Symbol:
Fgf6
Name:
fibroblast growth factor 6
RGD ID:
620130
Description:
Predicted to enable fibroblast growth factor receptor binding activity and growth factor activity. Predicted to be involved in several processes, including fibroblast growth factor receptor signaling pathway; positive regulation of MAPK cascade; and positive regulation of cell population proliferation. Predicted to act upstream of or within cartilage condensation and myoblast differentiation. Located in sarcolemma. Orthologous to human FGF6 (fibroblast growth factor 6); PARTICIPATES IN fibroblast growth factor signaling pathway; syndecan signaling pathway; melanoma pathway; INTERACTS WITH ammonium chloride; bisphenol A; Cuprizon.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
Fgf7b; fibroblast growth factor 7b
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 161,541,089 - 161,549,624 (+) NCBI GRCr8 mRatBN7.2 4 159,854,913 - 159,863,447 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 159,854,913 - 159,863,447 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 166,084,732 - 166,093,267 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 161,867,644 - 161,876,179 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 160,501,682 - 160,510,219 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 159,563,798 - 159,572,333 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 159,563,798 - 159,572,333 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 232,040,999 - 232,049,534 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 163,403,896 - 163,412,431 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 163,648,831 - 163,657,367 (+) NCBI Celera 4 148,570,431 - 148,578,966 (+) NCBI Celera Cytogenetic Map 4 q42 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Fgf6 Rat (S)-amphetamine increases expression ISO Fgf6 (Mus musculus) 6480464 Dextroamphetamine results in increased expression of FGF6 mRNA CTD PMID:12205029 Fgf6 Rat (S)-amphetamine multiple interactions ISO Fgf6 (Mus musculus) 6480464 SOD1 inhibits the reaction [Dextroamphetamine results in increased expression of FGF6 mRNA] CTD PMID:12205029 Fgf6 Rat 17alpha-ethynylestradiol multiple interactions ISO Fgf6 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of FGF6 mRNA CTD PMID:17942748 Fgf6 Rat 17alpha-ethynylestradiol increases expression ISO Fgf6 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of FGF6 mRNA CTD PMID:17942748 Fgf6 Rat 17beta-estradiol increases expression ISO FGF6 (Homo sapiens) 6480464 Estradiol results in increased expression of FGF6 mRNA CTD PMID:21098263 Fgf6 Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Fgf6 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Fgf6 Rat 2,2',5,5'-tetrachlorobiphenyl multiple interactions ISO Fgf6 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Fgf6 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Fgf6 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of FGF6 mRNA CTD PMID:17942748 Fgf6 Rat adenosine multiple interactions ISO FGF6 (Homo sapiens) 6480464 Adenosine results in increased expression of and results in increased secretion of FGF6 protein CTD PMID:34070360 Fgf6 Rat aflatoxin B1 decreases methylation ISO FGF6 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of FGF6 gene CTD PMID:27153756 Fgf6 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of FGF6 mRNA CTD PMID:16483693 Fgf6 Rat arsane affects expression ISO FGF6 (Homo sapiens) 6480464 Arsenic affects the expression of FGF6 protein CTD PMID:24675094 Fgf6 Rat arsenic atom affects expression ISO FGF6 (Homo sapiens) 6480464 Arsenic affects the expression of FGF6 