Mir141 (microRNA 141) - Rat Genome Database

Save List to My RGD

Analyze GeneStrainQTL List

RGD Manual Annotations

Imported Annotations - ClinVar

Imported Annotations - CTD

Name: Mir141
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir141 (microRNA 141) Rattus norvegicus

Analyze

General
Array IDs
References

Symbol:

Mir141

Name:

microRNA 141

Description:

Predicted to be involved in sensory perception of sound. Orthologous to human MIR141 (microRNA 141); INTERACTS WITH 2-methoxyethanol; bis(2-ethylhexyl) phthalate; bisphenol A.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

rno-mir-141

Orthologs:

Homo sapiens (human) : MIR141 (microRNA 141) HGNC Alliance
Mus musculus (house mouse) : Mir141 (microRNA 141) MGI Alliance

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR141 (microRNA 141)	HGNC	Ensembl
Mus musculus (house mouse):	Mir141 (microRNA 141)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Alliance orthologs ³
Homo sapiens (human):	MIR141 (microRNA 141)	Alliance	DIOPT (HGNC)

Latest Assembly:

Rnor_6.0 - RGSC Genome Assembly v6.0

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	4	157,236,346 - 157,236,439 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	4	157,236,346 - 157,236,439 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	4	224,253,942 - 224,254,035 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	4	146,261,901 - 146,261,994 (-)	NCBI		Celera
Cytogenetic Map	4	q42	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Liver Metastasis		ISO	RGD:1345345	14928321	associated with colorectal cancer, RNA:increased expression:liver:	RGD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Hyperphosphatemic Familial Tumoral Calcinosis 1		ISO	RGD:1345345	8554872	ClinVar Annotator: match by term: Hyperphosphatemic familial tumoral calcinosis 1	ClinVar	PMID:25378588, PMID:29389098
infantile Refsum disease		ISO	RGD:1345345	8554872	ClinVar Annotator: match by term: Neonatal adrenoleucodystrophy	ClinVar	PMID:28492532
Temtamy syndrome		ISO	RGD:1345345	8554872	ClinVar Annotator: match by term: Temtamy syndrome	ClinVar	PMID:28492532

alimentary part of gastrointestinal system

endocrine system

hemolymphoid system

renal system

reproductive system

respiratory system

Below cutoff

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
alcoholic liver cirrhosis		ISO	RGD:1345345	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28545106
Breast Neoplasms		ISO	RGD:1345345	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:20099276
Chemical and Drug Induced Liver Injury		ISO	RGD:1345345	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22363424, PMID:28545106
Neoplasm Invasiveness		ISO	RGD:1345345	11554173	CTD Direct Evidence: therapeutic	CTD	PMID:27616325
pancreatitis		ISO	RGD:1345345	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27840954
type 2 diabetes mellitus		ISO	RGD:1345345	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28545106

