Symbol:
Camk1
Name:
calcium/calmodulin-dependent protein kinase I
RGD ID:
629473
Description:
Enables calcium/calmodulin-dependent protein kinase activity. Involved in regulation of synapse organization. Is active in glutamatergic synapse and postsynaptic density. Orthologous to human CAMK1 (calcium/calmodulin dependent protein kinase I); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3,3',4,4',5-pentachlorobiphenyl; 4,4'-sulfonyldiphenol.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
calcium/calmodulin-dependent protein kinase type 1; caM kinase I alpha; caM-KI; Camki; caMKI-alpha; G alpha interacting protein; Gaip; regulator of G-protein signalling 19
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 148,036,843 - 148,047,675 (-) NCBI GRCr8 mRatBN7.2 4 146,481,196 - 146,492,039 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 146,481,196 - 146,492,081 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 151,865,404 - 151,875,694 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 147,646,247 - 147,656,537 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 146,267,793 - 146,278,095 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 145,289,300 - 145,300,146 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 145,288,996 - 145,300,177 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 208,586,449 - 208,597,283 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 149,220,661 - 149,229,168 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 149,465,501 - 149,474,009 (-) NCBI Celera 4 135,038,512 - 135,048,763 (-) NCBI Celera Cytogenetic Map 4 q42 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Camk1 Rat 1,1-dichloroethene increases expression ISO Camk1 (Mus musculus) 6480464 vinylidene chloride results in increased expression of CAMK1 mRNA CTD PMID:26682919 Camk1 Rat 1,2-dimethylhydrazine increases expression ISO Camk1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of CAMK1 mRNA CTD PMID:22206623 Camk1 Rat 17alpha-ethynylestradiol multiple interactions ISO Camk1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of CAMK1 mRNA CTD PMID:17942748 Camk1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Camk1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of CAMK1 mRNA CTD PMID:17942748 Camk1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of CAMK1 mRNA CTD PMID:33387578 Camk1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of CAMK1 mRNA CTD PMID:34747641 Camk1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Camk1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of CAMK1 mRNA CTD PMID:21570461 Camk1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of CAMK1 mRNA CTD PMID:21215274 Camk1 Rat 3,3',4,4',5-pentachlorobiphenyl decreases expression EXP 6480464 3 more ... CTD PMID:32119087 Camk1 Rat 3,4-methylenedioxymethamphetamine increases expression ISO Camk1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in increased expression of CAMK1 mRNA CTD PMID:26251327 Camk1 Rat 4,4'-sulfonyldiphenol increases expression ISO Camk1 (Mus musculus) 6480464 bisphenol S results in increased expression of CAMK1 mRNA CTD PMID:39298647 Camk1 Rat 4,4'-sulfonyldiphenol increases expression ISO CAMK1 (Homo sapiens) 6480464 bisphenol S results in increased expression of CAMK1 protein CTD PMID:34186270 Camk1 Rat 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of CAMK1 mRNA CTD PMID:36041667 Camk1 Rat 4-hydroxyphenyl retinamide decreases expression ISO Camk1 (Mus musculus) 6480464 Fenretinide results in decreased expression of CAMK1 mRNA CTD PMID:28973697 Camk1 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of CAMK1 mRNA CTD PMID:24780913 Camk1 Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of CAMK1 mRNA CTD PMID:31881176 Camk1 Rat aconitine increases expression EXP 6480464 Aconitine results in increased expression of CAMK1 protein CTD PMID:33236894 Camk1 Rat acrylamide decreases expression