Symbol:
Mxd1
Name:
max dimerization protein 1
RGD ID:
1564525
Description:
Predicted to enable DNA-binding transcription repressor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in negative regulation of transcription by RNA polymerase II. Predicted to be located in several cellular components, including chromatin; mitochondrion; and nucleoplasm. Predicted to be part of Mad-Max complex. Orthologous to human MXD1 (MAX dimerization protein 1); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; amphetamine; atrazine.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC362391; Mad-1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
MXD1 (MAX dimerization protein 1) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Mxd1 (MAX dimerization protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Mxd1 (MAX dimerization protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
MXD1 (MAX dimerization protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
MXD1 (MAX dimerization protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Mxd1 (MAX dimerization protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
MXD1 (MAX dimerization protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
MXD1 (MAX dimerization protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Mxd1 (MAX dimerization protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
MXD1 (MAX dimerization protein 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Mxd1 (MAX dimerization protein 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
mxd1 (MAX dimerization protein 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
mdl-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
mxd1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 120,654,731 - 120,678,972 (-) NCBI GRCr8 mRatBN7.2 4 119,097,353 - 119,118,080 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 119,097,353 - 119,117,751 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 124,569,846 - 124,590,267 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 120,344,579 - 120,365,000 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 118,968,838 - 118,989,263 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 118,451,752 - 118,472,150 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 118,449,882 - 118,472,179 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 183,021,767 - 183,042,167 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 120,801,932 - 120,822,346 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 108,067,388 - 108,087,863 (-) NCBI Celera Cytogenetic Map 4 q34 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mxd1 Rat (-)-alpha-phellandrene increases expression ISO MXD1 (Homo sapiens) 6480464 alpha phellandrene results in increased expression of MXD1 mRNA CTD PMID:25075043 Mxd1 Rat (-)-demecolcine increases expression ISO MXD1 (Homo sapiens) 6480464 Demecolcine results in increased expression of MXD1 mRNA CTD PMID:23649840 Mxd1 Rat (1->4)-beta-D-glucan multiple interactions ISO Mxd1 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of MXD1 mRNA CTD PMID:36331819 Mxd1 Rat 1,2-dimethylhydrazine decreases expression ISO Mxd1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of MXD1 mRNA CTD PMID:22206623 Mxd1 Rat 1-fluoro-2,4-dinitrobenzene increases expression ISO MXD1 (Homo sapiens) 6480464 Dinitrofluorobenzene results in increased expression of MXD1 mRNA CTD PMID:21362464 Mxd1 Rat 15-acetyldeoxynivalenol increases expression ISO MXD1 (Homo sapiens) 6480464 15-acetyldeoxynivalenol results in increased expression of MXD1 mRNA CTD PMID:23792671 Mxd1 Rat 17beta-estradiol multiple interactions ISO MXD1 (Homo sapiens) 6480464 Estradiol promotes the reaction [ESR2 protein affects the expression of MXD1 mRNA] CTD PMID:20404318 Mxd1 Rat 17beta-estradiol increases expression ISO MXD1 (Homo sapiens) 6480464 Estradiol results in increased expression of MXD1 mRNA CTD PMID:31614463 Mxd1 Rat 17beta-estradiol increases expression ISO Mxd1 (Mus musculus) 6480464 Estradiol results in increased expression of MXD1 mRNA CTD PMID:39298647 Mxd1 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO MXD1 (Homo sapiens) 6480464 2 more ... CTD PMID:19095052 and PMID:31173147 Mxd1 Rat 2,2',5,5'-tetrachlorobiphenyl increases expression ISO MXD1 (Homo sapiens) 6480464 2 more ... CTD PMID:21703328 Mxd1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO MXD1 (Homo sapiens) 6480464 Cycloheximide inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of MXD1 mRNA] CTD PMID:11007951 Mxd1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of MXD1 mRNA CTD PMID:32109520 and PMID:33387578 Mxd1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO MXD1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of MXD1 mRNA CTD PMID:17101203 Mxd1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO MXD1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of MXD1 mRNA CTD PMID:11007951 Mxd1 Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Mxd1 (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Mxd1 Rat 2-palmitoylglycerol increases expression ISO MXD1 (Homo sapiens) 6480464 2-palmitoylglycerol results in increased expression of MXD1 mRNA CTD PMID:37199045 Mxd1 Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Mxd1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of MXD1 mRNA CTD PMID:26251327 Mxd1 Rat 3,4-methylenedioxymethamphetamine decreases methylation ISO Mxd1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased methylation of MXD1 promoter CTD PMID:26251327 Mxd1 Rat 4-hydroxynon-2-enal decreases expression ISO Mxd1 (Mus musculus) 6480464 4-hydroxy-2-nonenal results in decreased expression of MXD1 mRNA CTD PMID:19191707 Mxd1 Rat acrolein multiple interactions ISO MXD1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of MXD1 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in decreased expression of MXD1 mRNA CTD PMID:32699268 Mxd1 Rat acrylamide increases expression ISO MXD1 (Homo sapiens) 6480464 Acrylamide results in increased expression of MXD1 mRNA CTD PMID:32763439 Mxd1 Rat aflatoxin B1 decreases methylation ISO MXD1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of MXD1 gene CTD PMID:27153756 Mxd1 Rat aldehydo-D-glucose multiple interactions ISO Mxd1 (Mus musculus) 6480464 Glucose promotes the reaction [MXD1 protein binds to TUG1 promoter] CTD PMID:32467232 Mxd1 Rat all-trans-retinoic acid increases expression ISO MXD1 (Homo sapiens) 6480464 Tretinoin results in increased expression of MXD1 mRNA and Tretinoin results in increased expression of MXD1 protein CTD PMID:15770638 and PMID:33167477 Mxd1 Rat alpha-phellandrene increases expression ISO MXD1 (Homo sapiens) 6480464 alpha phellandrene results in increased expression of MXD1 mRNA CTD PMID:25075043 Mxd1 Rat alpha-pinene multiple interactions ISO MXD1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of MXD1 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in decreased expression of MXD1 mRNA CTD PMID:32699268 Mxd1 Rat amiodarone increases expression ISO MXD1 (Homo sapiens) 6480464 Amiodarone results in increased expression of MXD1 mRNA CTD PMID:19774075 Mxd1 Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of MXD1 mRNA CTD PMID:30779732 Mxd1 Rat antirheumatic drug decreases expression ISO MXD1 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of MXD1 mRNA CTD PMID:24449571 Mxd1 Rat aristolochic acid A increases expression ISO MXD1 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of MXD1 mRNA CTD PMID:33212167 Mxd1 Rat arsane decreases expression ISO Mxd1 (Mus musculus) 6480464 Arsenic results in decreased expression of MXD1 mRNA CTD PMID:19654921 Mxd1 Rat arsane multiple interactions ISO MXD1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MXD1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of MXD1 mRNA CTD PMID:39836092 Mxd1 Rat arsenic atom decreases expression ISO Mxd1 (Mus musculus) 6480464 Arsenic results in decreased expression of MXD1 mRNA CTD PMID:19654921 Mxd1 Rat arsenic atom multiple interactions ISO MXD1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MXD1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of MXD1 mRNA CTD PMID:39836092 Mxd1 Rat arsenite(3-) multiple interactions ISO MXD1 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to MXD1 mRNA] CTD PMID:32406909 Mxd1 Rat arsenous acid increases expression ISO MXD1 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of MXD1 mRNA CTD PMID:25258189 and PMID:26705709 Mxd1 Rat atrazine increases expression EXP 6480464 Atrazine results in increased expression of MXD1 mRNA CTD PMID:36841081 Mxd1 Rat azathioprine increases expression ISO MXD1 (Homo sapiens) 6480464 Azathioprine results in increased expression of MXD1 mRNA CTD PMID:22623647 Mxd1 Rat benzene increases expression ISO MXD1 (Homo sapiens) 6480464 Benzene results in increased expression of MXD1 mRNA CTD PMID:20359517 Mxd1 Rat benzo[a]pyrene decreases expression ISO Mxd1 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of MXD1 mRNA CTD PMID:20127859 Mxd1 Rat benzo[a]pyrene increases expression ISO MXD1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of MXD1 mRNA CTD PMID:20064835 and PMID:26238291 Mxd1 Rat benzoates increases expression ISO MXD1 (Homo sapiens) 6480464 Benzoates analog results in increased expression of MXD1 mRNA CTD PMID:29472718 Mxd1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of MXD1 mRNA CTD PMID:25181051 Mxd1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of MXD1 mRNA CTD PMID:30816183 and PMID:32528016 Mxd1 Rat bisphenol A affects expression ISO MXD1 (Homo sapiens) 6480464 bisphenol A affects the expression of MXD1 mRNA CTD PMID:30903817 Mxd1 Rat bisphenol A affects methylation ISO Mxd1 (Mus musculus) 6480464 bisphenol A affects the methylation of MXD1 promoter CTD PMID:27334623 Mxd1 Rat C60 fullerene decreases expression EXP 6480464 fullerene C60 results in decreased expression of MXD1 mRNA CTD PMID:19167457 Mxd1 Rat cadmium atom increases expression ISO MXD1 (Homo sapiens) 6480464 Cadmium results in increased expression of MXD1 mRNA CTD PMID:21120746 Mxd1 Rat cadmium atom multiple interactions ISO Mxd1 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of MXD1 mRNA CTD PMID:37325564 Mxd1 Rat cadmium atom multiple interactions ISO MXD1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MXD1 mRNA CTD PMID:35301059 Mxd1 Rat cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of MXD1 mRNA CTD PMID:33453195 Mxd1 Rat cadmium dichloride multiple