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
17beta-estradiol	decreases expression	ISO	RGD:1345345	6480464	Estradiol results in decreased expression of MIR141 mRNA	CTD	PMID:24877718
2,3,7,8-tetrachlorodibenzodioxine	increases expression	ISO	RGD:1345345	6480464	Tetrachlorodibenzodioxin results in increased expression of MIR141 mRNA	CTD	PMID:30096437
2-hydroxypropanoic acid	decreases expression	ISO	RGD:1345345	6480464	Lactic Acid results in decreased expression of MIR141 mRNA	CTD	PMID:30851411
2-methoxyethanol	decreases expression	EXP		6480464	methyl cellosolve results in decreased expression of MIR141 mRNA	CTD	PMID:22008535
aldehydo-D-glucose	increases expression	ISO	RGD:1345345	6480464	Glucose results in increased expression of MIR141 mRNA	CTD	PMID:26548909
arsane	affects methylation	ISO	RGD:1345345	6480464	Arsenic affects the methylation of MIR141 gene	CTD	PMID:25304211
arsenic atom	affects methylation	ISO	RGD:1345345	6480464	Arsenic affects the methylation of MIR141 gene	CTD	PMID:25304211
benzo[a]pyrene	increases expression	ISO	RGD:1608331	6480464	Benzo(a)pyrene results in increased expression of MIR141 mRNA	CTD	PMID:21569818
bis(2-ethylhexyl) phthalate	multiple interactions	EXP		6480464	[diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in increased expression of MIR141	CTD	PMID:31199487
bisphenol A	multiple interactions	EXP		6480464	[bisphenol A co-treated with Genistein] results in increased methylation of MIR141 gene	CTD	PMID:28505145
bisphenol A	increases expression	ISO	RGD:1345345	6480464	bisphenol A results in increased expression of MIR141 mRNA	CTD	PMID:28238728
bleomycin A2	affects expression	EXP		6480464	Bleomycin affects the expression of MIR141 mRNA	CTD	PMID:25933445
Butylbenzyl phthalate	multiple interactions	EXP		6480464	[diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in increased expression of MIR141	CTD	PMID:31199487
cisplatin	decreases expression	EXP		6480464	Cisplatin results in decreased expression of MIR141 mRNA	CTD	PMID:27397436
cisplatin	decreases response to substance	ISO	RGD:1345345	6480464	MIR141 results in decreased susceptibility to Cisplatin	CTD	PMID:21289630
cisplatin	increases expression	EXP		6480464	Cisplatin results in increased expression of MIR141 mRNA	CTD	PMID:24880025
cisplatin	affects response to substance	ISO	RGD:1345345	6480464	MIR141 promoter affects the susceptibility to Cisplatin	CTD	PMID:20099276
D-glucose	increases expression	ISO	RGD:1345345	6480464	Glucose results in increased expression of MIR141 mRNA	CTD	PMID:26548909
dibutyl phthalate	multiple interactions	EXP		6480464	[diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in increased expression of MIR141	CTD	PMID:31199487
diethyl phthalate	multiple interactions	EXP		6480464	[diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in increased expression of MIR141	CTD	PMID:31199487
diisobutyl phthalate	multiple interactions	EXP		6480464	[diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in increased expression of MIR141	CTD	PMID:31199487
diisononyl phthalate	multiple interactions	EXP		6480464	[diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in increased expression of MIR141	CTD	PMID:31199487
dioxygen	decreases expression	ISO	RGD:1345345	6480464	Oxygen deficiency results in decreased expression of MIR141 mRNA modified form	CTD	PMID:25351418
ethanol	decreases expression	ISO	RGD:1345345	6480464	Ethanol results in decreased expression of MIR141 mRNA	CTD	PMID:28545106
furan	increases expression	EXP		6480464	furan results in increased expression of MIR141 mRNA	CTD	PMID:22079235
genistein	multiple interactions	EXP		6480464	[bisphenol A co-treated with Genistein] results in increased methylation of MIR141 gene	CTD	PMID:28505145
glucose	increases expression	ISO	RGD:1345345	6480464	Glucose results in increased expression of MIR141 mRNA	CTD	PMID:26548909
malonaldehyde	increases abundance	ISO	RGD:1345345	6480464	MIR141 mRNA results in increased abundance of Malondialdehyde	CTD	PMID:26548909
marinobufagenin	decreases expression	EXP		6480464	marinobufagenin results in decreased expression of MIR141 mRNA	CTD	PMID:26702050
methamidophos	decreases expression	ISO	RGD:1345345	6480464	methamidophos results in decreased expression of MIR141 mRNA	CTD	PMID:30602960
methimazole	multiple interactions	ISO	RGD:1608331	6480464	[Methimazole co-treated with Buthionine Sulfoximine] results in decreased expression of MIR141 mRNA	CTD	PMID:27421576
methylmercury chloride	increases expression	ISO	RGD:1345345	6480464	methylmercuric chloride results in increased expression of MIR141 mRNA	CTD	PMID:23903816
N-methyl-4-phenylpyridinium	increases expression	EXP		6480464	1-Methyl-4-phenylpyridinium results in increased expression of MIR141 mRNA	CTD	PMID:29631008
nitrofen	decreases expression	EXP		6480464	nitrofen results in decreased expression of MIR141 mRNA	CTD	PMID:27041227
ochratoxin A	increases expression	ISO	RGD:1345345	6480464	ochratoxin A results in increased expression of MIR141 mRNA	CTD	PMID:30428381, PMID:30559759
paracetamol	increases expression	EXP		6480464	Acetaminophen results in increased expression of MIR141 mRNA	CTD	PMID:27397436
paracetamol	decreases expression	ISO	RGD:1345345	6480464	Acetaminophen results in decreased expression of MIR141 mRNA	CTD	PMID:28545106
paracetamol	decreases expression	EXP		6480464	Acetaminophen results in decreased expression of MIR141 mRNA alternative form	CTD	PMID:22363424
PhIP	decreases expression	ISO	RGD:1345345	6480464	2-amino-1-methyl-6-phenylimidazo(4, 5-b)pyridine results in decreased expression of MIR141 mRNA	CTD	PMID:24877718
quartz	increases expression	EXP		6480464	Quartz results in increased expression of MIR141 mRNA	CTD	PMID:23208435
rac-lactic acid	decreases expression	ISO	RGD:1345345	6480464	Lactic Acid results in decreased expression of MIR141 mRNA	CTD	PMID:30851411
S-butyl-DL-homocysteine (S,R)-sulfoximine	multiple interactions	ISO	RGD:1608331	6480464	[Methimazole co-treated with Buthionine Sulfoximine] results in decreased expression of MIR141 mRNA	CTD	PMID:27421576
silver atom	decreases expression	ISO	RGD:1345345	6480464	Silver analog results in decreased expression of MIR141 mRNA	CTD	PMID:24974767
silver(0)	decreases expression	ISO	RGD:1345345	6480464	Silver analog results in decreased expression of MIR141 mRNA	CTD	PMID:24974767
sodium arsenite	decreases expression	ISO	RGD:1345345	6480464	sodium arsenite results in decreased expression of MIR141 mRNA	CTD	PMID:21292642
sodium arsenite	increases methylation	ISO	RGD:1345345	6480464	sodium arsenite results in increased methylation of MIR141 promoter	CTD	PMID:21292642
sodium arsenite	increases expression	ISO	RGD:1345345	6480464	sodium arsenite results in increased expression of MIR141 mRNA	CTD	PMID:27054085
sodium fluoride	increases expression	ISO	RGD:1608331	6480464	Sodium Fluoride results in increased expression of MIR141 mRNA	CTD	PMID:29127033
tetrachloromethane	decreases expression	EXP		6480464	Carbon Tetrachloride results in decreased expression of MIR141 mRNA	CTD	PMID:27397436
titanium dioxide	increases expression	ISO	RGD:1608331	6480464	titanium dioxide results in increased expression of MIR141 mRNA	CTD	PMID:21259345, PMID:29247641
Triptolide	multiple interactions	ISO	RGD:1608331	6480464	[triptolide co-treated with tariquidar] results in increased activity of MIR141 protein	CTD	PMID:26134275