ISO CAMK1 (Homo sapiens) 6480464 Acrylamide results in decreased expression of CAMK1 mRNA CTD PMID:32763439 Camk1 Rat afimoxifene decreases response to substance ISO CAMK1 (Homo sapiens) 6480464 CAMK1 results in decreased susceptibility to afimoxifene CTD PMID:21233418 Camk1 Rat all-trans-retinoic acid increases expression ISO CAMK1 (Homo sapiens) 6480464 Tretinoin results in increased expression of CAMK1 mRNA CTD PMID:15498508 and PMID:15894607 Camk1 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of CAMK1 mRNA CTD PMID:16483693 Camk1 Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of CAMK1 mRNA CTD PMID:30779732 Camk1 Rat aristolochic acid A increases expression ISO CAMK1 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of CAMK1 mRNA CTD PMID:33212167 Camk1 Rat arsane multiple interactions ISO CAMK1 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of CAMK1 mRNA CTD PMID:39836092 Camk1 Rat arsenic atom multiple interactions ISO CAMK1 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of CAMK1 mRNA CTD PMID:39836092 Camk1 Rat atrazine decreases expression ISO CAMK1 (Homo sapiens) 6480464 Atrazine results in decreased expression of CAMK1 mRNA CTD PMID:22378314 Camk1 Rat benzo[a]pyrene decreases expression ISO Camk1 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of CAMK1 mRNA CTD PMID:19770486 Camk1 Rat benzo[a]pyrene increases methylation ISO CAMK1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of CAMK1 promoter CTD PMID:27901495 Camk1 Rat beta-lapachone decreases expression ISO CAMK1 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of CAMK1 mRNA CTD PMID:38218311 Camk1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of CAMK1 mRNA CTD PMID:25181051 Camk1 Rat bisphenol A decreases expression ISO Camk1 (Mus musculus) 6480464 bisphenol A results in decreased expression of CAMK1 mRNA CTD PMID:35598803 Camk1 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of CAMK1 mRNA CTD PMID:36041667 Camk1 Rat bisphenol A increases expression ISO CAMK1 (Homo sapiens) 6480464 bisphenol A results in increased expression of CAMK1 protein CTD PMID:34186270 Camk1 Rat bisphenol AF increases expression ISO CAMK1 (Homo sapiens) 6480464 bisphenol AF results in increased expression of CAMK1 protein CTD PMID:34186270 Camk1 Rat bisphenol F multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of CAMK1 mRNA CTD PMID:36041667 Camk1 Rat CGP 52608 multiple interactions ISO CAMK1 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to CAMK1 gene] CTD PMID:28238834 Camk1 Rat choline increases expression EXP 6480464 Choline results in increased expression of CAMK1 mRNA and Choline results in increased expression of CAMK1 protein CTD PMID:17264169 Camk1 Rat cisplatin increases expression ISO CAMK1 (Homo sapiens) 6480464 Cisplatin results in increased expression of CAMK1 mRNA CTD PMID:27392435 Camk1 Rat cisplatin multiple interactions ISO CAMK1 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of CAMK1 mRNA CTD PMID:27392435 Camk1 Rat cobalt dichloride decreases expression ISO CAMK1 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of CAMK1 mRNA CTD PMID:19320972 Camk1 Rat copper(II) sulfate decreases expression ISO CAMK1 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of CAMK1 mRNA CTD PMID:19549813 Camk1 Rat cyclosporin A increases expression ISO Camk1 (Mus musculus) 6480464 Cyclosporine results in increased expression of CAMK1 mRNA CTD PMID:19770486 Camk1 Rat diuron decreases expression ISO CAMK1 (Homo sapiens) 6480464 Diuron results in decreased expression of CAMK1 mRNA CTD PMID:35967413 Camk1 Rat enzyme inhibitor multiple interactions ISO CAMK1 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of CAMK1 protein CTD PMID:23301498 Camk1 Rat fenthion increases expression ISO Camk1 (Mus musculus) 6480464 Fenthion results in increased expression of CAMK1 mRNA CTD PMID:34813904 Camk1 Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of