interactions ISO Mxd1 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of MXD1 mRNA CTD PMID:37325564 Mxd1 Rat cadmium dichloride multiple interactions ISO MXD1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MXD1 mRNA CTD PMID:35301059 Mxd1 Rat cadmium dichloride increases expression ISO MXD1 (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of MXD1 mRNA CTD PMID:38568856 Mxd1 Rat cadmium dichloride decreases expression ISO MXD1 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of MXD1 mRNA CTD PMID:38382870 Mxd1 Rat cadmium sulfate increases expression ISO MXD1 (Homo sapiens) 6480464 cadmium sulfate results in increased expression of MXD1 mRNA CTD PMID:21783983 Mxd1 Rat calcitriol increases expression ISO MXD1 (Homo sapiens) 6480464 Calcitriol results in increased expression of MXD1 mRNA CTD PMID:16002434 Mxd1 Rat carbamazepine affects expression ISO MXD1 (Homo sapiens) 6480464 Carbamazepine affects the expression of MXD1 mRNA CTD PMID:24752500 Mxd1 Rat carbon nanotube increases expression ISO Mxd1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Mxd1 Rat chlorpyrifos decreases expression ISO Mxd1 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of MXD1 mRNA CTD PMID:37019170 Mxd1 Rat chromium(6+) affects expression ISO Mxd1 (Mus musculus) 6480464 chromium hexavalent ion affects the expression of MXD1 mRNA CTD PMID:28472532 Mxd1 Rat cobalt dichloride increases expression ISO MXD1 (Homo sapiens) 6480464 cobaltous chloride results in increased expression of MXD1 mRNA CTD PMID:19320972 Mxd1 Rat cocaine increases expression ISO Mxd1 (Mus musculus) 6480464 Cocaine results in increased expression of MXD1 mRNA CTD PMID:27506785 Mxd1 Rat copper atom increases expression EXP 6480464 Copper deficiency results in increased expression of MXD1 mRNA CTD PMID:26033743 Mxd1 Rat copper atom decreases expression ISO MXD1 (Homo sapiens) 6480464 Copper results in decreased expression of MXD1 mRNA CTD PMID:16391388 Mxd1 Rat copper atom increases expression ISO MXD1 (Homo sapiens) 6480464 Copper results in increased expression of MXD1 mRNA CTD PMID:19747488 Mxd1 Rat copper atom multiple interactions ISO MXD1 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of MXD1 mRNA CTD PMID:20971185 Mxd1 Rat copper(0) increases expression EXP 6480464 Copper deficiency results in increased expression of MXD1 mRNA CTD PMID:26033743 Mxd1 Rat copper(0) decreases expression ISO MXD1 (Homo sapiens) 6480464 Copper results in decreased expression of MXD1 mRNA CTD PMID:16391388 Mxd1 Rat copper(0) increases expression ISO MXD1 (Homo sapiens) 6480464 Copper results in increased expression of MXD1 mRNA CTD PMID:19747488 Mxd1 Rat copper(0) multiple interactions ISO MXD1 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of MXD1 mRNA CTD PMID:20971185 Mxd1 Rat copper(II) chloride increases expression ISO MXD1 (Homo sapiens) 6480464 cupric chloride results in increased expression of MXD1 mRNA CTD PMID:38568856 Mxd1 Rat copper(II) sulfate increases expression ISO MXD1 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of MXD1 mRNA CTD PMID:19549813 Mxd1 Rat crocidolite asbestos increases expression ISO MXD1 (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of MXD1 mRNA CTD PMID:18687144 Mxd1 Rat crocidolite asbestos decreases expression ISO Mxd1 (Mus musculus) 6480464 Asbestos and Crocidolite results in decreased expression of MXD1 mRNA CTD PMID:29279043 Mxd1 Rat crotonaldehyde increases expression ISO MXD1 (Homo sapiens) 6480464 2-butenal results in increased expression of MXD1 mRNA CTD PMID:20471460 Mxd1 Rat curcumin increases expression ISO MXD1 (Homo sapiens) 6480464 Curcumin results in increased expression of MXD1 mRNA CTD PMID:15713895 Mxd1 Rat cycloheximide multiple interactions ISO MXD1 (Homo sapiens) 6480464 Cycloheximide inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of MXD1 mRNA] CTD PMID:11007951 Mxd1 Rat cyclosporin A increases expression ISO MXD1 (Homo sapiens) 6480464 Cyclosporine results in increased expression of MXD1 mRNA CTD PMID:20106945 more ... Mxd1 Rat D-glucose multiple interactions ISO Mxd1 (Mus musculus) 6480464 Glucose promotes the reaction [MXD1 protein binds to TUG1 promoter] CTD PMID:32467232 Mxd1 Rat DDE decreases expression ISO MXD1 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in decreased expression of MXD1 mRNA CTD PMID:38568856 Mxd1 Rat diarsenic trioxide increases expression ISO MXD1 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of MXD1 mRNA CTD PMID:25258189 and PMID:26705709 Mxd1 Rat diazinon increases methylation ISO MXD1 (Homo sapiens) 6480464 Diazinon results in increased methylation of MXD1 gene CTD PMID:22964155 Mxd1 Rat Dibutyl phosphate affects expression ISO MXD1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of MXD1 mRNA CTD PMID:37042841 Mxd1 Rat dichloromethane increases expression ISO MXD1 (Homo sapiens) 6480464 Methylene Chloride results in increased expression of MXD1 mRNA CTD PMID:20359517 Mxd1 Rat diclofenac affects expression ISO MXD1 (Homo sapiens) 6480464 Diclofenac affects the expression of MXD1 mRNA CTD PMID:24752500 Mxd1 Rat diethylstilbestrol increases expression ISO Mxd1 (Mus musculus) 6480464 Diethylstilbestrol results in increased expression of MXD1 mRNA CTD