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
sensory perception of sound		ISO	RGD:1608331	1624291	(MGI:MGI:5508842, PMID:23646144)	RGD	MGI:MGI:5508842, PMID:23646144

Disease Annotations

	alcoholic liver cirrhosis (ISO)
	Breast Neoplasms (ISO)
	Chemical and Drug Induced Liver Injury (ISO)
	Hyperphosphatemic Familial Tumoral Calcinosis 1 (ISO)

	infantile Refsum disease (ISO)
	Liver Metastasis (ISO)
	Neoplasm Invasiveness (ISO)
	pancreatitis (ISO)

	Temtamy syndrome (ISO)
	type 2 diabetes mellitus (ISO)

Gene-Chemical Interaction Annotations

	17beta-estradiol (ISO)
	2,3,7,8-tetrachlorodibenzodioxine (ISO)
	2-hydroxypropanoic acid (ISO)
	2-methoxyethanol (EXP)
	aldehydo-D-glucose (ISO)
	arsane (ISO)
	arsenic atom (ISO)
	benzo[a]pyrene (ISO)
	bis(2-ethylhexyl) phthalate (EXP)
	bisphenol A (EXP,ISO)
	bleomycin A2 (EXP)
	Butylbenzyl phthalate (EXP)
	cisplatin (EXP,ISO)
	D-glucose (ISO)
	dibutyl phthalate (EXP)

	diethyl phthalate (EXP)
	diisobutyl phthalate (EXP)
	diisononyl phthalate (EXP)
	dioxygen (ISO)
	ethanol (ISO)
	furan (EXP)
	genistein (EXP)
	glucose (ISO)
	malonaldehyde (ISO)
	marinobufagenin (EXP)
	methamidophos (ISO)
	methimazole (ISO)
	methylmercury chloride (ISO)
	N-methyl-4-phenylpyridinium (EXP)
	nitrofen (EXP)

	ochratoxin A (ISO)
	paracetamol (EXP,ISO)
	PhIP (ISO)
	quartz (EXP)
	rac-lactic acid (ISO)
	S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO)
	silver atom (ISO)
	silver(0) (ISO)
	sodium arsenite (ISO)
	sodium fluoride (ISO)
	tetrachloromethane (EXP)
	titanium dioxide (ISO)
	Triptolide (ISO)