CAMK1 mRNA CTD PMID:24136188 Camk1 Rat hyaluronic acid multiple interactions EXP 6480464 Hyaluronic Acid analog inhibits the reaction [Hydrogen Peroxide results in decreased expression of CAMK1 protein] CTD PMID:23178681 Camk1 Rat hyaluronic acid decreases expression EXP 6480464 Hyaluronic Acid analog results in decreased expression of CAMK1 protein CTD PMID:23178681 Camk1 Rat hydrogen peroxide multiple interactions EXP 6480464 Hyaluronic Acid analog inhibits the reaction [Hydrogen Peroxide results in decreased expression of CAMK1 protein] CTD PMID:23178681 Camk1 Rat hydrogen peroxide decreases expression EXP 6480464 Hydrogen Peroxide results in decreased expression of CAMK1 protein CTD PMID:23178681 Camk1 Rat ivermectin decreases expression ISO CAMK1 (Homo sapiens) 6480464 Ivermectin results in decreased expression of CAMK1 protein CTD PMID:32959892 Camk1 Rat KN-93 decreases activity ISO CAMK1 (Homo sapiens) 6480464 KN 93 results in decreased activity of CAMK1 protein CTD PMID:12193581 Camk1 Rat lipopolysaccharide multiple interactions ISO CAMK1 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine co-treated with Lipopolysaccharides] results in decreased expression of CAMK1 mRNA CTD PMID:35811015 Camk1 Rat methidathion increases expression ISO Camk1 (Mus musculus) 6480464 methidathion results in increased expression of CAMK1 mRNA CTD PMID:34813904 Camk1 Rat miconazole decreases expression ISO Camk1 (Mus musculus) 6480464 Miconazole results in decreased expression of CAMK1 mRNA CTD PMID:27462272 Camk1 Rat microcystin-LR increases expression ISO Camk1 (Mus musculus) 6480464 cyanoginosin LR results in increased expression of CAMK1 mRNA CTD PMID:17654400 Camk1 Rat nickel sulfate increases expression ISO CAMK1 (Homo sapiens) 6480464 nickel sulfate results in increased expression of CAMK1 mRNA CTD PMID:16780908 Camk1 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of CAMK1 mRNA CTD PMID:25729387 Camk1 Rat oxaliplatin increases expression EXP 6480464 oxaliplatin results in increased expression of CAMK1 mRNA CTD PMID:25729387 Camk1 Rat ozone multiple interactions ISO CAMK1 (Homo sapiens) 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of CAMK1 mRNA CTD PMID:35430440 Camk1 Rat phorbol 13-acetate 12-myristate multiple interactions ISO CAMK1 (Homo sapiens) 6480464 1 more ... CTD PMID:20590612 Camk1 Rat phorbol 13-acetate 12-myristate increases phosphorylation ISO CAMK1 (Homo sapiens) 6480464 Tetradecanoylphorbol Acetate results in increased phosphorylation of CAMK1 protein CTD PMID:20590612 Camk1 Rat pirinixic acid multiple interactions ISO Camk1 (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of CAMK1 mRNA CTD PMID:19710929 Camk1 Rat pirinixic acid decreases expression ISO Camk1 (Mus musculus) 6480464 pirinixic acid results in decreased expression of CAMK1 mRNA CTD PMID:18445702 Camk1 Rat propiconazole decreases expression ISO Camk1 (Mus musculus) 6480464 propiconazole results in decreased expression of CAMK1 mRNA CTD PMID:21278054 Camk1 Rat quercetin decreases expression ISO CAMK1 (Homo sapiens) 6480464 Quercetin results in decreased expression of CAMK1 mRNA CTD PMID:15309432 Camk1 Rat rotenone decreases expression EXP 6480464 Rotenone results in decreased expression of CAMK1 protein CTD PMID:35544339 Camk1 Rat Rutecarpine increases phosphorylation ISO Camk1 (Mus musculus) 6480464 rutecarpine results in increased phosphorylation of CAMK1 protein CTD PMID:19853001 Camk1 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO CAMK1 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine co-treated with Lipopolysaccharides] results in decreased expression of CAMK1 mRNA CTD PMID:35811015 Camk1 Rat sodium arsenite multiple interactions ISO CAMK1 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of CAMK1 mRNA CTD PMID:39836092 Camk1 Rat sodium dichromate decreases expression ISO CAMK1 (Homo sapiens) 6480464 sodium bichromate results in