat
2323359LOC100363281hypothetical LOC10036328147753819177545808Rat
4145674IqubIQ motif and ubiquitin domain containing45293176852993795Rat
2324329Nat8-ps1N-acetyltransferase 8, pseudogene 14118303631118305781Rat
2323698Tas2r122l-ps1taste receptor, type 2, member 122 like, pseudogene 14166000949166001846Rat
2323735Gsta4-ps4glutathione S-transferase alpha 4, pseudogene 44120318859120320679Rat
2323784Tex52testis expressed 524161651232161663250Rat
2323785Cfap92cilia and flagella associated protein 924120126565120181575Rat
4888590Mir3575microRNA 35754157523652157523766Rat
2323822Hax1-ps6HCLS1 associated protein X-1, pseudogene 64163166259163180255Rat
2324539LOC100362515hypothetical LOC1003625154101065901101066416Rat
2325393Mir29amicroRNA 29a45965060859650695Rat
2323903Psma3-ps3proteasome 20S subunit alpha 3, pseudogene 34127029644127030164Rat
2325407Mir141microRNA 1414157523239157523332Rat
2325414Mir490microRNA 49046504754865047631Rat
2325456Mir129-1microRNA 129-145762429557624366Rat
2325553Mir200cmicroRNA 200c4157523679157523747Rat
2325560Mir183microRNA 18345878861458788723Rat
2325582Mir96microRNA 9645878841158788516Rat
2325591Mir29b1microRNA 29b-145965098759651067Rat
4888604Mir3556amicroRNA 3556a45965059659650713Rat
4888613Mir3553microRNA 355345878861758788722Rat
4888616Mir182microRNA 18245878481858784879Rat
2324836Tas2r145taste receptor, type 2, member 1454166138007166138957Rat
2325113LOC10035961360S ribosomal protein L12-like48414816584152462Rat
4888577Mir3587microRNA 358745965096059651022Rat
6487873Tubg1-ps2tubulin, gamma 1, pseudogene 248671611286717437Rat
6488311LOC100912188uncharacterized LOC10091218849615649096204457Rat
6488104LOC100912259uncharacterized LOC1009122594169692479169702735Rat
6491746LOC100911668homeobox protein Hox-A10-like48133159181341241Rat
6484980LOC100912974uncharacterized LOC1009129744162066864162085023Rat
6492017Rpl4-ps2ribosomal protein L4, pseudogene 24136330114136331466Rat
6490793Vdac2-ps4voltage-dependent anion channel 2, pseudogene 44154880345154881160Rat
6493911LOC100911271uncharacterized LOC10091127147003688070038079Rat
6485532Ywhaq-ps1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta, pseudogene 147855544378556936Rat
6493044LOC100911370uncharacterized LOC1009113704114459942114463108Rat
6491335Tuba1b-ps4tubulin, alpha 1B, pseudogene 44148253286148254718Rat
6487745Actg1-ps3actin, gamma 1, pseudogene 34140834718140835768Rat
6491660Thumpd3-as1THUMPD3 antisense RNA 14146210520146217026Rat
6495277LOC100911032uncharacterized LOC10091103249800125798002145Rat
6502210Zfp239zinc finger protein 2394151029425151039283Rat
6495905Klra5-ps2killer cell lectin-like receptor, subfamily A, member 5, pseudogene 24164316495164341600Rat
6496223Poldip2-ps1DNA polymerase delta interacting protein 2, pseudogene 146985626469857478Rat
6499742Senp2-ps1SUMO specific peptidase 2, pseudogene 14161184094161185484Rat
6497379Myl6-ps4myosin light chain 6, pseudogene 446306171263063832Rat
6497475LOC100910678coiled-coil domain-containing protein 72-like47833066378331163Rat
6497663LOC100910604uncharacterized LOC1009106044120187658120188705Rat
6500959LOC100909928uncharacterized LOC1009099284162669862162675001Rat
6500991LOC100909941uncharacterized LOC10090994148387056083875187Rat
7499834LOC102548450uncharacterized LOC1025484504146564239146568426Rat
7502419LOC102551557uncharacterized LOC1025515574167651935167653837Rat
7517929LOC102548553uncharacterized LOC10254855347208172272088278Rat
7524413LOC102546367uncharacterized LOC1025463674104166361104168839Rat
7521956Znf431l-ps5zinc finger protein 431 like, pseudogene 54100210123100220831Rat
7506429LOC102553980ankyrin repeat domain-containing protein 13C-like4162511274162515628Rat
7507121LOC102556609uncharacterized LOC1025566094161027110161053419Rat
7507389LOC102554095uncharacterized LOC1025540954157831204157851015Rat
7508270LOC102546745uncharacterized LOC1025467454159103806159151760Rat
7508808LOC102546824uncharacterized LOC10254682447999538680054736Rat
7508836LOC102549269uncharacterized LOC1025492694128652499128742024Rat
7531073LOC102556178uncharacterized LOC10255617844977514649777251Rat
7509699LOC102551107uncharacterized LOC10255110748454311884560009Rat
7512196LOC102547820uncharacterized LOC1025478204122166102122172598Rat
7513880Senp2-ps3SUMO specific peptidase 2, pseudogene 34161099569161101683Rat
7537419Tomm7-ps3translocase of outer mitochondrial membrane 7, pseudogene 348373880383743666Rat
7517602LOC102549024uncharacterized LOC1025490244175285952175291175Rat
7539827LOC102548902uncharacterized LOC1025489024124160535124201206Rat
7520921Prdx6-ps2peroxiredoxin 6, pseudogene 24114684131114684952Rat
7613801LOC102553884uncharacterized LOC10255388447633415976429716Rat
7632355Dppa4-ps8developmental pluripotency-associated 4, pseudogene 846014565860148378Rat
7647571LOC102552663uncharacterized LOC1025526634103292937103297980Rat
7650153LOC102552138uncharacterized LOC1025521384120450176120462899Rat
7650908LOC102548361uncharacterized LOC1025483614115950040115953954Rat
7666339Fth1-ps1ferritin heavy chain 1,pseudogene 146843185768436899Rat
7621965LOC102553072uncharacterized LOC1025530724154499466154500917Rat
7635298LOC102549299uncharacterized LOC1025492994162261234162272138Rat
7650983LOC102554453uncharacterized LOC1025544534177900994177921788Rat
7558071LOC102549191uncharacterized LOC10254919147501451575018378Rat
7636572Nat8f4N-acetyltransferase 8 (GCN5-related) family member 44118326092118332591Rat
7637027LOC102551409uncharacterized LOC1025514094167415371167419796Rat
7652118Phb1-ps5prohibitin 1, pseudogene 54170106088170119240Rat
7623583LOC102548836uncharacterized LOC1025488364160624391160629130Rat
7575330LOC102548867uncharacterized LOC1025488674147482960147497153Rat
7623898LOC102548337uncharacterized LOC1025483374146168757146185408Rat
7624339LOC102546410uncharacterized LOC10254641047965417279689329Rat
7639290Phb1-ps4prohibitin 1, pseudogene 44105082392105084201Rat
7639415LOC102553847uncharacterized LOC1025538474157410200157417093Rat
7626918Tmsb10-ps5thymosin, beta 10, pseudogene 546836299068367488Rat
7657543LOC102549423uncharacterized LOC10254942348041680780427041Rat
7609120LOC102548080uncharacterized LOC1025480804145820794145887127Rat
7609272LOC102554878uncharacterized LOC1025548784121271560121272968Rat
7643066Srsf3-ps6serine and arginine rich splicing factor 3, pseudogene 646834229268343400Rat
7643253Rrs1-ps7ribosome biogenesis regulator 1 homolog, pseudogene 74128616299128619872Rat
7643284LOC102546865uncharacterized LOC1025468654169287350169292025Rat
7629242LOC102547371uncharacterized LOC1025473714171213887171219182Rat
7643646LOC102549088uncharacterized LOC10254908846061944960651830Rat
7661237LOC102554570uncharacterized LOC1025545704125334112125359366Rat
7661434LOC102546557uncharacterized LOC10254655747799003977994867Rat
7611210LOC102549638uncharacterized LOC1025496384169369605169385758Rat
7617185LOC102547496uncharacterized LOC1025474964171292052171298878Rat
7570592LOC102550087uncharacterized LOC10255008748110093781144318Rat
7589793LOC102554318uncharacterized LOC1025543184118942068118966369Rat
7571074LOC102555694uncharacterized LOC10255569447903911779041508Rat
7590189LOC102555978uncharacterized LOC1025559784125459772125773012Rat
7590867Pgk1-ps1phosphoglycerate kinase 1, pseudogene 145857843058580694Rat
7593775LOC102553678uncharacterized LOC10255367848336464383376599Rat
7594196LOC102549865uncharacterized LOC1025498654157561359157563262Rat
7618053LOC102554637anionic trypsin-2-like47033167370335768Rat
7591615LOC102555035uncharacterized LOC1025550354121464929121479571Rat
7620814LOC102546856uncharacterized LOC10254685648127531381293064Rat
7556630LOC102554736uncharacterized LOC1025547364161878162161881353Rat
7574084LOC102554670uncharacterized LOC1025546704161711959161722625Rat
7574135LOC102555151uncharacterized LOC10255515146892487368939499Rat
7560523LOC102550489uncharacterized LOC1025504894161218861161243406Rat
7546468LOC102550396LRRGT001884156121822156134151Rat
7601159LOC102553594uncharacterized LOC1025535944176322020176337037Rat
7580004LOC102549132uncharacterized LOC10254913247591043575915630Rat
7547913LOC102549328uncharacterized LOC1025493284118400294118416651Rat
7601218Aamdc-ps1adipogenesis associated, Mth938 domain containing, pseudogene 14148111641148112601Rat
7562079LOC102554068uncharacterized LOC1025540684120590582120622585Rat
7562795LOC102549458uncharacterized LOC1025494584104767270104769717Rat
7550029LOC102555094uncharacterized LOC1025550944121511450121516890Rat
7563828LOC102552812uncharacterized LOC10255281245827229058276271Rat
7583063LOC102549525uncharacterized LOC1025495254102802796102805439Rat
7551122Srsf7-ps5serine and arginine rich splicing factor 7, pseudogene 548214009382142214Rat
7565639LOC102549329uncharacterized LOC1025493294136745668136762242Rat
7566034LOC102553981uncharacterized LOC1025539814157727912157734774Rat
7552576Stxbp3-ps1syntaxin binding protein 3, pseudogene 14111049442111054421Rat
7566935Tas2r116taste receptor, type 2, member 116, pseudogene 14166243677166244658Rat
7553480LOC102554857uncharacterized LOC1025548574124441221124498179Rat
7553872LOC102556495uncharacterized LOC1025564954104131807104134481Rat
7554399Uba52-ps22ubiquitin A-52 residue ribosomal protein fusion product 1, pseudogene 224169972846169974112Rat
7691241LOC102547697uncharacterized LOC1025476974172189038172205487Rat
7706369Hdac2-ps1histone deacetylase 2, pseudogene 14102624284102625962Rat
7707214LOC102548180uncharacterized LOC1025481804160164273160173745Rat
7708239LOC102555545uncharacterized LOC1025555454158058337158075209Rat
7708743LOC102556090uncharacterized LOC1025560904111069839111075961Rat
7685582LOC102553885uncharacterized LOC10255388548369316083711573Rat
7723672LOC102548769uncharacterized LOC1025487694173860216173882046Rat
7724284LOC102550746uncharacterized LOC10255074648428875284310594Rat
7688358LOC102556035uncharacterized LOC1025560354110915998110999186Rat
7689603LOC102553416uncharacterized LOC10255341645920892859229667Rat