PMID:15171707 Mxd1 Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Blood Glucose deficiency co-treated with Particulate Matter] results in increased expression of MXD1 mRNA CTD PMID:33729688 Mxd1 Rat diuron increases expression EXP 6480464 Diuron results in increased expression of MXD1 mRNA CTD PMID:25152437 Mxd1 Rat dorsomorphin multiple interactions ISO MXD1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Mxd1 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of MXD1 mRNA CTD PMID:29391264 Mxd1 Rat entinostat decreases expression ISO MXD1 (Homo sapiens) 6480464 entinostat results in decreased expression of MXD1 mRNA CTD PMID:26272509 and PMID:27188386 Mxd1 Rat entinostat multiple interactions ISO MXD1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of MXD1 mRNA CTD PMID:27188386 Mxd1 Rat ethanol multiple interactions ISO MXD1 (Homo sapiens) 6480464 [Ethanol co-treated with Folic Acid] results in increased expression of MXD1 mRNA CTD PMID:23378141 Mxd1 Rat ethyl methanesulfonate increases expression ISO MXD1 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in increased expression of MXD1 mRNA CTD PMID:23649840 Mxd1 Rat ethylbenzene increases expression ISO MXD1 (Homo sapiens) 6480464 ethylbenzene results in increased expression of MXD1 mRNA CTD PMID:20359517 Mxd1 Rat eugenol increases expression ISO MXD1 (Homo sapiens) 6480464 Eugenol results in increased expression of MXD1 mRNA CTD PMID:20713136 Mxd1 Rat folic acid multiple interactions ISO MXD1 (Homo sapiens) 6480464 [Ethanol co-treated with Folic Acid] results in increased expression of MXD1 mRNA and [Folic Acid deficiency co-treated with Methotrexate] results in increased expression of MXD1 mRNA CTD PMID:23378141 and PMID:24657277 Mxd1 Rat folic acid decreases expression ISO Mxd1 (Mus musculus) 6480464 Folic Acid results in decreased expression of MXD1 mRNA CTD PMID:25629700 Mxd1 Rat formaldehyde increases expression ISO MXD1 (Homo sapiens) 6480464 Formaldehyde results in increased expression of MXD1 mRNA CTD PMID:23416264 and PMID:23649840 Mxd1 Rat furan increases expression EXP 6480464 furan results in increased expression of MXD1 mRNA CTD PMID:25539665 Mxd1 Rat genistein increases expression ISO MXD1 (Homo sapiens) 6480464 Genistein results in increased expression of MXD1 mRNA CTD PMID:26865667 Mxd1 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of MXD1 mRNA CTD PMID:33387578 Mxd1 Rat geraniol increases expression ISO MXD1 (Homo sapiens) 6480464 geraniol results in increased expression of MXD1 mRNA CTD PMID:27683099 Mxd1 Rat glucose multiple interactions ISO Mxd1 (Mus musculus) 6480464 Glucose promotes the reaction [MXD1 protein binds to TUG1 promoter] CTD PMID:32467232 Mxd1 Rat ibuprofen increases expression ISO MXD1 (Homo sapiens) 6480464 Ibuprofen results in increased expression of MXD1 mRNA CTD PMID:17070997 Mxd1 Rat iron dichloride increases expression ISO MXD1 (Homo sapiens) 6480464 ferrous chloride results in increased expression of MXD1 mRNA CTD PMID:35984750 Mxd1 Rat ivermectin multiple interactions ISO Mxd1 (Mus musculus) 6480464 Ivermectin inhibits the reaction [MXD1 protein binds to SIN3A protein] CTD PMID:26078298 Mxd1 Rat ivermectin multiple interactions ISO MXD1 (Homo sapiens) 6480464 Ivermectin inhibits the reaction [MXD1 protein binds to SIN3A protein] CTD PMID:26078298 Mxd1 Rat leflunomide increases expression ISO MXD1 (Homo sapiens) 6480464 leflunomide results in increased expression of MXD1 mRNA CTD PMID:28988120 Mxd1 Rat Licochalcone B increases expression ISO MXD1 (Homo sapiens) 6480464 licochalcone B results in increased expression of MXD1 mRNA CTD PMID:33647349 Mxd1 Rat lipopolysaccharide increases expression ISO MXD1 (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of MXD1 mRNA CTD PMID:21362464 Mxd1 Rat lipopolysaccharide multiple interactions ISO MXD1 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine co-treated with Lipopolysaccharides] results in increased expression of MXD1 mRNA CTD PMID:35811015 Mxd1 Rat manganese atom multiple interactions ISO MXD1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MXD1 mRNA CTD PMID:39836092 Mxd1 Rat manganese(0) multiple interactions ISO MXD1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MXD1 mRNA CTD PMID:39836092 Mxd1 Rat manganese(II) chloride multiple interactions ISO MXD1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MXD1 mRNA CTD PMID:39836092 Mxd1 Rat menadione affects expression ISO MXD1 (Homo sapiens) 6480464 Vitamin K 3 affects the expression of MXD1 mRNA CTD PMID:20044591 Mxd1 Rat methotrexate affects response to substance ISO MXD1 (Homo sapiens) 6480464 MXD1 mRNA affects the susceptibility to Methotrexate CTD PMID:22753658 Mxd1 Rat methotrexate increases expression ISO MXD1 (Homo sapiens) 6480464 Methotrexate results in increased expression of MXD1 mRNA CTD PMID:21678067 and PMID:24657277 Mxd1 Rat methotrexate multiple interactions ISO MXD1 (Homo sapiens) 6480464 [Folic Acid deficiency co-treated with Methotrexate] results in increased expression of MXD1 mRNA CTD PMID:24657277 Mxd1 Rat methyl methanesulfonate increases expression ISO MXD1 (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of MXD1 mRNA CTD PMID:23649840 Mxd1 Rat methylmercury chloride increases