decreased expression of CAMK1 mRNA CTD PMID:17685462 Camk1 Rat sodium fluoride decreases expression ISO Camk1 (Mus musculus) 6480464 Sodium Fluoride results in decreased expression of CAMK1 protein CTD PMID:28918527 Camk1 Rat sunitinib decreases expression ISO CAMK1 (Homo sapiens) 6480464 Sunitinib results in decreased expression of CAMK1 mRNA CTD PMID:31533062 Camk1 Rat tamibarotene increases expression ISO CAMK1 (Homo sapiens) 6480464 tamibarotene results in increased expression of CAMK1 mRNA CTD PMID:15498508 Camk1 Rat tetrachloromethane decreases expression ISO Camk1 (Mus musculus) 6480464 Carbon Tetrachloride results in decreased expression of CAMK1 mRNA CTD PMID:17484886 Camk1 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of CAMK1 mRNA CTD PMID:31150632 Camk1 Rat tetrachloromethane increases expression ISO Camk1 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of CAMK1 mRNA CTD PMID:27339419 and PMID:31919559 Camk1 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of CAMK1 protein CTD PMID:16845489 Camk1 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of CAMK1 mRNA CTD PMID:34492290 Camk1 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of CAMK1 mRNA CTD PMID:25729387 Camk1 Rat topotecan affects response to substance ISO CAMK1 (Homo sapiens) 6480464 CAMK1 protein affects the susceptibility to Topotecan CTD PMID:16217747 Camk1 Rat triphenyl phosphate affects expression ISO CAMK1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of CAMK1 mRNA CTD PMID:37042841 Camk1 Rat valproic acid affects expression ISO Camk1 (Mus musculus) 6480464 Valproic Acid affects the expression of CAMK1 mRNA CTD PMID:17292431
1,1-dichloroethene (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3,3',4,4',5-pentachlorobiphenyl (EXP) 3,4-methylenedioxymethamphetamine (ISO) 4,4'-sulfonyldiphenol (EXP,ISO) 4-hydroxyphenyl retinamide (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) aconitine (EXP) acrylamide (ISO) afimoxifene (ISO) all-trans-retinoic acid (ISO) ammonium chloride (EXP) amphetamine (EXP) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) atrazine (ISO) benzo[a]pyrene (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) bisphenol F (EXP) CGP 52608 (ISO) choline (EXP) cisplatin (ISO) cobalt dichloride (ISO) copper(II) sulfate (ISO) cyclosporin A (ISO) diuron (ISO) enzyme inhibitor (ISO) fenthion (ISO) flutamide (EXP) hyaluronic acid (EXP) hydrogen peroxide (EXP) ivermectin (ISO) KN-93 (ISO) lipopolysaccharide (ISO) methidathion (ISO) miconazole (ISO) microcystin-LR (ISO) nickel sulfate (ISO) oxaliplatin (EXP) ozone (ISO) phorbol 13-acetate 12-myristate (ISO) pirinixic acid (ISO) propiconazole (ISO) quercetin (ISO) rotenone (EXP) Rutecarpine (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) sodium arsenite (ISO) sodium dichromate (ISO) sodium fluoride (ISO) sunitinib (ISO) tamibarotene (ISO) tetrachloromethane (EXP,ISO) thioacetamide (EXP) topotecan (EXP,ISO) triphenyl phosphate (ISO) valproic acid (ISO)
Biological Process
cell differentiation (IEA) intracellular signal transduction (IEA,ISO) nervous system development (IEA) nucleocytoplasmic transport (IEA,ISO) positive regulation of dendritic spine development (IEA,ISO,ISS) positive regulation of muscle cell differentiation (IEA,ISO) positive regulation of neuron projection development (IEA,ISO,ISS) positive regulation of protein export from nucleus (IEA,ISO) positive regulation of protein serine/threonine kinase activity (ISO,ISS) positive regulation of synapse structural plasticity (IEA,ISO,ISS) positive regulation of syncytium formation by plasma membrane fusion (IEA,ISO) positive regulation of transcription by RNA polymerase II (IEA,ISO) protein phosphorylation (ISO,ISS) regulation of muscle cell differentiation (IEA,ISO,ISS) regulation of protein localization (IBA,IEA,ISO,ISS) regulation of synapse organization (IBA,IDA,IEP,IMP) signal transduction (IBA,IEA,ISO)
1.