7711844LOC102547728uncharacterized LOC1025477284115172801115177968Rat
7731047LOC102555697uncharacterized LOC1025556974133577659133647925Rat
7739309LOC102553126uncharacterized LOC10255312646381374863829271Rat
7733981LOC102554507uncharacterized LOC10255450746500661265016735Rat
7716070Hotairm1Hoxa transcript antisense RNA, myeloid-specific 148125879381262291Rat
7667063LOC102554372uncharacterized LOC1025543724119012925119030617Rat
7696532LOC102554942uncharacterized LOC1025549424121401011121454903Rat
7696800LOC102547086serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit alpha isoform-like4162232814162235046Rat
7718040LOC102548304uncharacterized LOC1025483044115678692115692726Rat
7669867LOC102555037uncharacterized LOC1025550374132153125132201203Rat
7699711LOC102549526uncharacterized LOC1025495264104672363104687654Rat
7701270LOC102547991uncharacterized LOC1025479914159882493159889757Rat
7702000LOC102554909uncharacterized LOC1025549094162965380162980260Rat
7702915LOC102553636uncharacterized LOC1025536364157375080157391503Rat
7703180LOC102550675uncharacterized LOC10255067548415456384170509Rat
7723051LOC102547466uncharacterized LOC1025474664141491266141542083Rat
7727476LOC102549052low molecular weight phosphotyrosine protein phosphatase-like4103247606103251384Rat
7749382LOC102548743uncharacterized LOC1025487434150498770150548561Rat
7728321Casp6-ps2caspase 6, pseudogene 24153024536153025248Rat
7682226LOC102548837uncharacterized LOC1025488374173917464173951407Rat
9174049Galnt8polypeptide N-acetylgalactosaminyltransferase 84159626438159650327Rat
9100480LOC103692229transcription elongation factor B polypeptide 1 pseudogene4161942851161943132Rat
9102747Igkvl-ps16immunoglobulin kappa variable like, pseudogene 1649734899497349801Rat
9070006LOC103692189uncharacterized LOC1036921894126124290126129626Rat
9142253Ybx1-ps2Y box binding protein 1, pseudogene 24118133630118134656Rat
9104942LOC103692246uncharacterized LOC1036922464169291491169294099Rat
9159197LOC103692092transcription factor BTF3 pseudogene46050383260506706Rat
9116769LOC103692103uncharacterized LOC10369210346862670668655436Rat
9124640LOC10369217960S ribosomal protein L34 pseudogene4120362254120362604Rat
9072808LOC103692262zinc finger HIT domain-containing protein 3 pseudogene4166654362166660847Rat
9074622LOC103692099uncharacterized LOC10369209946364549963654542Rat
9348766LOC10369208460S ribosomal protein L27 pseudogene45174224651742683Rat
9267310LOC103692110interferon-induced transmembrane protein 2 pseudogene45954898259549845Rat
9351185LOC103692231uncharacterized LOC1036922314162104622162134485Rat
9351699LOC10369489440S ribosomal protein S6 pseudogene48681994286820686Rat
9313900LOC103692226uncharacterized LOC1036922264161053128161134504Rat
9229745LOC103692198uncharacterized LOC1036921984132521989132539049Rat
9230431LOC10369222160S ribosomal protein L17 pseudogene4157313085157313947Rat
9367833LOC103692140ATP synthase subunit delta, mitochondrial pseudogene47694416876946742Rat
9232332LOC103695230uncharacterized LOC1036952304169873043169886803Rat
9320161LOC103692107small nuclear ribonucleoprotein E pseudogene46732695167328859Rat
9383752LOC10369208160S ribosomal protein L3 pseudogene44999112250003764Rat
9374544Sdad1-ps1SDA1 domain containing 1, pseudogene 145000501450017758Rat
9287263LOC103692120uncharacterized LOC10369212047521592875218753Rat
9386529Ywhaq-ps4tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta, pseudogene 449449111694491862Rat
9290612LOC10369214440S ribosomal protein S6 pseudogene48684360986845120Rat
9252280LOC103692180uncharacterized LOC1036921804120584341120590943Rat
9252629Igkvl-ps12immunoglobulin kappa variable like, pseudogene 124101726300101727506Rat
9369725Mgammaltase-glucoamylase46944162669602068Rat
9298384Smkr1small lysine-rich protein 145859536358609149Rat
9362818LOC103692227uncharacterized LOC1036922274161248841161287104Rat
9301889LOC103692187uncharacterized LOC1036921874124712546124722083Rat
9264819Tshr-ps1thyroid stimulating hormone receptor, pseudogene 149214265692143138Rat
9330732LOC103690609NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3 pseudogene49782873997829070Rat
9389444LOC103692184glyceraldehyde-3-phosphate dehydrogenase pseudogene4116178416116195253Rat
9389926LOC103692085uncharacterized LOC10369208545788614857889290Rat
9472094Atp6v1fnbATP6V1F neighbor45807076958073496Rat
9472652LOC10369221040S ribosomal protein S12 pseudogene4153219586153220023Rat
9438141LOC103690610Ig kappa chain V-V region L6-like49711573297119085Rat
9400932LOC103692250uncharacterized LOC1036922504170663801170675716Rat
9439280LOC103692161uncharacterized LOC10369216149757291097573408Rat
9410961Ppid-ps6peptidylprolyl isomerase D, pseudogene 646007650560077634Rat
9450947LOC103692240proteasome maturation protein pseudogene4167788500167790946Rat
9455361LOC103694898COMM domain-containing protein 6 pseudogene4153087395153094324Rat
9685082Mir148amicroRNA 148a48033376280333858Rat
11368266Trnac-gca4transfer RNA cysteine (anticodon GCA) 447712852177128592Rat
10398773Hoxaas3Hoxa cluster antisense RNA 348130125481313958Rat
11355186LOC108350864ATP synthase subunit g, mitochondrial pseudogene4104555149104555540Rat
11366389LOC108350783uncharacterized LOC1083507834173150183173178895Rat
11455586LOC108350761uncharacterized LOC1083507614160023192160034671Rat
11449079LOC108350678uncharacterized LOC10835067845431932854357983Rat
11448653LOC108350693high mobility group protein B1 pseudogene46709136867092710Rat
11433693LOC108350824peptidyl-prolyl cis-trans isomerase D pseudogene4164692297164694617Rat
11442637Trnac-gca15transfer RNA cysteine (anticodon GCA) 1547720984077209911Rat
11461811LOC108350742uncharacterized LOC1083507424141571301141599424Rat
11462536Trnac-gca13transfer RNA cysteine (anticodon GCA) 1347719026477190335Rat
11463298LOC108350876uncharacterized LOC1083508764150306396150319990Rat
11081189Nup50-ps1nucleoporin 50, pseudogene 14128787567128789296Rat
11051993Igkvl-ps11immunoglobulin kappa variable like, pseudogene 1149858862498589555Rat
11468430Trnas-gcu6transfer RNA serine (anticodon GCU) 64106831010106831091Rat
11466918Trnac-gca7transfer RNA cysteine (anticodon GCA) 747714011377140184Rat
11469179LOC108350740uncharacterized LOC1083507404134210738134238146Rat
11467847Trnac-gca28transfer RNA cysteine (anticodon GCA) 2847730766177307732Rat
11469937Trnac-gca3transfer RNA cysteine (anticodon GCA) 347712755777127628Rat
11470191Trnac-gca2transfer RNA cysteine (anticodon GCA) 247712214477122215Rat
11472949LOC108350866uncharacterized LOC1083508664105957318105981816Rat
11474695LOC108350790uncharacterized LOC1083507904174780553174786029Rat
11358358LOC108350743uncharacterized LOC1083507434143321781143331269Rat
11436055LOC108350705amiloride-sensitive amine oxidase [copper-containing]-like47787153177873395Rat
11458448LOC108350878uncharacterized LOC1083508784164985838165011361Rat
11458713Igkvl-ps2immunoglobulin kappa variable like, pseudogene 24100774851100775585Rat
11365902Trnac-gca14transfer RNA cysteine (anticodon GCA) 1447720364177203712Rat
11445921Trnac-gca6transfer RNA cysteine (anticodon GCA) 647713711577137186Rat
11368396Trnac-gca17transfer RNA cysteine (anticodon GCA) 1747723542477235495Rat
11437638LOC10835072260S ribosomal protein L27 pseudogene4116278373116281125Rat
11370866LOC108350753uncharacterized LOC1083507534153846873153873689Rat
11051991Igkvl-ps10immunoglobulin kappa variable like, pseudogene 1049976417199765272Rat
11051998Igkvl-ps18immunoglobulin kappa variable like, pseudogene 184101003409101004411Rat
11448279Trnac-gca19transfer RNA cysteine (anticodon GCA) 1947726528277265353Rat
11362919Igkvl-ps13immunoglobulin kappa variable like, pseudogene 1349696857496969477Rat
11439332LOC108350688uncharacterized LOC10835068846073321760817304Rat
11450202LOC108350756uncharacterized LOC1083507564155137257155149163Rat
11450417LOC108350840uncharacterized LOC10835084049087966590931441Rat
11450777LOC108350691uncharacterized LOC10835069146344516263448456Rat
11364654Igkvl-ps17immunoglobulin kappa variable like, pseudogene 1749749492997495415Rat
11051987Igkvl-ps20immunoglobulin kappa variable like, pseudogene 204101195589101196676Rat
11051990Igkvl-ps1immunoglobulin kappa variable like, pseudogene 14100900754100901355Rat
11052016LOC102551948Ig kappa chain V-II region RPMI 6410-like49791651997917533Rat
11052049LOC690813Ig kappa chain V-IV region-like4101838285101839132Rat
11451272LOC108350862uncharacterized LOC10835086248876271388780061Rat
11451624Trnar-ccu2transfer RNA arginine (anticodon CCU) 246727344867273520Rat
11440908LOC108350839high mobility group protein B1-like49130690291309095Rat
11453373Trnac-gca23transfer RNA cysteine (anticodon GCA) 2347727609477276165Rat
11453896LOC108350755thymosin beta-10 pseudogene4155001910155003394Rat
11383953Trnac-gca5transfer RNA cysteine (anticodon GCA) 547713610077136171Rat
11406136LOC108350834uncharacterized LOC10835083445997441259990317Rat
11414885Hoxa1homeobox A148125581481258504Rat
11415393Trnac-gca21transfer RNA cysteine (anticodon GCA) 2147727232077272391Rat
11419404LOC108350809glyceraldehyde-3-phosphate dehydrogenase pseudogene47201417272015171Rat
11420199Trnac-gca25transfer RNA cysteine (anticodon GCA) 2547728386677283937Rat
11420575LOC10835086060S ribosomal protein L31 pseudogene48119187681192258Rat
11421259Senp2-ps9SUMO specific peptidase 2, pseudogene 94161192379161207739Rat
11421296LOC10835086960S ribosomal protein L31 pseudogene4116921291116921723Rat
11424934LOC108350703uncharacterized LOC10835070347719590077341432Rat
11356528LOC108350861glyceraldehyde-3-phosphate dehydrogenase pseudogene48625213086253132Rat
11384346Rpl9-ps19ribosomal protein L9, pseudogene 194149309307149310333Rat
11385872LOC108350868glyceraldehyde-3-phosphate dehydrogenase pseudogene4110616441110617544Rat
11397796Trnac-gca24transfer RNA cysteine (anticodon GCA) 2447728288577282956Rat
11386332Trnac-gca26transfer RNA cysteine (anticodon GCA) 2647729489477294965Rat