protein CTD PMID:24675094 Fgf6 Rat arsenous acid increases expression ISO Fgf6 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of FGF6 mRNA CTD PMID:35676786 Fgf6 Rat atrazine increases expression ISO FGF6 (Homo sapiens) 6480464 Atrazine results in increased expression of FGF6 mRNA CTD PMID:22378314 Fgf6 Rat benzo[a]pyrene increases methylation ISO FGF6 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of FGF6 promoter CTD PMID:27901495 Fgf6 Rat benzo[a]pyrene affects methylation ISO FGF6 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of FGF6 exon CTD PMID:27901495 Fgf6 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of FGF6 mRNA CTD PMID:25181051 Fgf6 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of FGF6 gene CTD PMID:28505145 Fgf6 Rat cadmium atom increases expression ISO FGF6 (Homo sapiens) 6480464 Cadmium results in increased expression of FGF6 mRNA CTD PMID:21694771 Fgf6 Rat cadmium dichloride multiple interactions ISO FGF6 (Homo sapiens) 6480464 Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased expression of and results in increased secretion of FGF6 protein] and Cadmium Chloride results in increased expression of and results in increased secretion of FGF6 protein CTD PMID:26138014 Fgf6 Rat CGP 52608 multiple interactions ISO FGF6 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to FGF6 gene] CTD PMID:28238834 Fgf6 Rat cordycepin multiple interactions ISO FGF6 (Homo sapiens) 6480464 cordycepin results in increased expression of and results in increased secretion of FGF6 protein CTD PMID:34070360 Fgf6 Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of MT1F mRNA CTD PMID:27523638 Fgf6 Rat cyclosporin A decreases methylation ISO FGF6 (Homo sapiens) 6480464 Cyclosporine results in decreased methylation of FGF6 promoter CTD PMID:27989131 Fgf6 Rat diarsenic trioxide increases expression ISO Fgf6 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of FGF6 mRNA CTD PMID:35676786 Fgf6 Rat folic acid decreases expression ISO Fgf6 (Mus musculus) 6480464 Folic Acid results in decreased expression of FGF6 mRNA CTD PMID:25629700 Fgf6 Rat gefitinib increases expression ISO FGF6 (Homo sapiens) 6480464 gefitinib results in increased expression of FGF6 mRNA CTD PMID:16685379 Fgf6 Rat malathion increases expression ISO FGF6 (Homo sapiens) 6480464 Malathion results in increased expression of FGF6 mRNA CTD PMID:32069766 Fgf6 Rat metformin affects expression EXP 6480464 Metformin affects the expression of MT1F mRNA CTD PMID:31324951 Fgf6 Rat N-acetyl-L-cysteine multiple interactions ISO FGF6 (Homo sapiens) 6480464 Acetylcysteine inhibits the reaction [Cadmium Chloride results in increased expression of and results in increased secretion of FGF6 protein] CTD PMID:26138014 Fgf6 Rat Nor-9-carboxy-delta9-THC multiple interactions ISO FGF6 (Homo sapiens) 6480464 [Cannabinoids results in increased abundance of 11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid] which affects the methylation of FGF6 gene CTD PMID:30521419 Fgf6 Rat paracetamol affects expression ISO Fgf6 (Mus musculus) 6480464 Acetaminophen affects the expression of FGF6 mRNA CTD PMID:17562736 Fgf6 Rat PCB138 multiple interactions ISO Fgf6 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Fgf6 Rat phenformin increases expression EXP 6480464 Phenformin results in increased expression of MT1F mRNA CTD PMID:31324951 Fgf6 Rat pirinixic acid multiple interactions ISO Fgf6 (Mus musculus) 6480464 NCF1 protein promotes the reaction [pirinixic acid results in decreased expression of FGF6 mRNA] CTD PMID:17950772 Fgf6 Rat pirinixic acid increases expression ISO Fgf6 (Mus