Characterization of a rat cDNA clone encoding calcium/calmodulin-dependent protein kinase I.
Cho FS, etal., Biochim Biophys Acta 1994 Oct 20;1224(1):156-60.
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
4.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
5.
Calcium/calmodulin-dependent protein kinase I. cDNA cloning and identification of autophosphorylation site.
Picciotto MR, etal., J Biol Chem 1993 Dec 15;268(35):26512-21.
6.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
7.
Activity-dependent synaptogenesis: regulation by a CaM-kinase kinase/CaM-kinase I/betaPIX signaling complex.
Saneyoshi T, etal., Neuron. 2008 Jan 10;57(1):94-107. doi: 10.1016/j.neuron.2007.11.016.
8.
SIK1 is part of a cell sodium-sensing network that regulates active sodium transport through a calcium-dependent process.
Sjostrom M, etal., Proc Natl Acad Sci U S A. 2007 Oct 23;104(43):16922-7. Epub 2007 Oct 15.
9.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
10.
Activation of Ca2+/calmodulin-dependent protein kinase I in cultured rat hippocampal neurons.
Uezu A, etal., J Neurochem 2002 Aug;82(3):585-93.
Camk1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 148,036,843 - 148,047,675 (-) NCBI GRCr8 mRatBN7.2 4 146,481,196 - 146,492,039 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 146,481,196 - 146,492,081 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 151,865,404 - 151,875,694 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 147,646,247 - 147,656,537 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 146,267,793 - 146,278,095 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 145,289,300 - 145,300,146 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 145,288,996 - 145,300,177 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 208,586,449 - 208,597,283 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 149,220,661 - 149,229,168 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 149,465,501 - 149,474,009 (-) NCBI Celera 4 135,038,512 - 135,048,763 (-) NCBI Celera Cytogenetic Map 4 q42 NCBI
CAMK1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 3 9,757,347 - 9,769,947 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 3 9,757,347 - 9,769,992 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 3 9,799,031 - 9,811,631 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 3 9,774,031 - 9,786,661 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 3 9,774,031 - 9,786,661 NCBI Celera 3 9,733,733 - 9,746,362 (-) NCBI Celera Cytogenetic Map 3 p25.3 NCBI HuRef 3 9,735,376 - 9,748,016 (-) NCBI HuRef CHM1_1 3 9,749,224 - 9,761,863 (-) NCBI CHM1_1 T2T-CHM13v2.0 3 9,749,303 - 9,761,902 (-) NCBI T2T-CHM13v2.0
Camk1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 113,311,085 - 113,320,883 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 113,311,085 - 113,320,945 (-) Ensembl GRCm39 Ensembl GRCm38 6 113,334,124 - 113,343,922 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 113,334,124 - 113,343,984 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 113,284,118 - 113,293,916 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 113,299,901 - 113,309,699 (-) NCBI MGSCv36 mm8 Celera 6 115,161,124 - 115,170,917 (-) NCBI Celera Cytogenetic Map 6 E3 NCBI cM Map 6 52.75 NCBI
Camk1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955561 1,282,970 - 1,294,972 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955561 1,282,970 - 1,292,710 (-) NCBI ChiLan1.0 ChiLan1.0
CAMK1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 2 9,768,303 - 9,780,976 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 3 9,773,061 - 9,785,734 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 3 9,708,782 - 9,721,433 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 3 9,947,275 - 9,959,560 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 3 9,945,609 - 9,959,560 (-) Ensembl panpan1.1 panPan2
CAMK1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 20 8,475,902 - 8,486,214 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 20 8,475,716 - 8,486,214 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 20 8,508,977 - 8,519,292 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 20 8,505,194 - 8,515,504 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 20 8,505,011 - 8,517,090 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 20 8,227,664 - 8,237,979 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 20 8,572,188 - 8,582,503 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 20 8,545,805 - 8,556,117 (+) NCBI UU_Cfam_GSD_1.0
Camk1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404942 15,496,367 - 15,507,235 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936602 3,401,005 - 3,414,935 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936602 3,402,559 - 3,413,323 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CAMK1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 13 66,044,720 - 66,055,295 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 13 66,044,713 - 66,055,290 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 13 73,092,176 - 73,102,714 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
CAMK1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 22 45,763,799 - 45,776,792 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 22 45,762,499 - 45,774,597 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666041 120,790,539 - 120,803,686 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Camk1
.