11398915Trnal-aag2transfer RNA leucine (anticodon AAG) 24127454175127454256Rat
11410744Trnac-gca1transfer RNA cysteine (anticodon GCA) 147698021376980284Rat
11410861Rps11-ps14ribosomal protein S11, pseudogene 144124395855124398410Rat
11400791Trnac-gca22transfer RNA cysteine (anticodon GCA) 2247727333277273403Rat
11400916LOC108350874uncharacterized LOC1083508744141940905141942281Rat
11411257LOC108350764uncharacterized LOC1083507644159499081159520684Rat
11412043LOC10835085860S ribosomal protein L17 pseudogene47833370478336111Rat
11390635Trnac-gca27transfer RNA cysteine (anticodon GCA) 2747729587377295944Rat
11401676LOC108350707uncharacterized LOC10835070747979076779795915Rat
11379695LOC10835075260S ribosomal protein L17 pseudogene4151573137151573717Rat
11402575LOC108350772uncharacterized LOC1083507724162674714162704635Rat
11402703Rpl27a-ps5ribosomal protein L27a,pseudogene 54108745019108755613Rat
11380450Trnac-gca39transfer RNA cysteine (anticodon GCA) 3947720206277202133Rat
11380647LOC108350745uncharacterized LOC1083507454147262869147277704Rat
11380835LOC108350738uncharacterized LOC1083507384132797064132799375Rat
11391872Trnac-gca9transfer RNA cysteine (anticodon GCA) 947716356377163634Rat
11403251Trnap-agg6transfer RNA proline (anticodon AGG) 645798962657989697Rat
11403894LOC108350781uncharacterized LOC1083507814167701118167722927Rat
11392596LOC108350763uncharacterized LOC1083507634161303795161316166Rat
11405111Vom1r75vomeronasal 1 receptor 7548675662486757556Rat
11382743LOC108350768uncharacterized LOC1083507684161192518161214185Rat
11383082Igkvl-ps19immunoglobulin kappa variable like, pseudogene 194100736032100736741Rat
11519975LOC108350676uncharacterized LOC10835067645301133153070210Rat
11501436LOC108350777uncharacterized LOC1083507774166431911166436571Rat
11502286LOC108350725uncharacterized LOC1083507254118778620118792730Rat
11479062LOC108350782uncharacterized LOC1083507824172488953172492992Rat
11503662LOC108350685uncharacterized LOC10835068545908451759086860Rat
11479425Alg11-ps1ALG11, alpha-1,2-mannosyltransferase, pseudogene 14139862203139863619Rat
11480110LOC108350739uncharacterized LOC1083507394133581761133598613Rat
11481974LOC108350700uncharacterized LOC10835070047224919372293064Rat
11508600Trnag-ccc4transfer RNA glycine (anticodon CCC) 44118852419118852489Rat
11508794LOC108350727uncharacterized LOC1083507274120415759120430399Rat
11497379LOC103691800Ig kappa chain V-IV region-like4101645320101645700Rat
11497862Trnac-gca20transfer RNA cysteine (anticodon GCA) 2047726629777266368Rat
11498065LOC10835080840S ribosomal protein S23 pseudogene47167471371675154Rat
11494192LOC108350675uncharacterized LOC10835067545230586952306706Rat
11515107Trnac-gca16transfer RNA cysteine (anticodon GCA) 1647723254277232613Rat
11515722Trnac-gca11transfer RNA cysteine (anticodon GCA) 1147718033477180405Rat
11516150Eif4e-ps1eukaryotic translation initiation factor 4E, pseudogene 14156653571156657665Rat
11484912Rpl30-ps10ribosomal protein L30, pseudogene 104135972768135975698Rat
11485345LOC108350687uncharacterized LOC10835068746069840160709474Rat
11517337Trnac-gca18transfer RNA cysteine (anticodon GCA) 1847723641577236486Rat
11518313LOC108350719uncharacterized LOC1083507194115639631115642945Rat
11488278LOC108350721uncharacterized LOC1083507214116211039116218830Rat
11488957Trnaa-agc5transfer RNA alanine (anticodon AGC) 54155610386155610452Rat
11489696Trnac-gca29transfer RNA cysteine (anticodon GCA) 294149848557149848628Rat
11490908Trnac-gca12transfer RNA cysteine (anticodon GCA) 1247718288577182956Rat
11491518Trnac-gca10transfer RNA cysteine (anticodon GCA) 1047717826077178331Rat
11492396LOC108350711uncharacterized LOC10835071148215375582165281Rat
41321371LOC120102263uncharacterized LOC12010226347744562977451151Rat
41321497LOC120102565U6 spliceosomal RNA4109168372109168478Rat
41353377LOC120102733small nucleolar RNA SNORA1749823881598238917Rat
41353572LOC120102395uncharacterized LOC1201023954160615660160621883Rat
41354715LOC120102371uncharacterized LOC1201023714150423574150431401Rat
41378383LOC120102307uncharacterized LOC1201023074102761831102791308Rat
41086513Rpl19-ps6ribosomal protein L19, pseudogene 645841579258423285Rat
41086598LOC120102412uncharacterized LOC1201024124166348515166378551Rat
41166952LOC120102316uncharacterized LOC1201023164115098139115106023Rat
41167200LOC120102341vomeronasal type-1 receptor A144122679045122680064Rat
41167571LOC120102158uncharacterized LOC12010215845547681655492390Rat
41203173LOC120102365uncharacterized LOC1201023654147065997147066964Rat
41203940LOC120102612U7 small nuclear RNA45424994254250003Rat
41234562LOC120102340uncharacterized LOC1201023404121723881121732860Rat
41282493LOC120102708small nucleolar RNA SNORA174117652870117652993Rat
41323200LOC120102581U6 spliceosomal RNA49528482095284926Rat
41323307LOC120102777U4 spliceosomal RNA4105038037105038123Rat
41323577LOC120102314uncharacterized LOC1201023144111407391111454991Rat
41355210LOC120102710small nucleolar RNA SNORA174123361345123361441Rat
41381450LOC120102401uncharacterized LOC1201024014161473210161480205Rat
41112623LOC120102736small nucleolar RNA SNORA1749717502897175121Rat
41113583LOC120102728small nucleolar RNA SNORA1749681038496810504Rat
41168976NEWGENE_6576114transfer RNA threonine (anticodon AGU)48552640985526483Rat
41169229LOC120102722small nucleolar RNA SNORA1749826317398263300Rat
41205097NEWGENE_40934091transfer RNA alanine (anticodon AGC)4153468859153468931Rat
41205249Rnu6-936RNA, U6 small nuclear 93649920039799200501Rat
41250383LOC120102287uncharacterized LOC12010228748794191487952110Rat
41277236LOC120102585U6 spliceosomal RNA49914578099145884Rat
41357395LOC120102713small nucleolar RNA SNORA1747175492771755060Rat
41381715LOC120102288uncharacterized LOC12010228848944218589475598Rat
41381944LOC120102305uncharacterized LOC1201023054101437202101439905Rat
41382729LOC120102366uncharacterized LOC1201023664147575390147578136Rat
41383162LOC120102335uncharacterized LOC1201023354120733062120737659Rat
41384154LOC120102260uncharacterized LOC12010226047120915971219286Rat
41113909Ndufb4-ps7NADH:ubiquinone oxidoreductase subunit B4, pseudogene 748147423881474752Rat
41113925Rnu2-63RNA, U2 small nuclear 634169167908169168097Rat
41114178LOC120102583U6 spliceosomal RNA49926872299268826Rat
41140809LOC120102666small nucleolar RNA SNORA174133135428133135559Rat
41140853Rpl7-ps27ribosomal protein L7, pseudogene 274149550038149565446Rat
41141586LOC120102311uncharacterized LOC1201023114105288960105294181Rat
41170451LOC120102696small nucleolar RNA SNORA1749713082197130958Rat
41251011LOC120102700small nucleolar RNA SNORA1749709688597097017Rat
41278566LOC120102621U7 small nuclear RNA45424986854249928Rat
41279683LOC120102707small nucleolar RNA SNORA1745783546757835618Rat
41284758NEWGENE_40938314transfer RNA serine (anticodon AGA)4140797732140797813Rat
41285462LOC120102481uncharacterized LOC12010248145830681058311531Rat
41326110LOC120102327uncharacterized LOC1201023274118919046118930645Rat
41358316LOC120102632small nucleolar RNA SNORA36 family4104895641104895763Rat
41385577LOC120102243uncharacterized LOC12010224345071201250723386Rat
41091302LOC120102631small nucleolar RNA SNORA36 family4168442805168442931Rat
41116076LOC120102770small nucleolar RNA U345347260253472711Rat
41142180LOC120102680small nucleolar RNA SNORA1746776730567767435Rat
41142645Cdc42-ps1cell division cycle 42, pseudogene 147020715770207873Rat
41142959LOC120093104T-cell surface glycoprotein YE1/48-like4163619289163643091Rat
41172269LOC120102644U11 spliceosomal RNA4110662076110662209Rat
41207469LOC120102425uncharacterized LOC1201024254173888010173917457Rat
41253364LOC120102725small nucleolar RNA SNORA1749858397298584104Rat
41287307LOC120102385uncharacterized LOC1201023854157663064157665454Rat
41327009LOC120102729small nucleolar RNA SNORA1749800423498004360Rat
41327517LOC120102427uncharacterized LOC1201024274176409253176422733Rat
41359859LOC120102324uncharacterized LOC1201023244117723370117725707Rat
41386173NEWGENE_40940579transfer RNA leucine (anticodon AAG)49503448895034569Rat
41091703Fbl-ps4fibrillarin, pseudogene 44101416548101417555Rat
41091722LOC120102670small nucleolar RNA SNORA174125861717125861845Rat
41116383LOC120102170thymosin beta-10-like4104962532104963461Rat
41146337LOC120102364uncharacterized LOC1201023644146787484146795910Rat
41173484Rpl21-ps7ribosomal protein L21, pseudogene 748117475881175534Rat
41327928Rnu6-433RNA, U6 small nuclear 4334131099002131099108Rat
41328136LOC120102650small nucleolar RNA SNORA4849582653795826676Rat
41361057Rpl21-ps8ribosomal protein L21, pseudogene 849578372795784432Rat
41361992LOC120102607U6 spliceosomal RNA4135562032135562145Rat
41388537LOC120102326uncharacterized LOC1201023264118416642118424029Rat
41389009LOC120102554U4 spliceosomal RNA4105248170105248327Rat
41389277LOC120102409uncharacterized LOC1201024094162899203162903794Rat
41093189LOC120102273uncharacterized LOC12010227348082463680828739Rat
41093674LOC120102354uncharacterized LOC1201023544133142571133164384Rat
41146352LOC120102380small ubiquitin-related modifier 1-like4155619960155620555Rat
41362761Igkvl-ps8immunoglobulin kappa variable like, pseudogene 849953181099532249Rat
41390060Thrap3-ps3thyroid hormone receptor associated protein 3, pseudogene 345261899952623801Rat
41094682LOC120102721small nucleolar RNA SNORA1749813375998133886Rat
41095347LOC120102254uncharacterized LOC12010225446336104963362181Rat
41096242LOC120102774U4 spliceosomal RNA4151638871151639012Rat
41120297LOC120102574U6 spliceosomal RNA4102735624102735728Rat
41120707LOC120102598U6 spliceosomal RNA49921932699219429Rat
41120855LOC120102337uncharacterized LOC1201023374121604758121615075Rat
41120875Cox7c-ps3Cytochrome c oxidase subunit 7C, pseudogene 34155783930155785243Rat
41148600LOC120102265uncharacterized LOC12010226547827987078287108Rat
41176146LOC120102396sentrin-specific protease 2-like4161243521161247778Rat