Gene Ontology Annotations

Biological Process

sensory perception of sound (ISO)

References - curated

1.	RGD automated import pipeline for gene-chemical interactions
2.	Zhu SH, etal., Eur Rev Med Pharmacol Sci. 2017 May;21(10):2357-2363.

References - uncurated

PubMed

16381832 17604727 20403161 22012804 23646144 26453334 28543175 29264965 29901110 30016773 31532760

Genomics

Comparative Map Data

Mir141
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	4	157,236,346 - 157,236,439 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	4	157,236,346 - 157,236,439 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	4	224,253,942 - 224,254,035 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	4	146,261,901 - 146,261,994 (-)	NCBI		Celera
Cytogenetic Map	4	q42	NCBI

MIR141
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38 Ensembl	12	6,964,097 - 6,964,191 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	12	6,964,097 - 6,964,191 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	12	7,073,260 - 7,073,354 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	12	6,943,520 - 6,943,614 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	12	8,694,279 - 8,694,373 (+)	NCBI
Cytogenetic Map	12	p13.31	NCBI
HuRef	12	6,931,725 - 6,931,819 (+)	NCBI		HuRef
CHM1_1	12	7,072,213 - 7,072,307 (+)	NCBI		CHM1_1

Mir141
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38 Ensembl	6	124,717,914 - 124,717,985 (-)	Ensembl	GRCm38		mm10	GRCm38
GRCm38	6	124,717,914 - 124,717,985 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	6	124,667,932 - 124,668,003 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	6	126,399,639 - 126,399,710 (-)	NCBI		Celera
Cytogenetic Map	6	F2	NCBI