Predicted Target Of
Count of predictions: 36 Count of miRNA genes: 35 Interacting mature miRNAs: 36 Transcripts: ENSRNOT00000029728 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1582232 Gluco25 Glucose level QTL 25 3.6 0.0023 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 85253748 148090731 Rat 1358352 Srcrt3 Stress Responsive Cort QTL 3 2.29 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 38465774 146803430 Rat 1300116 Hrtrt5 Heart rate QTL 5 3.76 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 116179486 151161268 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 631683 Bp116 Blood pressure QTL 116 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 124303370 169303370 Rat 61451 Ciaa4 CIA Autoantibody QTL 4 3.1 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 4 126395976 167139601 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1549827 Scl46 Serum cholesterol level QTL 46 3.5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 132396220 177396220 Rat 731165 Uae21 Urinary albumin excretion QTL 21 2.4 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 4 106649412 151649412 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 7411558 Bw133 Body weight QTL 133 13.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 125590636 170590636 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1549832 Bss3 Bone structure and strength QTL 3 11 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 4 109827074 154827074 Rat 70177 Xhs1 X-ray hypersensitivity QTL 1 25.1 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 82798864 152731274 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 1354660 Salc1 Saline consumption QTL 1 11.26 drinking behavior trait (VT:0001422) saline drink intake rate (CMO:0001627) 4 44463908 148090542 Rat 1298082 Stresp4 Stress response QTL 4 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 50119848 146803430 Rat 737978 Pia23 Pristane induced arthritis QTL 23 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 61362 Oia2 Oil induced arthritis QTL 2 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 70201 Gcr1 Gastric cancer resistance QTL 1 2.7 stomach morphology trait (VT:0000470) stomach tumor susceptibility score (CMO:0002043) 4 120260281 147278687 Rat 70200 Alc18 Alcohol consumption QTL 18 9.2 drinking behavior trait (VT:0001422) ethanol intake volume to total fluid intake volume ratio (CMO:0001591) 4 56647873 149491524 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 724535 Cm18 Cardiac mass QTL 18 2.6 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 4 118856416 163856416 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 2302049 Pia32 Pristane induced arthritis QTL 32 5.1 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112) 4 105789505 150789505 Rat 724558 Plsm2 Polydactyly-luxate syndrome (PLS) morphotypes QTL 2 0.0003 hindlimb integrity trait (VT:0010563) hind foot phalanges count (CMO:0001949) 4 132422778 177422778 Rat 6478763 Anxrr46 Anxiety related response QTL 46 0.07428 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 6478760 Anxrr45 Anxiety related response QTL 45 0.06717 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 1331802 Srn5 Serum renin concentration QTL 5 3.045 renin activity (VT:0005581) plasma renin activity level (CMO:0000116) 4 119428175 157578333 Rat 1298524 Oia8 Oil induced arthritis QTL 8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 2312567 Glom19 Glomerulus QTL 19 1.9 0.006 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 4 45456990 146803430 Rat 7207480 Bss105 Bone structure and strength QTL 105 8.1 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 4 109827074 154827074 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 6478778 Anxrr51 Anxiety related response QTL 51 0.25384 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 124778595 169778595 Rat 61406 Scwia1 Streptococcal cell wall induced arthritis QTL 1 2.3 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 4 106805662 151805662 Rat 631511 Pia7 Pristane induced arthritis QTL 7 4.