41176189LOC120102561U6 spliceosomal RNA4104156903104157009Rat
41176579LOC120102251uncharacterized LOC12010225145916618959197472Rat
41187450Rpl21-ps6ribosomal protein L21, pseudogene 645238660952387084Rat
41187910LOC120102382uncharacterized LOC1201023824156027337156039551Rat
41188358LOC120102768U2 spliceosomal RNA4150054525150054694Rat
41188500LOC120102506uncharacterized LOC1201025064144039749144041146Rat
41211382LOC120102392uncharacterized LOC1201023924159369156159392659Rat
41261845LOC120102369uncharacterized LOC1201023694147944627147947997Rat
41262491LOC120102350uncharacterized LOC1201023504132559007132560324Rat
41331827LOC120102399uncharacterized LOC1201023994161154428161164224Rat
41364677LOC120102648small nucleolar RNA SNORA484102978143102978286Rat
41365694Igkvl-ps7immunoglobulin kappa variable like, pseudogene 749896141998965084Rat
41096447LOC120102705small nucleolar RNA SNORA1745488282354882955Rat
41096961LOC120102643small nucleolar RNA SNORA514111475412111475543Rat
41121066Fam50a-ps1family with sequence similarity 50, member A, pseudogene 14106608389106609566Rat
41121481NEWGENE_40933693transfer RNA proline (anticodon GGG)4149560503149560583Rat
41121586LOC120102292uncharacterized LOC12010229249643512196439487Rat
41121964Cox6c-ps3cytochrome c oxidase subunit 6C, pseudogene 34127416018127417910Rat
41150042LOC120102331uncharacterized LOC1201023314120353804120366389Rat
41150073LOC120102639small nucleolar RNA SNORA2/SNORA34 family4118815877118816012Rat
41150076LOC120102279uncharacterized LOC12010227948170440281727173Rat
41153654LOC120102424uncharacterized LOC1201024244173484566173489427Rat
41153665LOC120102642small nucleolar RNA SNORA294120707367120707503Rat
41177686LOC120102309uncharacterized LOC1201023094104285634104289300Rat
41177763LOC120102688small nucleolar RNA SNORA1748581335885813483Rat
41178684Prune2-ps1prune homolog 2 with BCH domain, pseudogene 14130327921130328679Rat
41263255LOC120102348uncharacterized LOC1201023484129815657129821673Rat
41263518Igkvl-ps5immunoglobulin kappa variable like, pseudogene 549887513898875778Rat
41263594LOC120102406uncharacterized LOC1201024064162360081162367102Rat
41366642Scarna10small Cajal body-specific RNA 104157986558157986885Rat
41367052LOC120093139acidic proline-rich protein PRP25-like4165774396165776501Rat
41392412LOC120102697small nucleolar RNA SNORA1748824063988240769Rat
41392789LOC120102370uncharacterized protein C9orf85 homolog4150205867150206875Rat
41393297NEWGENE_40926764transfer RNA proline (anticodon AGG)4146300941146301014Rat
41180729LOC120102601U6 spliceosomal RNA4144143261144143356Rat
41213572LOC120102610U7 small nuclear RNA4157552861157552922Rat
41213638LOC120102652small nucleolar RNA SNORA484102675250102675393Rat
41214177Ptma-ps6prothymosin alpha, pseudogene 647829254878293734Rat
41368239LOC120102394uncharacterized LOC1201023944160286011160296415Rat
41368653Cox6c-ps4cytochrome c oxidase subunit 6C, pseudogene 445039472250401254Rat
41394606LOC120102693small nucleolar RNA SNORA174177759488177759624Rat
41394821LOC120102171uncharacterized LOC1201021714126995970126999766Rat
41394991LOC120102416keratin-associated protein 5-14167976391167980791Rat
41099928LOC120102275uncharacterized LOC12010227548119303681208800Rat
41123928LOC120102182acidic proline-rich protein PRP254165802821165805103Rat
41156543LOC120102345uncharacterized LOC1201023454126097347126157088Rat
41156854Snord94small nucleolar RNA, C/D box 944103924328103924464Rat
41180823LOC120102592U6 spliceosomal RNA49916978599169889Rat
41181679LOC120102665small nucleolar RNA SNORA1747278134972781478Rat
41193354LOC120102493uncharacterized LOC12010249349329282193299590Rat
41215295LOC120102732small nucleolar RNA SNORA1749715488097155000Rat
41216201LOC120102586U6 spliceosomal RNA4146200474146200580Rat
41267017LOC120102261uncharacterized LOC12010226147126100871284951Rat
41288887LOC120102344uncharacterized LOC1201023444125657909125684813Rat
41344928LOC120102718small nucleolar RNA SNORA174137032326137032442Rat
41345109Hsp90aa1-ps7heat shock protein 90 alpha family class A member 1, pseudogene 748663089386631975Rat
41396160LOC120102675small nucleolar RNA SNORA1748411420284114328Rat
41101884LOC120102262uncharacterized LOC12010226247676728476777220Rat
41125163LOC120102717small nucleolar RNA SNORA1749849391198494037Rat
41125808LOC120102403uncharacterized LOC1201024034161946545161960470Rat
41126171LOC120102771small nucleolar RNA U34132053395132053495Rat
41126584Rnu6-321RNA, U6 small nuclear 32145430365054303756Rat
41157489LOC120102393uncharacterized LOC1201023934159505806159516119Rat
41158046LOC120102501uncharacterized LOC1201025014139283893139296350Rat
41158599LOC120102266uncharacterized LOC12010226647850726778513680Rat
41193953LOC120102686small nucleolar RNA SNORA174167111232167111361Rat
41195085LOC120102492uncharacterized LOC12010249249081616490869483Rat
41268541Rnu6-212RNA, U6 small nuclear 2124158206300158206401Rat
41269840Nudt1-ps1nudix hydrolase 1, pseudogene 149438167994382041Rat
41370877LOC120102391uncharacterized LOC1201023914158182694158185265Rat
41371508LOC120102389uncharacterized LOC1201023894157913815157921519Rat
41372108LOC120102490insulin-induced gene 1 protein-like46733039967331371Rat
41397436LOC120102487uncharacterized LOC12010248745983240159845825Rat
41397929LOC120102250uncharacterized LOC12010225045758550557626664Rat
41398122LOC12010254260S ribosomal protein L21-like4102797216102797569Rat
41070385Snora44small nucleolar RNA, H/ACA box 444126415989126416119Rat
41070524C18h18orf32-ps1similar to human chromosome 18 open reading frame 32, pseudogene 14133734357133734611Rat
41102695LOC120102611U7 small nuclear RNA4136623724136623786Rat
41103026Atp5mg-ps11ATP synthase membrane subunit g, pseudogene 114108818020108821027Rat
41127226LOC120102641small Cajal body-specific RNA 164135361243135361421Rat
41127828LOC120102339uncharacterized LOC1201023394121701048121712111Rat
41159196LOC120102709small nucleolar RNA SNORA174111773083111773205Rat
41195642LOC120102763U2 spliceosomal RNA46500716565007263Rat
41195793LOC120102315uncharacterized LOC1201023154113504541113533897Rat
41196132Rpl38-ps6ribosomal protein L38, pseudogene 646392236963936867Rat
41196182LOC120102769small nucleolar RNA U34146088309146088519Rat
41196388LOC120102291uncharacterized LOC12010229149641626996417217Rat
41196392LOC120102488uncharacterized LOC12010248845987710159880952Rat
41219320LOC120102505cyclin-dependent kinases regulatory subunit 2-like4144220612144220990Rat
41219357LOC120102491uncharacterized LOC12010249146798822168026091Rat
41270105LOC120102319uncharacterized LOC1201023194115515273115521277Rat
41270403Igkvl-ps4immunoglobulin kappa variable like, pseudogene 449936335399363814Rat
41291582Npm1-ps6nucleophosmin 1, pseudogene 64108791940108792947Rat
41291607LOC120102330uncharacterized LOC1201023304120086931120112957Rat
41292079Tmsb10-ps4thymosin, beta 10, pseudogene 44155392522155394525Rat
41347889LOC120102660small nucleolar RNA SNORA174151283431151283559Rat
41347976Eef1b2-ps1eukaryotic translation elongation factor 1 beta 2, pseudogene 148344887783449544Rat
41348576LOC120102637small nucleolar RNA SNORA74148866843148866982Rat
41372663LOC120102573U6 spliceosomal RNA4139689094139689204Rat
41373605LOC120102663small nucleolar RNA SNORA174106494538106494669Rat
41399556LOC120102270uncharacterized LOC12010227048047185780479206Rat
41399876LOC120102605U6 spliceosomal RNA47179492871795029Rat
41072194Rpl23-ps7ribosomal protein L23,pseudogene 746725589767260205Rat
41072523LOC120102179uncharacterized LOC1201021794136171929136192655Rat
41104383LOC120102494uncharacterized LOC12010249449389284393911169Rat
41105292NEWGENE_40940579transfer RNA leucine (anticodon AAG)4153529208153529282Rat
41128409LOC120102161uncharacterized LOC12010216147406270374072374Rat
41129602LOC120102669small nucleolar RNA SNORA174117587214117587345Rat
41161074LOC120102320uncharacterized LOC1201023204116014672116016904Rat
41161138LOC120102336uncharacterized LOC1201023364121277566121278416Rat
41161250Rnu6-604RNA, U6 small nuclear 60446803216868032274Rat
41162112LOC120102268uncharacterized LOC12010226847952343879529558Rat
41229891LOC120102544uncharacterized LOC1201025444108434706108534978Rat
41271751LOC120102378uncharacterized LOC1201023784153689331153692583Rat
41349825Rpl23-ps8ribosomal protein L23,pseudogene 84115616374115621512Rat
41349965Igkvl-ps9immunoglobulin kappa variable like, pseudogene 94101040345101043988Rat
41350806Czib-ps2CXXC motif containing zinc binding protein, pseudogene 24117631660117632934Rat
41373976Snrpg-ps6small nuclear ribonucleoprotein polypeptide G, pseudogene 645830406958304945Rat
41374913LOC120102638small nucleolar RNA SNORA2/SNORA34 family4119234751119234887Rat
41401399Spcs2-ps2signal peptidase complex subunit 2, pseudogene 24102869047102869887Rat
41401598LOC120102374uncharacterized LOC1201023744150988154150999023Rat
41081553LOC120102498uncharacterized LOC1201024984126742553126760176Rat
41081789LOC120102747small nucleolar RNA U894157520539157520799Rat
41106900LOC120102272uncharacterized LOC12010227248063104480644379Rat
41162659Actg1-ps9actin, gamma 1, pseudogene 94133306869133313492Rat
41162732LOC120102317uncharacterized LOC1201023174115217376115228513Rat
41162866NEWGENE_6576114transfer RNA threonine (anticodon AGU)4126353506126353587Rat
41163084LOC120102358uncharacterized LOC1201023584133818078133839199Rat
41163406LOC120102386uncharacterized LOC1201023864157660415157662419Rat
41198727Pam-ps1peptidylglycine alpha-amidating monooxygenase, pseudogene 14165903774165908067Rat
41199103NEWGENE_40933816transfer RNA valine (anticodon AAC)4121218174121218246Rat
41273212LOC120102404uncharacterized LOC1201024044162002325162017963Rat
41294070Ckmt1-ps1creatine kinase, mitochondrial 1, pseudogene 148228467082319694Rat
41294697LOC120102411taste receptor type 2 member 140-like4166329666166331697Rat
41351198LOC120102180uncharacterized LOC1201021804136636923136641514Rat
41351797LOC120102672small nucleolar RNA SNORA174150004608150004742Rat