QTLs in Region (Rnor_6.0)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
61446	Coreg2	Compensatory renal growth QTL 2	3.5		kidney mass (VT:0002707)	compensatory renal growth score (CMO:0001894)	4	147274055	157294090	Rat
61451	Ciaa4	CIA Autoantibody QTL 4	3.1		blood autoantibody amount (VT:0003725)	calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)	4	125884464	168047091	Rat
724535	Cm18	Cardiac mass QTL 18	2.6		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	4	117926139	162926139	Rat
724558	Plsm2	Polydactyly-luxate syndrome (PLS) morphotypes QTL 2		0.0003	hindlimb integrity trait (VT:0010563)	hind foot phalanges count (CMO:0001949)	4	131834282	176834282	Rat
1331738	Bp209	Blood pressure QTL 209	2.979		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	4	136351734	180689124	Rat
1331759	Hrtrt13	Heart rate QTL 13	3.54628		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	4	108876717	169215811	Rat
737821	Hcar9	Hepatocarcinoma resistance QTL 9	3.7		liver integrity trait (VT:0010547)	volume of individual liver tumorous lesion (CMO:0001078)	4	105971071	168047091	Rat
631674	Iddm14	Insulin dependent diabetes mellitus QTL 14			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	4	63537179	157286626	Rat
631683	Bp116	Blood pressure QTL 116		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	4	123111827	168111827	Rat
737978	Pia23	Pristane induced arthritis QTL 23	5.3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	4	131532269	168047091	Rat
1331802	Srn5	Serum renin concentration QTL 5	3.045		renin activity (VT:0005581)	plasma renin activity level (CMO:0000116)	4	116726724	157291438	Rat
1582237	Kidm34	Kidney mass QTL 34	4	0.0001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	4	146942075	168998263	Rat
1298524	Oia8	Oil induced arthritis QTL 8			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	4	136351734	174694858	Rat
631511	Pia7	Pristane induced arthritis QTL 7	4.3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	4	131532269	168047091	Rat
1581574	Eae20	Experimental allergic encephalomyelitis QTL 20	7.8		nervous system integrity trait (VT:0010566)	percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)	4	152482121	158564471	Rat
2293659	Bmd35	Bone mineral density QTL 35	4.5	0.0001	femur strength trait (VT:0010010)	femoral neck ultimate force (CMO:0001703)	4	136908430	182878540	Rat
634335	Anxrr16	Anxiety related response QTL 16	7.22		locomotor behavior trait (VT:0001392)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	4	94893247	168046938	Rat
634342	Cia24	Collagen induced arthritis QTL 24	4.5		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	4	145373934	176509907	Rat
634347	Hcar8	Hepatocarcinoma resistance QTL 8	5.8		liver integrity trait (VT:0010547)	liver tumorous lesion area to total liver area ratio (CMO:0001075)	4	123478354	168478354	Rat
1576316	Ept5	Estrogen-induced pituitary tumorigenesis QTL 5	3.8		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	4	84475257	178931073	Rat
1578674	Bmd12	Bone mineral density QTL 12	3.8		femur mineral mass (VT:0010011)	cortical volumetric bone mineral density (CMO:0001730)	4	137171018	182171018	Rat
2316958	Gluco58	Glucose level QTL 58	10		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	4	7850904	182171018	Rat
1358364	Sradr4	Stress Responsive Adrenal Weight QTL 4	4.92		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	4	128602727	173602727	Rat
1358202	Gluco11	Glucose level QTL 11	2.4	0.02	adipocyte glucose uptake trait (VT:0004185)	absolute change in adipocyte glucose uptake (CMO:0000873)	4	86438317	168047091	Rat
2303623	Vencon2	Ventilatory control QTL 2	3.8		respiration trait (VT:0001943)	minute ventilation (VE) (CMO:0000132)	4	134917642	179917642	Rat
1549827	Scl46	Serum cholesterol level QTL 46	3.5		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	4	131864442	176864442	Rat
61362	Oia2	Oil induced arthritis QTL 2		0.001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	4	136351734	174694858	Rat
61422	Cia13	Collagen induced arthritis QTL 13	4.5		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	4	132455408	168047091	Rat
6478718	Anxrr34	Anxiety related response QTL 34		0.00896	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	145547014	184226339	Rat
6478720	Alc23	Alcohol consumption QTL 23		0.00509	drinking behavior trait (VT:0001422)	ethanol drink intake rate to body weight ratio (CMO:0001616)	4	155386197	184226339	Rat
6478728	Anxrr36	Anxiety related response QTL 36		0.01061	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	155386197	184226339	Rat
6478733	Anxrr37	Anxiety related response QTL 37		0.00095	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	155386197	184226339	Rat
6478737	Anxrr38	Anxiety related response QTL 38		0.00159	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	155386197	184226339	Rat
6478748	Anxrr42	Anxiety related response QTL 42		0.28008	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	145547014	184226339	Rat
6478754	Anxrr43	Anxiety related response QTL 43		0.14035	locomotor behavior trait (VT:0001392)	distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)	4	145547014	184226339	Rat
6478757	Anxrr44	Anxiety related response QTL 44		0.01087	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	155386197	184226339	Rat
6478778	Anxrr51	Anxiety related response QTL 51		0.25384	locomotor behavior trait (VT:0001392)	measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)	4	123587009	168587009	Rat
6478782	Anxrr52	Anxiety related response QTL 52		0.02091	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	155386197	184226339	Rat
6478785	Anxrr53	Anxiety related response QTL 53		0.01397	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	155386197	184226339	Rat
6478693	Anxrr32	Anxiety related response QTL 32		0.00092	locomotor behavior trait (VT:0001392)	measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)	4	145547014	184226339	Rat
6478700	Anxrr33	Anxiety related response QTL 33		0.00896	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	145547014	184226339	Rat
7411558	Bw133	Body weight QTL 133	13.84	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	4	124442168	169442168	Rat
10053718	Scort25	Serum corticosterone level QTL 25	2.15	0.0097	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	4	156855449	184226339	Rat
10401796	Kidm48	Kidney mass QTL 48			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	4	146497452	184226339	Rat
10755501	Bp390	Blood pressure QTL 390	2.5		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	4	23850384	169318094	Rat
12798519	Anxrr54	Anxiety related response QTL 54	2.54	0.05	locomotor behavior trait (VT:0001392)	distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)	4	112807675	157807675	Rat
12798525	Anxrr57	Anxiety related response QTL 57	3.21	0.05	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	4	146086918	168047091	Rat

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Elavl4	rno-miR-141-3p	Mirtarbase	external_info	qRT-PCR	Functional MTI (Weak)	20584986