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 1354612 Foco1 Food consumption QTL 1 8.87 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 4 44463908 148090542 Rat 634347 Hcar8 Hepatocarcinoma resistance QTL 8 5.8 liver integrity trait (VT:0010547) liver tumorous lesion area to total liver area ratio (CMO:0001075) 4 123143783 168143783 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 61422 Cia13 Collagen induced arthritis QTL 13 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 132642577 167139601 Rat 631674 Iddm14 Insulin dependent diabetes mellitus QTL 14 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 64528739 157573521 Rat 2293840 Kiddil9 Kidney dilation QTL 9 2.9 kidney pelvis morphology trait (VT:0004194) hydronephrosis severity score (CMO:0001208) 4 120926564 148090731 Rat 12798519 Anxrr54 Anxiety related response QTL 54 2.54 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 114627026 159627026 Rat 12798523 Anxrr56 Anxiety related response QTL 56 2.83 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 85253748 150276390 Rat 61434 Cia3 Collagen induced arthritis QTL 3 4.8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 103194656 148194656 Rat 12798527 Anxrr58 Anxiety related response QTL 58 4.11 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 119463257 147278687 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat
RH128087
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 146,480,937 - 146,481,139 (+) MAPPER mRatBN7.2 Rnor_6.0 4 145,289,042 - 145,289,243 NCBI Rnor6.0 Rnor_5.0 4 208,586,192 - 208,586,392 UniSTS Rnor5.0 Celera 4 135,038,254 - 135,038,455 UniSTS RH 3.4 Map 4 937.4 UniSTS Cytogenetic Map 4 q42 UniSTS
AI505105
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 146,481,267 - 146,481,394 (+) MAPPER mRatBN7.2 Rnor_6.0 4 145,289,372 - 145,289,498 NCBI Rnor6.0 Rnor_5.0 4 208,586,521 - 208,586,647 UniSTS Rnor5.0 Celera 4 135,038,584 - 135,038,710 UniSTS Cytogenetic Map 4 q42 UniSTS
D6Ertd263e
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 146,481,234 - 146,481,453 (+) MAPPER mRatBN7.2 Rnor_6.0 4 145,289,339 - 145,289,557 NCBI Rnor6.0 Rnor_5.0 4 208,586,488 - 208,586,706 UniSTS Rnor5.0 Celera 4 135,038,551 - 135,038,769 UniSTS Cytogenetic Map 4 q42 UniSTS
RH136941
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 146,481,737 - 146,481,926 (+) MAPPER mRatBN7.2 Rnor_6.0 4 145,289,842 - 145,290,030 NCBI Rnor6.0 Rnor_5.0 4 208,586,991 - 208,587,179 UniSTS Rnor5.0 Celera 4 135,039,054 - 135,039,242 UniSTS RH 3.4 Map 4 937.5 UniSTS Cytogenetic Map 4 q42 UniSTS
RH137514
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 146,481,260 - 146,481,393 (+) MAPPER mRatBN7.2 Rnor_6.0 4 145,289,365 - 145,289,497 NCBI Rnor6.0 Rnor_5.0 4 208,586,514 - 208,586,646 UniSTS Rnor5.0 Celera 4 135,038,577 - 135,038,709 UniSTS Cytogenetic Map 4 q42 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000029728 ⟹ ENSRNOP00000033456
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 146,481,196 - 146,492,081 (-) Ensembl Rnor_6.0 Ensembl 4 145,288,996 - 145,300,177 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000093950 ⟹ ENSRNOP00000091265