41376499LOC120102333uncharacterized LOC1201023334120648227120658210Rat
41401725LOC120102735small nucleolar RNA SNORA174156772988156773105Rat
41402055LOC120102752U2 spliceosomal RNA4146594912146595102Rat
41402798LOC120102332uncharacterized LOC1201023324120567736120572576Rat
41403011LOC120102405uncharacterized LOC1201024054162158581162168357Rat
41403052LOC120102750U2 spliceosomal RNA4146511607146511797Rat
41081979LOC120102712U1 spliceosomal RNA49614656196146710Rat
41082831LOC120102446FAD-linked sulfhydryl oxidase ALR-like46209998762100799Rat
41083750LOC120102310uncharacterized LOC1201023104104988896104994531Rat
41107864LOC120102589U6 spliceosomal RNA49929007299290176Rat
41107960LOC120102702small nucleolar RNA SNORA1749700031297000443Rat
41108658LOC120102517uncharacterized LOC12010251748089814280924068Rat
41132129Gabarap-ps3GABA type A receptor-associated protein, pseudogene 34126518341126548868Rat
41200147LOC120102584U6 spliceosomal RNA4157772787157772892Rat
41200685LOC120102325uncharacterized LOC1201023254118176974118190926Rat
41320141LOC120102419uncharacterized LOC1201024194170035182170057126Rat
41352598LOC120102414uncharacterized LOC1201024144167026057167029767Rat
41352693LOC120102755U2 spliceosomal RNA4134969601134969762Rat
41377972LOC120102346uncharacterized LOC1201023464126183463126186067Rat
41403537Timp1-ps1TIMP metallopeptidase inhibitor 1, pseudogene 145760435257606480Rat
41083837LOC120102163uncharacterized LOC12010216348018866680191301Rat
41108878Igkvl-ps14immunoglobulin kappa variable like, pseudogene 1449928277299285103Rat
41109258NEWGENE_40926764transfer RNA proline (anticodon AGG)4104598962104599042Rat
41109424LOC120102372uncharacterized LOC1201023724150812902150819415Rat
41166541LOC120102515uncharacterized LOC12010251547778078477793017Rat
41166573Snu13-ps2small nuclear ribonucleoprotein 13, pseudogene 24144510658144511761Rat
41201656LOC120102267uncharacterized LOC12010226747851382078519021Rat
41233243LOC120102174macrophage migration inhibitory factor-like4132485334132485702Rat
41233693LOC120102633small nucleolar RNA SNORA54116471399116471527Rat
40972096LOC120102367endogenous retrovirus group K member 21 Env polyprotein-like4147699712147708407Rat
40946187Igkvl-ps3immunoglobulin kappa variable like, pseudogene 349934046699340968Rat
40972357LOC120102677small nucleolar RNA SNORA174114390354114390483Rat
40972614LOC120102183proline-rich protein 2-like4165878329165880711Rat
40972881LOC120102759U2 spliceosomal RNA45645195256452095Rat
40973112LOC120102280uncharacterized LOC12010228048225601382264460Rat
41011708LOC120102630small nucleolar RNA SNORA36 family4129770615129770745Rat
40949626LOC120102500uncharacterized LOC1201025004129086996129146558Rat
40973663LOC120102749U1 spliceosomal RNA45500375355003908Rat
40974049LOC120102417uncharacterized LOC1201024174168042535168044541Rat
40974159LOC120102277uncharacterized LOC12010227748157824081580768Rat
40950635LOC120102420uncharacterized LOC1201024204169984046169990987Rat
40974521LOC120102579U6 spliceosomal RNA49925367099253774Rat
41340465LOC120102695small nucleolar RNA SNORA1745369658653696709Rat
41340890LOC120102373uncharacterized LOC1201023734150943127150952907Rat
41340927LOC120102746small nucleolar RNA U134117499018117499122Rat
40952068Rps17-ps7ribosomal protein S17, pseudogene 74167958242167960696Rat
40952747NEWGENE_40938314transfer RNA serine (anticodon AGA)4103396425103396498Rat
40952956Arpc5l-ps4actin related protein 2/3 complex, subunit 5-like, pseudogene 449942323999424376Rat
40976786LOC120102649small nucleolar RNA SNORA484150527373150527515Rat
40926323LOC120102600U6 spliceosomal RNA49362423893624344Rat
40953411LOC120102343uncharacterized LOC1201023434125386934125418673Rat
40953625LOC120102185uncharacterized LOC1201021854169333442169334547Rat
40977765LOC120102731small nucleolar RNA SNORA1749748051797480618Rat
40978413LOC120102509uncharacterized LOC1201025094154458546154471554Rat
40926761LOC120102681small nucleolar RNA SNORA1747557598075576108Rat
40928300Senp2-ps2SUMO specific peptidase 2, pseudogene 24161445852161453314Rat
40928383LOC120102426uncharacterized LOC1201024264174798242174828025Rat
40955934LOC120102329uncharacterized LOC1201023294119717819119729211Rat
40956031LOC120102765U2 spliceosomal RNA4159526155159526327Rat
40956713LOC120102160uncharacterized LOC12010216047198640571989140Rat
40980164LOC120102351RING1 and YY1 binding protein4132876260132929075Rat
40929032LOC120102616U7 small nuclear RNA49406112494061185Rat
40982331LOC120102560U4 spliceosomal RNA45344725653447395Rat
41000453LOC120102408uncharacterized LOC1201024084162826603162832675Rat
41002253LOC120102730small nucleolar RNA SNORA174148787387148787491Rat
40930702LOC120102497uncharacterized LOC1201024974126723866126732961Rat
40930852LOC120102657U1 spliceosomal RNA45695629256956455Rat
40958069LOC120102485uncharacterized LOC12010248545964749359762806Rat
40958942LOC120102428uncharacterized LOC1201024284177741460177773567Rat
40983794LOC120102360uncharacterized LOC1201023604138620225138624508Rat
41002790LOC120102608small nucleolar RNA SNORA73 family45625815156258354Rat
40933824LOC120102387uncharacterized LOC1201023874157788553157793531Rat
40933947LOC120102313uncharacterized LOC1201023134108573617108627858Rat
40959422LOC120102757U2 spliceosomal RNA4152575725152575876Rat
40984833NEWGENE_40926764transfer RNA proline (anticodon AGG)4157888872157888946Rat
41004547LOC120102499uncharacterized LOC1201024994129197518129420528Rat
41004740Klra4-ps1killer cell lectin-like receptor, subfamily A, member 4, pseudogene 14164528494164548811Rat
41004839LOC120102244uncharacterized LOC12010224445314025853147391Rat
41005265LOC120102550uncharacterized LOC1201025504158115475158123311Rat
40934091Trnaa-agctransfer RNA alanine (anticodon AGC)4103258388103258469Rat
40934392LOC120102689small nucleolar RNA SNORA174140680625140680738Rat
40935195Trnad-auctransfer RNA aspartic acid (anticodon AUC)45978748459787557Rat
40935983LOC120102662small nucleolar RNA SNORA174176438218176438347Rat
40961802LOC120102590U6 spliceosomal RNA49934623299346336Rat
40961810LOC120102186uncharacterized LOC1201021864173817659173823154Rat
40986091Timm23-ps6translocase of inner mitochondrial membrane 23, pseudogene 64152877093152878119Rat
41007128LOC120102673small nucleolar RNA SNORA1745338598353386111Rat
40936449LOC120102716small nucleolar RNA SNORA1749757666097576791Rat
40937429LOC120102664small nucleolar RNA SNORA174165020142165020273Rat
40962142LOC120102363translation initiation factor IF-2-like4146447443146458594Rat
40962184LOC120102609small nucleolar RNA SNORA7146819917868199301Rat
40988507LOC120102549killer cell lectin-like receptor subfamily G member 14155426357155433041Rat
41008723LOC120102388uncharacterized LOC1201023884157783186157787376Rat
41008980LOC120102656small nucleolar RNA SNORA484102572182102572325Rat
40939113LOC120093082submandibular gland secretory Glx-rich protein CA4166543761166547614Rat
40964815LOC120102617U7 small nuclear RNA4162603035162603097Rat
40965413LOC120102246uncharacterized LOC12010224645426329454267934Rat
40989992Rpl7-ps25ribosomal protein L7, pseudogene 254156171212156172467Rat
41009709LOC120102711small nucleolar RNA SNORA174117685079117685209Rat
41009975LOC120102483uncharacterized LOC12010248345837333558381144Rat
40966555Rps2-ps30ribosomal protein S2, pseudogene 3045118082051181483Rat
40966591Apoo-ps4apolipoprotein O, pseudogene 448531798985318559Rat
40991721LOC120102726small nucleolar RNA SNORA1749499311894993219Rat
40941309LOC120102276uncharacterized LOC12010227648128008781281256Rat
40942068LOC120102704small nucleolar RNA SNORA1749722965597229787Rat
40942840LOC120102738small Cajal body-specific RNA 114157923016157923151Rat
40942986LOC120102699small nucleolar RNA SNORA1747788726377887385Rat
40993191LOC120102703small nucleolar RNA SNORA174126026597126026707Rat
40993425LOC120102510uncharacterized LOC1201025104177261248177270069Rat
40994091Paics-ps3phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase, pseudogene 349164710291648078Rat
40994149LOC120102674small nucleolar RNA SNORA174167986914167987036Rat
40994299LOC120102257uncharacterized LOC12010225746861471568622669Rat
40943387LOC120102178uncharacterized LOC1201021784135763696135765816Rat
40970919LOC120102253uncharacterized LOC12010225346320022963204908Rat
40996046LOC120102553U4 spliceosomal RNA4142973965142974049Rat
41046683LOC120102245thymosin beta-10-like45316672153167501Rat
41074832LOC120102667small nucleolar RNA SNORA1748298003982980170Rat
41075263Igkvl-ps6immunoglobulin kappa variable like, pseudogene 649901452399015161Rat
41075400NEWGENE_40933816transfer RNA valine (anticodon AAC)47472882274728894Rat
41243681LOC120102661small nucleolar RNA SNORA1748579175085791883Rat
41024371LOC120102557U4 spliceosomal RNA4155771670155771782Rat
41024974LOC120102352uncharacterized LOC1201023524133042414133050061Rat
41048538LOC120102701U1 spliceosomal RNA4108539249108539412Rat
41049106Igkvl-ps15immunoglobulin kappa variable like, pseudogene 1549932280799323306Rat
41049156LOC120102357uncharacterized LOC1201023574133676076133686958Rat
41312835LOC120102520uncharacterized LOC12010252048894704088947688Rat
41313119LOC120102359uncharacterized LOC1201023594136616052136628878Rat
41314095LOC120102353uncharacterized LOC1201023534133100432133108825Rat
41025378LOC120102338uncharacterized LOC1201023384121690045121700753Rat
41025668LOC120102271MICOS complex subunit MIC13-like48062378580625489Rat
41050464LOC120102400uncharacterized LOC1201024004161371510161385774Rat
41078896LOC120102377uncharacterized LOC1201023774153055775153064184Rat
41246146LOC120102361uncharacterized LOC1201023614141728281141747563Rat
41246601LOC120102177uncharacterized LOC1201021774134335166134338245Rat
41316092LOC120102682small nucleolar RNA SNORA1749685191196852043Rat
41027978LOC120102407uncharacterized LOC1201024074162635438162641772Rat
41028316LOC120102281uncharacterized LOC12010228148232552182347057Rat