expression ISO MXD1 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of MXD1 mRNA CTD PMID:28001369 Mxd1 Rat methylseleninic acid affects expression ISO MXD1 (Homo sapiens) 6480464 methylselenic acid affects the expression of MXD1 mRNA CTD PMID:14617803 Mxd1 Rat o-xylene increases expression ISO MXD1 (Homo sapiens) 6480464 2-xylene results in increased expression of MXD1 mRNA CTD PMID:20359517 Mxd1 Rat ozone multiple interactions ISO MXD1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in decreased expression of MXD1 mRNA more ... CTD PMID:32699268 Mxd1 Rat p-chloromercuribenzoic acid multiple interactions ISO MXD1 (Homo sapiens) 6480464 [NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MXD1 mRNA CTD PMID:27188386 Mxd1 Rat paracetamol affects expression ISO Mxd1 (Mus musculus) 6480464 Acetaminophen affects the expression of MXD1 mRNA CTD PMID:17562736 Mxd1 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of MXD1 mRNA CTD PMID:33387578 Mxd1 Rat paracetamol increases expression ISO MXD1 (Homo sapiens) 6480464 Acetaminophen results in increased expression of MXD1 mRNA CTD PMID:21420995 and PMID:29067470 Mxd1 Rat paracetamol increases expression ISO Mxd1 (Mus musculus) 6480464 Acetaminophen results in increased expression of MXD1 mRNA CTD PMID:11752693 Mxd1 Rat perfluorononanoic acid increases expression ISO MXD1 (Homo sapiens) 6480464 perfluoro-n-nonanoic acid results in increased expression of MXD1 mRNA CTD PMID:32588087 Mxd1 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Mxd1 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of MXD1 mRNA CTD PMID:36331819 Mxd1 Rat phenobarbital affects expression ISO Mxd1 (Mus musculus) 6480464 Phenobarbital affects the expression of MXD1 mRNA CTD PMID:23091169 Mxd1 Rat phenylmercury acetate increases expression ISO MXD1 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of MXD1 mRNA CTD PMID:26272509 Mxd1 Rat phenylmercury acetate multiple interactions ISO MXD1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MXD1 mRNA CTD PMID:27188386 Mxd1 Rat pioglitazone multiple interactions ISO MXD1 (Homo sapiens) 6480464 [pioglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of MXD1 mRNA and pioglitazone inhibits the reaction [tert-Butylhydroperoxide results in increased expression of MXD1 mRNA] CTD PMID:20847119 Mxd1 Rat pirinixic acid decreases expression ISO Mxd1 (Mus musculus) 6480464 pirinixic acid results in decreased expression of MXD1 mRNA CTD PMID:17426115 Mxd1 Rat quercetin increases expression ISO MXD1 (Homo sapiens) 6480464 Quercetin results in increased expression of MXD1 mRNA CTD PMID:21632981 Mxd1 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO MXD1 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine co-treated with Lipopolysaccharides] results in increased expression of MXD1 mRNA CTD PMID:35811015 Mxd1 Rat SB 431542 multiple interactions ISO MXD1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Mxd1 Rat Selamectin multiple interactions ISO Mxd1 (Mus musculus) 6480464 selamectin inhibits the reaction [MXD1 protein binds to SIN3A protein] CTD PMID:26078298 Mxd1 Rat Selamectin multiple interactions ISO MXD1 (Homo sapiens) 6480464 selamectin inhibits the reaction [MXD1 protein binds to SIN3A protein] CTD PMID:26078298 Mxd1 Rat serpentine asbestos increases expression ISO MXD1 (Homo sapiens) 6480464 Asbestos and Serpentine results in increased expression of MXD1 mRNA CTD PMID:21148743 Mxd1 Rat silicon dioxide increases expression ISO Mxd1 (Mus musculus) 6480464 Silicon Dioxide results in increased expression of MXD1 mRNA CTD PMID:23221170 Mxd1 Rat silicon dioxide increases methylation ISO MXD1 (Homo sapiens) 6480464 Silicon Dioxide results in increased methylation of MXD1 3' UTR CTD PMID:34973136 Mxd1 Rat silver atom decreases expression ISO Mxd1 (Mus musculus) 6480464 Silver results in decreased expression of MXD1 mRNA CTD PMID:27131904 Mxd1 Rat silver atom increases expression ISO MXD1 (Homo sapiens) 6480464 Silver results in increased expression of MXD1 mRNA CTD PMID:26014281 Mxd1 Rat silver(0) decreases expression ISO Mxd1 (Mus musculus) 6480464 Silver results in decreased expression of MXD1 mRNA CTD PMID:27131904 Mxd1 Rat silver(0) increases expression ISO MXD1 (Homo sapiens) 6480464 Silver results in increased expression of MXD1 mRNA CTD PMID:26014281 Mxd1 Rat sodium arsenite decreases expression ISO MXD1 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of MXD1 mRNA CTD PMID:12377979 Mxd1 Rat sodium arsenite multiple interactions ISO MXD1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MXD1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of MXD1 mRNA CTD PMID:39836092 Mxd1 Rat sodium arsenite increases expression ISO MXD1 (Homo sapiens) 6480464 sodium arsenite results in increased expression of MXD1 mRNA CTD PMID:12760830 and PMID:38568856 Mxd1 Rat sodium dodecyl sulfate increases expression ISO MXD1 (Homo sapiens) 6480464 Sodium Dodecyl Sulfate results in increased expression of MXD1 mRNA CTD PMID:20713136 Mxd1 Rat sodium fluoride increases expression ISO Mxd1 (Mus musculus) 6480464 Sodium Fluoride results in increased expression of MXD1 mRNA CTD PMID:27862939 Mxd1 Rat Soman increases expression EXP 6480464 Soman results in increased