musculus) 6480464 pirinixic acid results in increased expression of FGF6 mRNA CTD PMID:20813756 Fgf6 Rat pirinixic acid decreases expression ISO Fgf6 (Mus musculus) 6480464 pirinixic acid results in decreased expression of FGF6 mRNA CTD PMID:17950772 Fgf6 Rat resveratrol multiple interactions ISO FGF6 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in decreased expression of FGF6 mRNA CTD PMID:23557933 Fgf6 Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of MT1F mRNA CTD PMID:28374803 Fgf6 Rat thallium multiple interactions EXP 6480464 [thallium sulfate results in increased abundance of Thallium] which results in increased expression of MT1F mRNA CTD PMID:39361050 Fgf6 Rat thallium sulfate multiple interactions EXP 6480464 [thallium sulfate results in increased abundance of Thallium] which results in increased expression of MT1F mRNA CTD PMID:39361050 Fgf6 Rat titanium dioxide increases expression EXP 6480464 titanium dioxide results in increased expression of MT1F mRNA CTD PMID:30012374 Fgf6 Rat trichloroethene increases expression ISO Fgf6 (Mus musculus) 6480464 Trichloroethylene results in increased expression of FGF6 mRNA CTD PMID:15363585 Fgf6 Rat triphenyl phosphate increases expression EXP 6480464 triphenyl phosphate results in increased expression of MT1F mRNA CTD PMID:30589522 Fgf6 Rat triptonide increases expression ISO Fgf6 (Mus musculus) 6480464 triptonide results in increased expression of FGF6 mRNA CTD PMID:33045310
Imported Annotations - KEGG (archival)
Imported Annotations - PID (archival)
(S)-amphetamine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) adenosine (ISO) aflatoxin B1 (ISO) ammonium chloride (EXP) arsane (ISO) arsenic atom (ISO) arsenous acid (ISO) atrazine (ISO) benzo[a]pyrene (ISO) bisphenol A (EXP) cadmium atom (ISO) cadmium dichloride (ISO) CGP 52608 (ISO) cordycepin (ISO) Cuprizon (EXP) cyclosporin A (ISO) diarsenic trioxide (ISO) folic acid (ISO) gefitinib (ISO) malathion (ISO) metformin (EXP) N-acetyl-L-cysteine (ISO) Nor-9-carboxy-delta9-THC (ISO) paracetamol (ISO) PCB138 (ISO) phenformin (EXP) pirinixic acid (ISO) resveratrol (ISO) rotenone (EXP) thallium (EXP) thallium sulfate (EXP) titanium dioxide (EXP) trichloroethene (ISO) triphenyl phosphate (EXP) triptonide (ISO)
1.
Solvent use and psychiatric comorbidity.
Dinwiddie SH, etal., Br J Addict. 1990 Dec;85(12):1647-56.
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
4.
Gene expression patterns of the fibroblast growth factors and their receptors during myogenesis of rat satellite cells.
Kastner S, etal., J Histochem Cytochem 2000 Aug;48(8):1079-96.
5.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
6.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
7.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
8.
GOA pipeline
RGD automated data pipeline
9.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
10.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
11.
Comprehensive gene review and curation
RGD comprehensive gene curation
12.
Increased expression of fibroblast growth factor 6 in human prostatic intraepithelial neoplasia and prostate cancer.
Ropiquet F, etal., Cancer Res. 2000 Aug 1;60(15):4245-50.
13.
Differential adaptation of growth and differentiation factor 8/myostatin, fibroblast growth factor 6 and leukemia inhibitory factor in overloaded, regenerating and denervated rat muscles.
Sakuma K, etal., Biochim Biophys Acta. 2000 Jun 2;1497(1):77-88.
14.
Tissue remodeling in the acute otitis media mouse model.
Sautter NB, etal., Int J Pediatr Otorhinolaryngol. 2011 Nov;75(11):1368-71. doi: 10.1016/j.ijporl.2011.07.026. Epub 2011 Sep 1.