41028632LOC120102252uncharacterized LOC12010225245937459359381533Rat
41052186LOC120102422uncharacterized LOC1201024224170357230170358173Rat
41052635LOC120102269uncharacterized LOC12010226948011040280114314Rat
41079727NEWGENE_40938314transfer RNA serine (anticodon AGA)48548230785482381Rat
41080233Gapdh-ps70Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 704116161930116162927Rat
41247159LOC120102502uncharacterized LOC1201025024139299748139305639Rat
41247803LOC120102720small nucleolar RNA SNORA174108118729108118852Rat
41318857LOC120102342uncharacterized LOC1201023424124637670124656902Rat
41030033LOC120102587U6 spliceosomal RNA4158700406158700512Rat
41332887NEWGENE_40934091transfer RNA alanine (anticodon AGC)4148841925148842005Rat
41053760LOC120102356uncharacterized LOC1201023564133648139133660193Rat
41136119LOC120102301uncharacterized LOC1201023014100744447100787990Rat
41143089LOC120102740small nucleolar RNA SNORA764148319434148319561Rat
41255876LOC120102647small nucleolar RNA SNORA4849414489094145033Rat
41256239LOC120102402uncharacterized LOC1201024024161698505161701464Rat
41054799LOC120102741small nucleolar RNA SNORD8847116051571160603Rat
41055517LOC120102159uncharacterized LOC12010215947185448371905362Rat
41152181LOC120102169uncharacterized LOC1201021694104098343104105838Rat
41152310LOC120102555U4 spliceosomal RNA4116423166116423314Rat
41257034LOC120102390uncharacterized LOC1201023904158028943158032695Rat
41257949LOC120102328uncharacterized LOC1201023284119415816119417839Rat
41335347Rnu6-131RNA, U6 small nuclear 1314129166306129166407Rat
41031424LOC120102347uncharacterized LOC1201023474128336735128342363Rat
41153446LOC120102756U2 spliceosomal RNA45579655355796713Rat
41221465LOC120102615U7 small nuclear RNA49406097694061038Rat
41258840LOC120102567U6 spliceosomal RNA48784604487846150Rat
41297101LOC120102286uncharacterized LOC12010228648618482886206190Rat
41317445LOC120102593U6 spliceosomal RNA4144668340144668444Rat
41317950LOC120102724small nucleolar RNA SNORA174130392379130392510Rat
41318674LOC120102398sentrin-specific protease 2-like4161368024161370339Rat
41058292LOC120102429uncharacterized LOC1201024294177773659177788909Rat
41058543LOC120102484uncharacterized LOC12010248445863484558638314Rat
41059287LOC120102620U7 small nuclear RNA49171696791717031Rat
41223455LOC120102479uncharacterized LOC12010247944981092649845924Rat
41298329LOC120102516basic proline-rich protein-like47916687779179773Rat
41299232LOC120102622small nucleolar RNA SNORA62/SNORA6 family4169959215169959370Rat
41033320LOC120102595U6 spliceosomal RNA49930944099309544Rat
41059548LOC120102691small nucleolar RNA SNORA1749698993796990067Rat
41059633LOC120102282uncharacterized LOC12010228248317836983186721Rat
41061164LOC120102676small nucleolar RNA SNORA1747962350279623632Rat
41223619LOC120102503uncharacterized LOC1201025034138789618138794102Rat
41299711LOC120102384uncharacterized LOC1201023844157572998157576719Rat
41299916LOC120102588U6 spliceosomal RNA4152565797152565884Rat
41337025LOC120102349uncharacterized LOC1201023494132466966132473095Rat
41337280LOC120102727small nucleolar RNA SNORA1749688594096886060Rat
41337965LOC120102413uncharacterized LOC1201024134166994319167000861Rat
41034677LOC120102248uncharacterized LOC12010224845680319656805686Rat
41035699LOC120102323uncharacterized LOC1201023234117614716117648792Rat
41062867LOC120102308uncharacterized LOC1201023084104292221104321842Rat
41225554Rpl26-ps11ribosomal protein L26, pseudogene 1146839090368395785Rat
41226242LOC120102568U6 spliceosomal RNA47044930770449413Rat
41226461LOC120102278uncharacterized LOC12010227848161340681619082Rat
41301986LOC120102651small nucleolar RNA SNORA4848229639982296539Rat
41302375LOC120102773U4 spliceosomal RNA4174712840174713071Rat
41334655LOC120102640small nucleolar RNA SNORA3245895139358951489Rat
41036133LOC120102375uncharacterized LOC1201023754151066816151075877Rat
41038068LOC120102486uncharacterized LOC12010248645996954160002431Rat
41227538LOC120102655small nucleolar RNA SNORA484121944388121944517Rat
41227954LOC120102684small nucleolar RNA SNORA174157084756157084883Rat
41228509Rnu6-840RNA, U6 small nuclear 8404176642863176642957Rat
41235421LOC120102719small nucleolar RNA SNORA174174964373174964496Rat
41302964NEWGENE_40933816transfer RNA valine (anticodon AAC)4163876371163876443Rat
41016825LOC120102376uncharacterized LOC1201023764151176337151179656Rat
41016841LOC120102668U1 spliceosomal RNA4111394809111394970Rat
41017193LOC120102762U2 spliceosomal RNA4142280446142280654Rat
41039183LOC120102283uncharacterized LOC12010228348318245483189341Rat
41039270LOC120102508uncharacterized LOC1201025084151761162151765077Rat
41039852LOC120102625small nucleolar RNA SNORA704165144932165145065Rat
41039995LOC120102368uncharacterized LOC1201023684147735944147739532Rat
41066235Eef1a1-ps16eukaryotic translation elongation factor 1 alpha 1, pseudogene 164145130360145132187Rat
41236019LOC120102247uncharacterized LOC12010224745443222054444023Rat
41236250LOC120102679U1 spliceosomal RNA4103011258103011413Rat
41236583LOC120102421uncharacterized LOC1201024214170358652170370882Rat
41237120LOC120102383uncharacterized LOC1201023834157404793157408561Rat
41305549LOC120102274uncharacterized LOC12010227448082881280830571Rat
41018082LOC120102321uncharacterized LOC1201023214116080648116105711Rat
41018384Psmb3-ps2proteasome 20S subunit beta 3, pseudogene 24127536885127537501Rat
41042197LOC120102415uncharacterized LOC1201024154167220701167224595Rat
41066520LOC120102683small nucleolar RNA SNORA174156849122156849249Rat
41237666Hmgb1-ps18high-mobility group box 1, pseudogene 1846649212666492794Rat
41305950LOC120102564U6 spliceosomal RNA4101286236101286342Rat
41306080LOC120102423uncharacterized LOC1201024234172518596172533761Rat
41306468LOC120102496uncharacterized LOC1201024964126790194126802525Rat
41018919LOC120102626small nucleolar RNA SNORA704158053924158054052Rat
41020684LOC120102418uncharacterized LOC1201024184169043518169049467Rat
41043092LOC120102284uncharacterized LOC12010228448480010684817508Rat
41044388LOC120102751U2 spliceosomal RNA49015113790151328Rat
41239321LOC120102362uncharacterized LOC1201023624141998399142016719Rat
41021783LOC120102259uncharacterized LOC12010225947042230970428425Rat
41021819LOC120102764U2 spliceosomal RNA46456265364562792Rat
41045910LOC120102715small nucleolar RNA SNORA1749796989597970021Rat
41073567LOC120102430uncharacterized LOC1201024304177887761177892190Rat
41240645LOC120102176uncharacterized LOC1201021764134072462134077268Rat
41309288Rpl21-ps9ribosomal protein L21, pseudogene 94120819893120820436Rat
41309461LOC120102671small nucleolar RNA SNORA1746458071464580842Rat
41023422LOC120102264uncharacterized LOC12010226447769389877696051Rat
1563178Edaectodysplasin-AX6507845465480172Rat

Nucleotide Sequences
GenBank Nucleotide AU028711 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226917817127469484Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)240067944102785628Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)240067944102785628Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)240067944102785628Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)240067944102785628Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)240067944102785628Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243154682202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
2293676Bmd19Bone mineral density QTL 1910.70.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)243162366111362592Rat
2293682Bmd24Bone mineral density QTL 248.90.0001femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)243162366111362592Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243162366148478373Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)259134147127460910Rat
5684990Bmd82Bone mineral density QTL 822.8tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)259324377103795077Rat
5684996Bmd85Bone mineral density QTL 854.70.024tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)259324377103795077Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)259324377141596857Rat
631500Bp99Blood pressure QTL 992.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)259324719102755241Rat
1578777Stresp15Stress response QTL 1520.05blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)259846005104846005Rat
2306903Bp336Blood pressure QTL 3360.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)264366971109366971Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
7411551Bw131Body weight QTL 13129.60.001body mass (VT:0001259)body weight gain (CMO:0000420)267942638112942638Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)272532993157142209Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)276539322102785628Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)276539322102785628Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)276539322150540526Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)278665616143657569Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
61392Bp6Blood pressure QTL 67arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)280270434125270434Rat
1598865Bp296Blood pressure QTL 2962.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)281018907126018907Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
1578772Stresp14Stress response QTL 1450.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)282345893130923501Rat
7207808Bmd89Bone mineral density QTL 894.1femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)288862519133862519Rat
2300165Bmd49Bone mineral density QTL 494.80.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)288862519133862519Rat
2300170Bmd45Bone mineral density QTL 4512.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)288862519133862519Rat
2300185Bmd46Bone mineral density QTL 468.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)288862519133862519Rat
1598862Glom9Glomerulus QTL 93.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)292337601137337601Rat