Predicted Targets

	Summary Value
Count of predictions:	8148
Count of gene targets:	5034
Count of transcripts:	5387
Interacting mature miRNAs:	rno-miR-141-3p, rno-miR-141-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_031887	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AAHX01032846	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AC129138	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000053700

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0 Ensembl	4	157,236,346 - 157,236,439 (-)	Ensembl

RefSeq Acc Id:

NR_031887

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0	4	157,236,346 - 157,236,439 (-)	NCBI
Rnor_5.0	4	224,253,942 - 224,254,035 (-)	NCBI
Celera	4	146,261,901 - 146,261,994 (-)	NCBI

Sequence:

show sequence

GGCTGACTCTGAGTCCATCTTCCAGTGCAGTGTTGGATGGTTGAAGTACGAAGCTCCTAACACT
GTCTGGTAAAGATGGCCCCCGGGTCAGTTC

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Strain Variation

Strain Sequence Variants (Rnor 6.0)

ACI/EurMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Medical College of Wisconsin
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

ACI/EurMcwi (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

ACI/N (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Royal Netherland Academy of Arts and Sciences (Dr. Edwin Cuppen) Max Delbruck Center for Molecular Medicine (Dr. Norbert Huebner)
Platform:	SOLiD 4 and 5500
Secondary Analysis:	liftOver (Batch Coordinate Conversion)--genome.ucsc.edu
Breeder:	National Institutes of Health
Description:	Founder strain for the heterogeneous stock (HS) rat population; SNPs from the RGSC 3.4 assembly were "lifted over" from RGSC 3.4 to Rnor 5.0 and from Rnor 5.0 to Rnor 6.0; Provided by Medical College of Wisconsin

BBDP/Wor (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

BN/SsN (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Royal Netherland Academy of Arts and Sciences (Dr. Edwin Cuppen) Max Delbruck Center for Molecular Medicine (Dr. Norbert Huebner)
Platform:	SOLiD 4 and 5500
Secondary Analysis:	liftOver (Batch Coordinate Conversion)--genome.ucsc.edu
Breeder:	National Institutes of Health
Description:	Founder strain for the heterogeneous stock (HS) rat population; SNPs from the RGSC 3.4 assembly were "lifted over" from RGSC 3.4 to Rnor 5.0 and from Rnor 5.0 to Rnor 6.0; Provided by Medical College of Wisconsin

Buf/N (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Royal Netherland Academy of Arts and Sciences (Dr. Edwin Cuppen) Max Delbruck Center for Molecular Medicine (Dr. Norbert Huebner)
Platform:	SOLiD 4 and 5500
Secondary Analysis:	liftOver (Batch Coordinate Conversion)--genome.ucsc.edu
Breeder:	National Institutes of Health
Description:	Founder strain for the heterogeneous stock (HS) rat population; SNPs from the RGSC 3.4 assembly were "lifted over" from RGSC 3.4 to Rnor 5.0 and from Rnor 5.0 to Rnor 6.0; Provided by Medical College of Wisconsin

COP/CrCrl (MCW & UW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob) University of Wisconsin (Dr. James Shull)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Charles River Laboratories
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob) and UW Madison (Dr. James Shull)

F344/NCrl (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

F344/NRrrc (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Royal Netherland Academy of Arts and Sciences (Dr. Edwin Cuppen) Max Delbruck Center for Molecular Medicine (Dr. Norbert Huebner)
Platform:	SOLiD 4 and 5500
Secondary Analysis:	liftOver (Batch Coordinate Conversion)--genome.ucsc.edu
Breeder:	National Institutes of Health
Description:	Founder strain for the heterogeneous stock (HS) rat population; SNPs from the RGSC 3.4 assembly were "lifted over" from RGSC 3.4 to Rnor 5.0 and from Rnor 5.0 to Rnor 6.0; Provided by Medical College of Wisconsin

FHH/EurMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Medical College of Wisconsin
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

FHH/EurMcwi (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

FHL/EurMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Medical College of Wisconsin
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

FHL/EurMcwi (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

GH/OmrMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Medical College of Wisconsin
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