expression of MXD1 mRNA CTD PMID:19281266 Mxd1 Rat sulforaphane increases expression ISO MXD1 (Homo sapiens) 6480464 sulforaphane results in increased expression of MXD1 mRNA CTD PMID:26833863 Mxd1 Rat tert-butyl hydroperoxide multiple interactions ISO MXD1 (Homo sapiens) 6480464 [pioglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of MXD1 mRNA more ... CTD PMID:20847119 Mxd1 Rat tert-butyl hydroperoxide increases expression ISO MXD1 (Homo sapiens) 6480464 tert-Butylhydroperoxide results in increased expression of MXD1 mRNA CTD PMID:20847119 Mxd1 Rat thimerosal increases expression ISO MXD1 (Homo sapiens) 6480464 Thimerosal results in increased expression of MXD1 mRNA CTD PMID:16870260 Mxd1 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of MXD1 mRNA CTD PMID:34492290 Mxd1 Rat thiram increases expression ISO MXD1 (Homo sapiens) 6480464 Thiram results in increased expression of MXD1 mRNA CTD PMID:38568856 Mxd1 Rat titanium dioxide increases methylation ISO Mxd1 (Mus musculus) 6480464 titanium dioxide results in increased methylation of MXD1 gene CTD PMID:35295148 Mxd1 Rat toluene increases expression ISO MXD1 (Homo sapiens) 6480464 Toluene results in increased expression of MXD1 mRNA CTD PMID:20359517 Mxd1 Rat tributylstannane increases expression ISO Mxd1 (Mus musculus) 6480464 tributyltin results in increased expression of MXD1 mRNA CTD PMID:31939706 Mxd1 Rat trichloroethene increases expression ISO MXD1 (Homo sapiens) 6480464 Trichloroethylene results in increased expression of MXD1 mRNA CTD PMID:20359517 Mxd1 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of MXD1 mRNA CTD PMID:33387578 Mxd1 Rat triphenyl phosphate affects expression ISO MXD1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of MXD1 mRNA CTD PMID:37042841 Mxd1 Rat triptonide increases expression ISO Mxd1 (Mus musculus) 6480464 triptonide results in increased expression of MXD1 mRNA CTD PMID:33045310 Mxd1 Rat tris(2-butoxyethyl) phosphate affects expression ISO MXD1 (Homo sapiens) 6480464 tris(2-butoxyethyl) phosphate affects the expression of MXD1 mRNA CTD PMID:29024780 Mxd1 Rat troglitazone multiple interactions ISO MXD1 (Homo sapiens) 6480464 [troglitazone co-treated with tert-Butylhydroperoxide] results in increased expression of MXD1 mRNA and troglitazone inhibits the reaction [tert-Butylhydroperoxide results in increased expression of MXD1 mRNA] CTD PMID:20847119 Mxd1 Rat tungsten decreases expression ISO Mxd1 (Mus musculus) 6480464 Tungsten results in decreased expression of MXD1 mRNA CTD PMID:30912803 Mxd1 Rat urethane increases expression ISO MXD1 (Homo sapiens) 6480464 Urethane results in increased expression of MXD1 mRNA CTD PMID:28818685 Mxd1 Rat valproic acid increases expression ISO MXD1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of MXD1 mRNA CTD PMID:23179753 and PMID:29154799 Mxd1 Rat vincristine increases expression ISO MXD1 (Homo sapiens) 6480464 Vincristine results in increased expression of MXD1 mRNA CTD PMID:23649840 Mxd1 Rat vorinostat decreases expression ISO MXD1 (Homo sapiens) 6480464 vorinostat results in decreased expression of MXD1 mRNA CTD PMID:27188386 Mxd1 Rat zinc atom multiple interactions ISO MXD1 (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of MXD1 mRNA CTD PMID:18593933 Mxd1 Rat zinc(0) multiple interactions ISO MXD1 (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of MXD1 mRNA CTD PMID:18593933
(-)-alpha-phellandrene (ISO) (-)-demecolcine (ISO) (1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 1-fluoro-2,4-dinitrobenzene (ISO) 15-acetyldeoxynivalenol (ISO) 17beta-estradiol (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2-palmitoylglycerol (ISO) 3,4-methylenedioxymethamphetamine (ISO) 4-hydroxynon-2-enal (ISO) acrolein (ISO) acrylamide (ISO) aflatoxin B1 (ISO) aldehydo-D-glucose (ISO) all-trans-retinoic acid (ISO) alpha-phellandrene (ISO) alpha-pinene (ISO) amiodarone (ISO) amphetamine (EXP) antirheumatic drug (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) arsenous acid (ISO) atrazine (EXP) azathioprine (ISO) benzene (ISO) benzo[a]pyrene (ISO) benzoates (ISO) bisphenol A (EXP,ISO) C60 fullerene (EXP) cadmium atom (ISO) cadmium dichloride (EXP,ISO) cadmium sulfate (ISO) calcitriol (ISO) carbamazepine (ISO) carbon nanotube (ISO) chlorpyrifos (ISO) chromium(6+) (ISO) cobalt dichloride (ISO) cocaine (ISO) copper atom (EXP,ISO) copper(0) (EXP,ISO) copper(II) chloride (ISO) copper(II) sulfate (ISO) crocidolite asbestos (ISO) crotonaldehyde (ISO) curcumin (ISO) cycloheximide (ISO) cyclosporin A (ISO) D-glucose (ISO) DDE (ISO) diarsenic trioxide (ISO) diazinon (ISO) Dibutyl phosphate (ISO) dichloromethane (ISO) diclofenac (ISO) diethylstilbestrol (ISO) dioxygen (EXP) diuron (EXP) dorsomorphin (ISO) endosulfan (EXP) entinostat (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) ethylbenzene (ISO) eugenol (ISO) folic acid (ISO) formaldehyde (ISO) furan (EXP) genistein (ISO) gentamycin (EXP) geraniol (ISO) glucose (ISO) ibuprofen (ISO) iron dichloride (ISO) ivermectin (ISO) leflunomide (ISO) Licochalcone B (ISO) lipopolysaccharide (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) menadione (ISO) methotrexate (ISO) methyl methanesulfonate (ISO) methylmercury chloride (ISO) methylseleninic acid (ISO) o-xylene (ISO) ozone (ISO) p-chloromercuribenzoic acid (ISO) paracetamol (EXP,ISO) perfluorononanoic acid (ISO) perfluorooctane-1-sulfonic acid (ISO) phenobarbital (ISO) phenylmercury acetate (ISO) pioglitazone (ISO) pirinixic acid (ISO) quercetin (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 431542 (ISO) Selamectin (ISO) serpentine asbestos (ISO) silicon dioxide (ISO) silver atom (ISO) silver(0) (ISO) sodium arsenite (ISO) sodium dodecyl sulfate (ISO) sodium fluoride (ISO) Soman (EXP) sulforaphane (ISO) tert-butyl hydroperoxide (ISO) thimerosal (ISO) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) toluene (ISO) tributylstannane (ISO) trichloroethene (EXP,ISO) triphenyl phosphate (ISO) triptonide (ISO) tris(2-butoxyethyl) phosphate (ISO) troglitazone (ISO) tungsten (ISO) urethane (ISO) valproic acid (ISO) vincristine (ISO) vorinostat (ISO) zinc atom (ISO) zinc(0) (ISO)
Mxd1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 120,654,731 - 120,678,972 (-) NCBI GRCr8 mRatBN7.2 4 119,097,353 - 119,118,080 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 119,097,353 - 119,117,751 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 124,569,846 - 124,590,267 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 120,344,579 - 120,365,000 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 118,968,838 - 118,989,263 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 118,451,752 - 118,472,150 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 118,449,882 - 118,472,179 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 183,021,767 - 183,042,167 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 120,801,932 - 120,822,346 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 108,067,388 - 108,087,863 (-) NCBI Celera Cytogenetic Map 4 q34 NCBI
MXD1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 69,915,109 - 69,942,945 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 69,897,688 - 69,942,945 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 70,142,241 - 70,170,077 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 69,995,707 - 70,023,581 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 70,053,967 - 70,077,256 NCBI Celera 2 69,993,381 - 70,021,239 (+) NCBI Celera Cytogenetic Map 2 p13.3 NCBI HuRef 2 69,878,174 - 69,906,081 (+) NCBI HuRef CHM1_1 2 70,071,823 - 70,099,727 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 69,926,849 - 69,954,666 (+) NCBI T2T-CHM13v2.0
Mxd1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 86,624,026 - 86,646,099 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 86,624,024 - 86,646,143 (-) Ensembl GRCm39 Ensembl GRCm38 6 86,647,044 - 86,669,234 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 86,647,042 - 86,669,161 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 86,597,038 - 86,619,153 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 86,616,160 - 86,634,688 (-) NCBI MGSCv36 mm8 Celera 6 88,584,673 - 88,606,787 (-) NCBI Celera Cytogenetic Map 6 D1 NCBI cM Map 6 37.75 NCBI
Mxd1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955424 15,209,609 - 15,235,667 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955424 15,209,609 - 15,235,396 (-) NCBI ChiLan1.0 ChiLan1.0
MXD1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 56,451,227 - 56,505,376 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 56,474,284 - 56,500,079 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 69,957,798 - 70,002,615 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 71,074,998 - 71,102,845 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 71,074,998 - 71,102,838 (+) Ensembl panpan1.1 panPan2
MXD1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 68,550,232 - 68,572,950 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 68,549,533 - 68,571,538 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 68,440,021 - 68,462,599 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 69,571,772 - 69,592,697 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 69,571,524 - 69,593,914 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 69,291,187 - 69,312,094 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 69,553,292 - 69,575,921 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 69,851,763 - 69,872,682 (+) NCBI UU_Cfam_GSD_1.0
Mxd1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024406292 14,417,985 - 14,443,722 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936491 14,127,547 - 14,153,322 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936491 14,127,581 - 14,152,118 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MXD1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 72,517,837 - 72,545,247 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 72,517,829 - 72,545,302 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 75,914,561 - 75,939,811 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
MXD1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 14 37,181,424 - 37,209,262 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 14 37,181,329 - 37,209,222 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666045 74,789,032 - 74,817,057 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Mxd1
.