1598863Cm65Cardiac mass QTL 652.3heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)292337601137337601Rat
631566Bp90Blood pressure QTL 900.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2102803808147803808Rat
8662836Vetf8Vascular elastic tissue fragility QTL 80.66thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2104559726149559726Rat
1581552Pur12Proteinuria QTL 125.190.0009total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)2112103657148076632Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
1354594Despr10Despair related QTL 100.00000249locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)2114654253159654253Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2114837527143657569Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2114837527143657569Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2114837527185876470Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2114837527185876470Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2114837527211674221Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
5135226Leukc2Leukocyte quantity QTL 2eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)2118111229149559726Rat
1582257Gluco21Glucose level QTL 213.10.0035blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2118111229157142209Rat
738007Anxrr7Anxiety related response QTL 74.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2118189491163189491Rat
1581578Cm49Cardiac mass QTL 494.90.01heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2127447387143657569Rat
1358360Sradr2Stress Responsive Adrenal Weight QTL 210.24adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)2129164097152195315Rat
6907363Bp357Blood pressure QTL 3574.10.002arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2129540907174540907Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2133914684202447032Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2135552573202446871Rat
1298076Bp166Blood pressure QTL 1660.0009arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2136445150202447032Rat
1581502Esta3Estrogen-induced thymic atrophy QTL 3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2136916935189599348Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2136916935213594495Rat
12879830Bw178Body weight QTL 1780.001body mass (VT:0001259)body weight (CMO:0000012)2137219876142323610Rat
12879831Cm82Cardiac mass QTL 820.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)2137219876142323610Rat
12879832Cm83Cardiac mass QTL 830.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2137219876142323610Rat
12879833Cm84Cardiac mass QTL 840.001heart right ventricle mass (VT:0007033)heart weight to body weight ratio (CMO:0000074)2137219876142323610Rat
12879834Am1Aortic mass QTL 10.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)2137219876142323610Rat
12879835Kidm60Kidney mass QTL 600.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2137219876142323610Rat
1549841Bp256Blood pressure QTL 2560.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2137219876142323610Rat
7488931Bp367Blood pressure QTL 3670.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2139401804142323610Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2141194931223265385Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2141194931223265385Rat
71113Cari2Carrageenan-induced inflammation QTL 22.70.009hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)2141596551202447032Rat
12879841Cm87Cardiac mass QTL 870.026heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)2142323368146786035Rat
12879842Cm88Cardiac mass QTL 880.042heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2142323368146786035Rat
12879843Am3Aortic mass QTL 30.016aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)2142323368146786035Rat
12879844Kidm62Kidney mass QTL 620.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2142323368146786035Rat
7488933Bp368Blood pressure QTL 3680.004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2142323368147803808Rat
1549828Bp258Blood pressure QTL 2580.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2142323368150650069Rat
724568Uae13Urinary albumin excretion QTL 134.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)2143157029210020885Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2143657411190602963Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2143657411190602963Rat
6903312Bw112Body weight QTL 1123.20.0013body mass (VT:0001259)body weight (CMO:0000012)2143657569184114274Rat
61401Niddm2Non-insulin dependent diabetes mellitus QTL 24.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2144599348189599348Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)41008408955084089Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41008408955084089Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)41008408955084089Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)41008408955084089Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)41008408955084089Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41008408955084089Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41793350862933508Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42133334362278020Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)432583980114627242Rat
11530004Niddm71Non-insulin dependent diabetes mellitus QTL 710.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43258419952754138Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)43443048482490359Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)436303261103194984Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)43950527573892441Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)43952426474726312Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)439524264116179656Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44043338885433388Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)44043341485433414Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44345797688457976Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
10450818Scl76Serum cholesterol level QTL 763.60.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44917811657114705Rat
10450821Scl77Serum cholesterol level QTL 774.10.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44917811657114705Rat
10450825Scl78Serum cholesterol level QTL 783.70.01blood VLDL cholesterol amount (VT:0005144)blood low density lipoprotein cholesterol level (CMO:0000053)44917811657114705Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
4889969Bss96Bone structure and strength QTL 964.9tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)45664777678882945Rat
4889972Bss97Bone structure and strength QTL 975.6tibia size trait (VT:0100001)tibia total bone volume (CMO:0001724)45664777678882945Rat
5685009Bmd86Bone mineral density QTL 863.7tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)45664777678882945Rat
5685012Bmd87Bone mineral density QTL 875.1tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)45664777678882945Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)456698790126192555Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711443291360801Rat
634311Sach7Saccharin preference QTL 7taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)457114432102114432Rat
61336Bp21Blood pressure QTL 214.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711470578881294Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)457486946102486946Rat
1558651Swd3Spike wave discharge measurement QTL 34.620.000024brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)45843213392991462Rat
631671Iddm11Insulin dependent diabetes mellitus QTL 113.60.0012blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)45863587778886137Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)459948935154902892Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
1578657Bss12Bone structure and strength QTL 128.9femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)460220938105220938Rat
1578658Bss13Bone structure and strength QTL 138femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)460220938105220938Rat
2300179Bmd50Bone mineral density QTL 505.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)460928534105928534Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658103194791Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658115089733Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)462277855128289560Rat
6478743Anxrr40Anxiety related response QTL 400.83076defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
6478772Anxrr49Anxiety related response QTL 490.15488defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
6478684Anxrr30Anxiety related response QTL 300.00087defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
631651Bp124Blood pressure QTL 1243arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)462879517107879517Rat
7394826Bw126Body weight QTL 1260.002body mass (VT:0001259)body weight gain (CMO:0000420)46293326987483707Rat
8552807Vie4Viral induced encephalitis QTL 47.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)46293350882490359Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in mean arterial blood pressure (CMO:0002035)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in systolic blood pressure (CMO:0000747)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in pulse pressure (CMO:0001882)462933508114921294Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)462933508114921294Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
2312569Pur19Proteinuria QTL 193.40.001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)46588210796130297Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)46699318572752834Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)46699318572752834Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)46699318572752834Rat