GK/Ox (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

LE/Stm (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

LEW/Crl (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

LEW/NCrlBR (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

LH/MavRrrc (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

LL/MavRrrc (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

LN/MavRrrc (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

M520/N (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Royal Netherland Academy of Arts and Sciences (Dr. Edwin Cuppen) Max Delbruck Center for Molecular Medicine (Dr. Norbert Huebner)
Platform:	SOLiD 4 and 5500
Secondary Analysis:	liftOver (Batch Coordinate Conversion)--genome.ucsc.edu
Breeder:	National Institutes of Health
Description:	Founder strain for the heterogeneous stock (HS) rat population; SNPs from the RGSC 3.4 assembly were "lifted over" from RGSC 3.4 to Rnor 5.0 and from Rnor 5.0 to Rnor 6.0; Provided by Medical College of Wisconsin

MHS/Gib (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

MNS/Gib (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

MR/N (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Royal Netherland Academy of Arts and Sciences (Dr. Edwin Cuppen) Max Delbruck Center for Molecular Medicine (Dr. Norbert Huebner)
Platform:	SOLiD 4 and 5500
Secondary Analysis:	liftOver (Batch Coordinate Conversion)--genome.ucsc.edu
Breeder:	National Institutes of Health
Description:	Founder strain for the heterogeneous stock (HS) rat population; SNPs from the RGSC 3.4 assembly were "lifted over" from RGSC 3.4 to Rnor 5.0 and from Rnor 5.0 to Rnor 6.0; Provided by Medical College of Wisconsin

SBH/Ygl (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Medical College of Wisconsin
Description:	SBH/Ygl sequenced by MCW

SBH/Ygl (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

SBN/Ygl (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Medical College of Wisconsin
Description:	SBN/Ygl sequenced by MCW

SBN/Ygl (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

SHR/NHsd (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

SHRSP/Gcrc (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

SR/JrHsd (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Harlan Laboratories
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

SR/JrHsd (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

SS/Jr (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

SS/JrHsdMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.7.7 and GATK v3.2-2
Breeder:	Medical College of Wisconsin
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

SS/JrHsdMcwi (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

WAG/Rij (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

WKY/Gcrc (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

WKY/N (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Royal Netherland Academy of Arts and Sciences (Dr. Edwin Cuppen) Max Delbruck Center for Molecular Medicine (Dr. Norbert Huebner)
Platform:	SOLiD 4 and 5500
Secondary Analysis:	liftOver (Batch Coordinate Conversion)--genome.ucsc.edu
Breeder:	National Institutes of Health
Description:	Founder strain for the heterogeneous stock (HS) rat population; SNPs from the RGSC 3.4 assembly were "lifted over" from RGSC 3.4 to Rnor 5.0 and from Rnor 5.0 to Rnor 6.0; Provided by Medical College of Wisconsin

WKY/NCrl (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

WKY/NHsd (RGD)

Visual

CSV

TAB

Printer

Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA mem 0.7.15, GATK v.3.6-0
Description:	Sequences from Atanur et al and Hermsen et al realigned to the Rnor 6.0 assembly and reanalyzed by RGD

WN/N (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Royal Netherland Academy of Arts and Sciences (Dr. Edwin Cuppen) Max Delbruck Center for Molecular Medicine (Dr. Norbert Huebner)
Platform:	SOLiD 4 and 5500
Secondary Analysis:	liftOver (Batch Coordinate Conversion)--genome.ucsc.edu
Breeder:	National Institutes of Health
Description:	Founder strain for the heterogeneous stock (HS) rat population; SNPs from the RGSC 3.4 assembly were "lifted over" from RGSC 3.4 to Rnor 5.0 and from Rnor 5.0 to Rnor 6.0; Provided by Medical College of Wisconsin

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325407	AgrOrtholog
Ensembl Genes	ENSRNOG00000035577	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053700	ENTREZGENE
miRBase	MI0000914	ENTREZGENE
NCBI Gene	100314215	ENTREZGENE
PhenoGen	Mir141	PhenoGen
RNAcentral	URS000003E1A9	RNACentral
	URS0000618F93	RNACentral
	URS000075B3F6	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2015-04-09	Mir141	microRNA 141	Mir141	microRNA mir-141	Name updated	61478	APPROVED
2010-06-02	Mir141	microRNA mir-141			Symbol and Name status set to provisional	70820	PROVISIONAL

More on Mir141
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: rn5 rn6
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	2325407
Created:	2010-06-02
Species:	Rattus norvegicus
Last Modified:	2020-06-09
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.