Fgf6 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 161,541,089 - 161,549,624 (+) NCBI GRCr8 mRatBN7.2 4 159,854,913 - 159,863,447 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 159,854,913 - 159,863,447 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 166,084,732 - 166,093,267 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 161,867,644 - 161,876,179 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 160,501,682 - 160,510,219 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 159,563,798 - 159,572,333 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 159,563,798 - 159,572,333 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 232,040,999 - 232,049,534 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 163,403,896 - 163,412,431 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 163,648,831 - 163,657,367 (+) NCBI Celera 4 148,570,431 - 148,578,966 (+) NCBI Celera Cytogenetic Map 4 q42 NCBI
FGF6 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 4,434,142 - 4,445,815 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 4,428,155 - 4,445,815 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 4,543,308 - 4,554,981 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 4,413,569 - 4,425,041 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 4,413,568 - 4,425,041 NCBI Celera 12 6,165,354 - 6,176,826 (-) NCBI Celera Cytogenetic Map 12 p13.32 NCBI HuRef 12 4,399,989 - 4,411,463 (-) NCBI HuRef CHM1_1 12 4,542,938 - 4,554,384 (-) NCBI CHM1_1 T2T-CHM13v2.0 12 4,440,927 - 4,452,599 (-) NCBI T2T-CHM13v2.0
Fgf6 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 126,992,505 - 127,001,681 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 126,992,549 - 127,005,150 (+) Ensembl GRCm39 Ensembl GRCm38 6 127,015,542 - 127,024,718 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 127,015,586 - 127,028,187 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 126,965,560 - 126,974,736 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 126,981,205 - 126,993,806 (+) NCBI MGSCv36 mm8 Celera 6 128,694,407 - 128,703,583 (+) NCBI Celera Cytogenetic Map 6 F3 NCBI cM Map 6 61.92 NCBI
Fgf6 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955413 2,246,965 - 2,257,883 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955413 2,246,965 - 2,257,883 (-) NCBI ChiLan1.0 ChiLan1.0
FGF6 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 9,973,565 - 9,986,599 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 9,971,511 - 9,983,357 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 4,543,776 - 4,555,352 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 4,466,975 - 4,478,459 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 4,466,975 - 4,478,459 (-) Ensembl panpan1.1 panPan2
FGF6 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 40,440,298 - 40,456,933 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 27 40,440,377 - 40,455,257 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 6,224,956 - 6,241,616 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 40,795,894 - 40,812,531 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 40,795,777 - 40,808,204 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 40,684,960 - 40,701,438 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 40,709,936 - 40,726,576 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 5,635,648 - 5,652,137 (-) NCBI UU_Cfam_GSD_1.0
Fgf6 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 104,559,308 - 104,575,178 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936606 4,613,048 - 4,624,587 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936606 4,613,052 - 4,624,587 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
FGF6 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 65,975,838 - 65,990,029 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 65,975,807 - 65,990,035 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 68,197,796 - 68,207,597 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
FGF6 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 4,464,159 - 4,476,592 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 4,464,171 - 4,473,916 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666063 3,768,764 - 3,779,212 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Fgf6
.
Predicted Target Of