2306547Iddm38Insulin dependent diabetes mellitus QTL 38blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)46738666970362197Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470362013132642728Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)470808386115808386Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)470808386115808386Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473169846132642728Rat
724522Bp146Blood pressure QTL 1462.20.0021arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)473630210118630210Rat
2302051Pia28Pristane induced arthritis QTL 285.30.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)473630210118630210Rat
70167Bw22Body weight QTL 223.1body mass (VT:0001259)body weight (CMO:0000012)476647384117676292Rat
1357342Bw40Body weight QTL 400.001body mass (VT:0001259)body weight (CMO:0000012)476647384117676292Rat
2306545Iddm39Insulin dependent diabetes mellitus QTL 39blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47735672177687411Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)478878504123878504Rat
631556Bp135Blood pressure QTL 1350.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)478881294117676292Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)47888281783007655Rat
2317586Eae25Experimental allergic encephalomyelitis QTL 259.300000190734863nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)47888281783007655Rat
61364Iddm2Insulin dependent diabetes mellitus QTL 2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)478885890102684881Rat
738015Pia9Pristane induced arthritis QTL 94.50.048joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)480694870125694870Rat
2306899Bp338Blood pressure QTL 3380.071arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)481006124120102625Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)481192555126192555Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)482798864152731274Rat
2306794Ean2Experimental allergic neuritis QTL 26.4nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)48342841995853334Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)484728680129854654Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)485253748148090731Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)485253748150276390Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)485379421167139601Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486730991131730991Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487327165132327165Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487327165132327165Rat
2317587Eae26Experimental allergic encephalomyelitis QTL 26nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)488656681103194984Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)490850165135850165Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)493308457167139447Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)495174120140174120Rat
8662350Eae35Experimental allergic encephalomyelitis QTL 356.2blood tumor necrosis factor amount (VT:0008552)inflammatory exudate tumor necrosis factor level (CMO:0001435)4100834579103761084Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4103194656148194656Rat
2317588Eae27Experimental allergic encephalomyelitis QTL 27nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)4103194805112478794Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105789505150789505Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106649412151649412Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4106805662151805662Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109827074154827074Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109827074154827074Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4109866907167139601Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4110275411168266883Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4114627026159627026Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4116179486151161268Rat
724535Cm18Cardiac mass QTL 182.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)4118856416163856416Rat
1331802Srn5Serum renin concentration QTL 53.045renin activity (VT:0005581)plasma renin activity level (CMO:0000116)4119428175157578333Rat
12798527Anxrr58Anxiety related response QTL 584.110.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4119463257147278687Rat
70201Gcr1Gastric cancer resistance QTL 12.7stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)4120260281147278687Rat
2293840Kiddil9Kidney dilation QTL 92.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)4120926564148090731Rat
634347Hcar8Hepatocarcinoma resistance QTL 85.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)4123143783168143783Rat
631683Bp116Blood pressure QTL 1160.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4124303370169303370Rat
6478778Anxrr51Anxiety related response QTL 510.25384locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4124778595169778595Rat
7411558Bw133Body weight QTL 13313.840.001body mass (VT:0001259)body weight gain (CMO:0000420)4125590636170590636Rat
61451Ciaa4CIA Autoantibody QTL 43.1blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)4126395976167139601Rat
737978Pia23Pristane induced arthritis QTL 235.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131730738167139601Rat
631511Pia7Pristane induced arthritis QTL 74.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131730738167139601Rat
1549827Scl46Serum cholesterol level QTL 463.5blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)4132396220177396220Rat
724558Plsm2Polydactyly-luxate syndrome (PLS) morphotypes QTL 20.0003hindlimb integrity trait (VT:0010563)hind foot phalanges count (CMO:0001949)4132422778177422778Rat
61422Cia13Collagen induced arthritis QTL 134.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4132642577167139601Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (CMO:0000132)4135204660180204660Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)4135699135180699135Rat
2293659Bmd35Bone mineral density QTL 354.50.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)4137755016181392681Rat
61362Oia2Oil induced arthritis QTL 20.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4138503169173369699Rat
1298524Oia8Oil induced arthritis QTL 8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4138503169173369699Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4138503169179293946Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478748Anxrr42Anxiety related response QTL 420.28008locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4144639524182687754Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4145568712182687754Rat
634342Cia24Collagen induced arthritis QTL 244.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4146565735175236377Rat
12798525Anxrr57Anxiety related response QTL 573.210.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4147278504167139601Rat
1582237Kidm34Kidney mass QTL 3440.0001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)4148090542168069246Rat
61446Coreg2Compensatory renal growth QTL 23.5kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)4148423102157580971Rat
1581574Eae20Experimental allergic encephalomyelitis QTL 207.8nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)4153031106158841762Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4155561574182687754Rat
731178Oia7Oil induced arthritis QTL 70.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4156050654157232313Rat
1581566Eae21Experimental allergic encephalomyelitis QTL 216.2body mass (VT:0001259)maximum body weight loss to initial body weight ratio (CMO:0001400)4157680158158841762Rat
1300109Rf13Renal function QTL 133.91renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)4157710145182687754Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
70221Bp56Blood pressure QTL 564.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X5704214165612192Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat
1300110Stl7Serum triglyceride level QTL 74.64blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)112952841882566702Rat
2298551Neuinf10Neuroinflammation QTL 103.7nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)113123913478851519Rat
70180BpQTLcluster10Blood pressure QTL cluster 103.19arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)113491804179918041Rat
1300135Rf19Renal function QTL 193.38blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)114094618882566702Rat
2312566Glom20Glomerulus QTL 203.60.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)114428575982566702Rat
1581565Pur10Proteinuria QTL 100.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
1581572Uae35Urinary albumin excretion QTL 350.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
724561Plsm4Polydactyly-luxate syndrome (PLS) morphotypes QTL 40.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)115445753486241447Rat
4889521Gluco62Glucose level QTL 622.820.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)115513672982993457Rat
7411658Foco27Food consumption QTL 2716.20.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)115635142486241447Rat
631506Bp104Blood pressure QTL 1042.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)115980279482566545Rat
70208Niddm22Non-insulin dependent diabetes mellitus QTL 223.61blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)115980279482566553Rat
10058954Gmadr7Adrenal mass QTL 72.490.0049adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)116034659086241447Rat
1549848Bvd6Brain ventricular dilatation QTL 63.10.0001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)116611332182169223Rat
634339Niddm50Non-insulin dependent diabetes mellitus QTL 503.32blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)116642214886241447Rat
1354593Stl12Serum triglyceride level QTL 123.36blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)116642214886241447Rat
1354656Bvd3Brain ventricular dilatation QTL 33.640.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)116944607082846715Rat


Additional Information

Database Acc Id Source(s)
UniSTS 112061 UniSTS