Predicted Target Of
Count of predictions: 253 Count of miRNA genes: 169 Interacting mature miRNAs: 204 Transcripts: ENSRNOT00000023856 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1582232 Gluco25 Glucose level QTL 25 3.6 0.0023 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 85253748 148090731 Rat 631689 Scl4 Serum cholesterol level QTL 4 1.9 0.008 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 95174120 140174120 Rat 2302049 Pia32 Pristane induced arthritis QTL 32 5.1 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112) 4 105789505 150789505 Rat 1358352 Srcrt3 Stress Responsive Cort QTL 3 2.29 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 38465774 146803430 Rat 1578655 Bmd11 Bone mineral density QTL 11 11 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 4 90850165 135850165 Rat 1300116 Hrtrt5 Heart rate QTL 5 3.76 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 116179486 151161268 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 6478763 Anxrr46 Anxiety related response QTL 46 0.07428 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 6478760 Anxrr45 Anxiety related response QTL 45 0.06717 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 61330 Eau1 Experimental allergic uveoretinitis QTL 1 0.0003 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 4 70362013 132642728 Rat 2312567 Glom19 Glomerulus QTL 19 1.9 0.006 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 4 45456990 146803430 Rat 738015 Pia9 Pristane induced arthritis QTL 9 4.5 0.048 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 80694870 125694870 Rat 7207480 Bss105 Bone structure and strength QTL 105 8.1 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 4 109827074 154827074 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 731165 Uae21 Urinary albumin excretion QTL 21 2.4 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 4 106649412 151649412 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 631646 Stl4 Serum triglyceride level QTL 4 6.5 0.0001 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 4 73169846 132642728 Rat 634334 Xhs3 X-ray hypersensitivity QTL 3 10 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 84728680 129854654 Rat 61406 Scwia1 Streptococcal cell wall induced arthritis QTL 1 2.3 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 4 106805662 151805662 Rat 1549832 Bss3 Bone structure and strength QTL 3 11 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 4 109827074 154827074 Rat 1354612 Foco1 Food consumption QTL 1 8.87 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 4 44463908 148090542 Rat 70177 Xhs1 X-ray hypersensitivity QTL 1 25.1 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 82798864 152731274 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 61476 Aia3 Adjuvant induced arthritis QTL 3 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 86730991 131730991 Rat 1641919 Alc22 Alcohol consumption QTL 22 0.0005 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 81192555 126192555 Rat 631662 Hcar2 Hepatocarcinoma resistance QTL 2 3.1 0.0003 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 78878504 123878504 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 61418 Pia5 Pristane induced arthritis QTL 5 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 62277855 128289560 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 1354660 Salc1 Saline consumption QTL 1 11.26 drinking behavior trait (VT:0001422) saline drink intake rate (CMO:0001627) 4 44463908 148090542 Rat 1641833 Alc21 Alcohol consumption QTL 21 8.6 0.0001 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 56698790 126192555 Rat 2306899 Bp338 Blood pressure QTL 338 0.071 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 81006124 120102625 Rat 1298082 Stresp4 Stress response QTL 4 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 50119848 146803430 Rat 631674 Iddm14 Insulin dependent diabetes mellitus QTL 14 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 64528739 157573521 Rat 12798519 Anxrr54 Anxiety related response QTL 54 2.54 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 114627026 159627026 Rat 1578670 Bss14 Bone structure and strength QTL 14 16.4 femur morphology trait (VT:0000559) bone trabecular cross-sectional area (CMO:0002311) 4 87327165 132327165 Rat 12798523 Anxrr56 Anxiety related response QTL 56 2.83 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 85253748 150276390 Rat 70200 Alc18 Alcohol consumption QTL 18 9.2 drinking behavior trait (VT:0001422) ethanol intake volume to total fluid intake volume ratio (CMO:0001591) 4 56647873 149491524 Rat 61434 Cia3 Collagen induced arthritis QTL 3 4.8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 103194656 148194656 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 724535 Cm18 Cardiac mass QTL 18 2.6 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 4 118856416 163856416 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 1578662 Bss15 Bone structure and strength QTL 15 19.6 femur width (VT:1000666) femoral neck width (CMO:0001695) 4 87327165 132327165 Rat
RH141918
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 119,097,380 - 119,097,589 (+) MAPPER mRatBN7.2 Rnor_6.0 4 118,451,780 - 118,451,988 NCBI Rnor6.0 Rnor_5.0 4 183,021,795 - 183,022,003 UniSTS Rnor5.0 RGSC_v3.4 4 120,801,960 - 120,802,168 UniSTS RGSC3.4 Celera 4 108,067,416 - 108,067,624 UniSTS RH 3.4 Map 4 695.8 UniSTS Cytogenetic Map 4 q34 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000023856 ⟹ ENSRNOP00000023856
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 119,097,353 - 119,117,751 (-) Ensembl Rnor_6.0 Ensembl 4 118,449,882 - 118,472,179 (-) Ensembl
RefSeq Acc Id:
NM_001100749 ⟹ NP_001094219
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 120,654,731 - 120,675,129 (-) NCBI mRatBN7.2 4 119,097,353 - 119,117,751 (-) NCBI Rnor_6.0 4 118,451,752 - 118,472,150 (-) NCBI Rnor_5.0 4 183,021,767 - 183,042,167 (-) NCBI RGSC_v3.4 4 120,801,932 - 120,822,346 (-) RGD Celera 4 108,067,388 - 108,087,863 (-) RGD
Sequence:
CTCGGCGGTGGCGGCTGGGCTCCGGGCTCCGTGCTGTCCCATCGCTGCCCCTTCTGGCTGGCCAGCGCGGCAGCTCCTCGGTGTTCCCGGCCGGCCGCCCGCGGGCACGGAGAGGCAGCCCGCCGGGT
hide sequence
RefSeq Acc Id:
XM_063286285 ⟹ XP_063142355
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 120,657,115 - 120,678,972 (-) NCBI
RefSeq Acc Id:
NP_001094219 ⟸ NM_001100749
- UniProtKB:
F1LRY0 (UniProtKB/TrEMBL), Q6TV20 (UniProtKB/TrEMBL)
- Sequence:
MATAVGMNIQLLLEAADYLERREREAEHGYASMLPYSSKDRDAFKRRNKPKKNSTSSRSTHNEMEKNRRAHLRLCLEKLKGLVPLGPESSRHTTLSLLTKAKLHIKKLEDCDRKAVHQIDQLQREQRH
hide sequence
Ensembl Acc Id:
ENSRNOP00000023856 ⟸ ENSRNOT00000023856
RefSeq Acc Id:
XP_063142355 ⟸ XM_063286285
- Peptide Label:
isoform X1
RGD ID: 13693211 Promoter ID: EPDNEW_R3736 Type: initiation region Name: Mxd1_1 Description: max dimerization protein 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 118,472,165 - 118,472,225 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2006-03-30
Mxd1
max dimerization protein 1
LOC362391
Symbol updated
1299863 APPROVED
2006-02-09
LOC362391
max dimerization protein 1
Symbol and Name status set to provisional
70820 PROVISIONAL