Count of predictions: 133 Count of miRNA genes: 111 Interacting mature miRNAs: 112 Transcripts: ENSRNOT00000026866 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 724558 Plsm2 Polydactyly-luxate syndrome (PLS) morphotypes QTL 2 0.0003 hindlimb integrity trait (VT:0010563) hind foot phalanges count (CMO:0001949) 4 132422778 177422778 Rat 1582237 Kidm34 Kidney mass QTL 34 4 0.0001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 4 148090542 168069246 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 631683 Bp116 Blood pressure QTL 116 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 124303370 169303370 Rat 61451 Ciaa4 CIA Autoantibody QTL 4 3.1 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 4 126395976 167139601 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1298524 Oia8 Oil induced arthritis QTL 8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 10053718 Scort25 Serum corticosterone level QTL 25 2.15 0.0097 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 155561574 182687754 Rat 1549827 Scl46 Serum cholesterol level QTL 46 3.5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 132396220 177396220 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 7411558 Bw133 Body weight QTL 133 13.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 125590636 170590636 Rat 6478778 Anxrr51 Anxiety related response QTL 51 0.25384 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 124778595 169778595 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 631511 Pia7 Pristane induced arthritis QTL 7 4.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 1300109 Rf13 Renal function QTL 13 3.91 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 4 157710145 182687754 Rat 634347 Hcar8 Hepatocarcinoma resistance QTL 8 5.8 liver integrity trait (VT:0010547) liver tumorous lesion area to total liver area ratio (CMO:0001075) 4 123143783 168143783 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 61422 Cia13 Collagen induced arthritis QTL 13 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 132642577 167139601 Rat 634342 Cia24 Collagen induced arthritis QTL 24 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 146565735 175236377 Rat 737978 Pia23 Pristane induced arthritis QTL 23 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 61362 Oia2 Oil induced arthritis QTL 2 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 724535 Cm18 Cardiac mass QTL 18 2.6 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 4 118856416 163856416 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 12798525 Anxrr57 Anxiety related response QTL 57 3.21 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 147278504 167139601 Rat
Fgf6
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 159,854,977 - 159,855,146 (+) MAPPER mRatBN7.2 Rnor_6.0 4 159,563,863 - 159,564,031 NCBI Rnor6.0 Rnor_5.0 4 232,049,301 - 232,049,469 UniSTS Rnor5.0 RGSC_v3.4 4 163,403,961 - 163,404,129 UniSTS RGSC3.4 Celera 4 148,570,496 - 148,570,664 UniSTS Cytogenetic Map 4 q42 UniSTS
GDB:214840
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 159,854,748 - 159,855,016 (+) MAPPER mRatBN7.2 Rnor_6.0 4 159,563,634 - 159,563,901 NCBI Rnor6.0 Rnor_5.0 4 232,049,431 - 232,049,698 UniSTS Rnor5.0 RGSC_v3.4 4 163,403,732 - 163,403,999 UniSTS RGSC3.4 Celera 4 148,570,267 - 148,570,534 UniSTS Cytogenetic Map 4 q42 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
1
11
21
9
16
17
9
9
5
57
30
4
9
18
8
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000081426 ⟹ ENSRNOP00000068734
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 159,854,913 - 159,863,447 (+) Ensembl Rnor_6.0 Ensembl 4 159,563,798 - 159,572,333 (+) Ensembl
RefSeq Acc Id:
NM_131908 ⟹ NP_571983
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 161,541,089 - 161,549,624 (+) NCBI mRatBN7.2 4 159,854,913 - 159,863,447 (+) NCBI Rnor_6.0 4 159,563,798 - 159,572,333 (+) NCBI Rnor_5.0 4 232,040,999 - 232,049,534 (-) NCBI RGSC_v3.4 4 163,403,896 - 163,412,431 (+) RGD Celera 4 148,570,431 - 148,578,966 (+) RGD
Sequence:
ATGGCCCTGGGACAGAGGCTGTTCATCACTATGTCCCGGGGAGCAGGACGTGTTCAGGGCACGCTGCAGGCTCTCGTCTTCTTAGGCGTCCTAGTGGGCATGGTGGTGCCCTCACCTGCCGGCGCCCG
hide sequence
RefSeq Acc Id:
NP_571983 ⟸ NM_131908
- UniProtKB:
Q8R5L5 (UniProtKB/TrEMBL), A6ILX0 (UniProtKB/TrEMBL), A0A0G2JTJ4 (UniProtKB/TrEMBL)
- Sequence:
MALGQRLFITMSRGAGRVQGTLQALVFLGVLVGMVVPSPAGARANGTLLDSRGWGTLLSRSRAGLAGEISGVNWESGYLVGIKRQRRLYCNVGIGFHLQVPPDGRISGTHEENPYSLLEISTVERGVV
hide sequence
Ensembl Acc Id:
ENSRNOP00000068734 ⟸ ENSRNOT00000081426
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-09-10
Fgf6
fibroblast growth factor 6
Symbol and Name status set to approved
1299863 APPROVED
2002-08-07
Fgf6
fibroblast growth factor 6
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_expression
enriched in in the myofibers, but not in the connective tissue cells surrounding the myofibers or in satellite cells; expressed in skeletal musle tissue
708329