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 146,481,199 - 146,491,517 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000106794 ⟹ ENSRNOP00000096413
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 146,481,196 - 146,488,887 (-) Ensembl
RefSeq Acc Id:
NM_134468 ⟹ NP_604463
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 148,036,843 - 148,047,145 (-) NCBI mRatBN7.2 4 146,481,196 - 146,491,498 (-) NCBI Rnor_6.0 4 145,289,300 - 145,299,602 (-) NCBI Rnor_5.0 4 208,586,449 - 208,597,283 (-) NCBI RGSC_v3.4 4 149,220,661 - 149,229,168 (-) RGD Celera 4 135,038,512 - 135,048,763 (-) RGD
Sequence:
CTTTAGAGCCAGGTACGGACGCGGCGGGAGCTCCGCACCAGCCACCTAGGCCCTCGCTGCCAGCCCCGTGGCGGGGCAGCCGCAGGAGCCCTGGCTGTGGCTGGGGGGCAGTGGGCCATGCCAGGGGC
hide sequence
RefSeq Acc Id:
XM_006237001 ⟹ XP_006237063
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 148,036,848 - 148,047,673 (-) NCBI mRatBN7.2 4 146,481,201 - 146,492,038 (-) NCBI Rnor_6.0 4 145,289,305 - 145,300,146 (-) NCBI Rnor_5.0 4 208,586,449 - 208,597,283 (-) NCBI
Sequence:
TTTCCTAGTCTTTTTGAGCAGCACCTGAAAGTGTGTGGGATAAAAGCCTTAGCTCTGTTTTGCT
hide sequence
RefSeq Acc Id:
XM_039106984 ⟹ XP_038962912
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 148,036,848 - 148,047,674 (-) NCBI mRatBN7.2 4 146,481,201 - 146,492,039 (-) NCBI
RefSeq Acc Id:
XM_039106985 ⟹ XP_038962913
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 148,036,848 - 148,047,669 (-) NCBI mRatBN7.2 4 146,481,201 - 146,492,034 (-) NCBI
RefSeq Acc Id:
XM_063285458 ⟹ XP_063141528
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 148,036,848 - 148,047,675 (-) NCBI
RefSeq Acc Id:
XM_063285459 ⟹ XP_063141529
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 148,036,848 - 148,047,669 (-) NCBI
RefSeq Acc Id:
NP_604463 ⟸ NM_134468
- UniProtKB:
Q63084 (UniProtKB/Swiss-Prot), Q63450 (UniProtKB/Swiss-Prot), A6IBQ6 (UniProtKB/TrEMBL), A0A8I6B458 (UniProtKB/TrEMBL)
- Sequence:
MPGAVEGPRWKQAEDIRDIYDFRDVLGTGAFSEVILAEDKRTQKLVAIKCIAKKALEGKEGSMENEIAVLHKIKHPNIVALDDIYESGGHLYLIMQLVSGGELFDRIVEKGFYTERDASRLIFQVLDA
hide sequence
RefSeq Acc Id:
XP_006237063 ⟸ XM_006237001
- Peptide Label:
isoform X4
- UniProtKB:
A0A8I6AEY2 (UniProtKB/TrEMBL), A0A8I6B458 (UniProtKB/TrEMBL)
- Sequence:
MPGAVEGPRWKQAEDIRDIYDFRDVLGTGAFSEVILAEDKRTQKLVAIKCIAKKALEGKEGSMENEIAVLHKIKHPNIVALDDIYESGGHLYLIMQLVSGGELFDRIVEKGFYTERDASRLIFQVLDA
hide sequence
Ensembl Acc Id:
ENSRNOP00000033456 ⟸ ENSRNOT00000029728
RefSeq Acc Id:
XP_038962912 ⟸ XM_039106984
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6B458 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038962913 ⟸ XM_039106985
- Peptide Label:
isoform X3
- UniProtKB:
A0A8L2UL04 (UniProtKB/TrEMBL), A0A8I6B458 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000091265 ⟸ ENSRNOT00000093950
Ensembl Acc Id:
ENSRNOP00000096413 ⟸ ENSRNOT00000106794
RefSeq Acc Id:
XP_063141528 ⟸ XM_063285458
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I6B458 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141529 ⟸ XM_063285459
- Peptide Label:
isoform X3
- UniProtKB:
A0A8L2UL04 (UniProtKB/TrEMBL), A0A8I6B458 (UniProtKB/TrEMBL)
RGD ID: 13693296 Promoter ID: EPDNEW_R3820 Type: initiation region Name: Camk1_1 Description: calcium/calmodulin-dependent protein kinase I SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 145,299,642 - 145,299,702 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2005-01-20
Camk1
calcium/calmodulin-dependent protein kinase I
regulator of G-protein signalling 19
Name updated
1299863 APPROVED
2003-04-06
Camk1
regulator of G-protein signalling 19
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_expression
expressed in hippocampal neurons
625618
