| 61000 | SHR | Spontaneously Hypertensive Rat | Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648). | | inbred | 26 | symbol , origin |
| 728194 | SHR/N | | To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. | | inbred | 23 | symbol |
| 1302680 | SHR/Ta | | Strain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol |
| 7241794 | SHR/Bbb | | This SHR colony is maintained at Max-Delbruck Center for Molecular Medicine, Germany | | inbred | 2 | symbol , origin , old_strain_symbol |
| 731186 | SHR/Fub | | Spontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany | | inbred | 4 | symbol |
| 1302724 | SHR/Hcm | | Strain is from the Hyogo College of Medicine, Japan. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol |
| 631577 | SHR/Izm | | Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). | National BioResource Project for the Rat in Japan, Funabashi Farm, Chiba, Japan | inbred | 12 | symbol |
| 10043826 | SHR/Kpo | | Spontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 1302620 | SHR/Kyo | spontaneous hypertension rat | Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). | National BioResource Project for the Rat in Japan | mutant | 3 | symbol |
| 61110 | SHR/Mol | | Spontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes. | | inbred | 23 | symbol |
| 1559042 | SHR/Nig | | Originated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin |
| 61100 | SHR/Ola | | Strain originated from an inbred SHR strain from Harlan UK Ltd. | | inbred | 23 | symbol , origin |
| 2304280 | SHR/Shi | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , old_strain_symbol |
| 631604 | SHR/Snk | | The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. | | inbred | 11 | symbol |
| 8142385 | SHR/Utx | | Animals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974 | | inbred | 4 | symbol , origin , old_strain_symbol |
| 1566434 | NTac:SHR | | Taconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony. | Taconic | outbred | 1 | symbol , origin , old_strain_symbol |
| 10043828 | SHR/2Kpo | | Spontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 737923 | SHR/Maas | | Substrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlands | | inbred | 1 | symbol , origin |
| 1357994 | SHR/NCrl | | To Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with continued selection for spontaneo us hypertension. | Charles River Laboratories | inbred | 1 | symbol , old_strain_symbol |
| 724574 | SHR/NHsd | | SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) | Envigo | inbred | 18 | symbol , origin |
| 1558662 | SHR/Tkyo | | Substrain of SHR rats maintained at International Medical Center of Japan, Tokyo | | inbred | 8 | symbol , origin |
| 2307155 | SHR/1NCrl | | To Charles River from NIH in 1973 at F32. | | inbred | 1 | symbol , old_strain_symbol |
| 2306045 | SHR/2Dmcr | | Developed by the DEPOSITOR, one of the SHR substrains from B2 line | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 2306048 | SHR/3Dmcr | | Developed by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 2306043 | SHR/4Dmcr | | Developed by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 61096 | SHR/NCruk | Spontaneously Hypertensive Rat | NIH derived strain maintained at the Charles River, United Kingdom. | Charles River Laboratories UK | inbred | 9 | symbol , old_strain_symbol |
| 631696 | SHR/FubRkb | | Strain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin. | | inbred | 13 | symbol , origin , old_strain_symbol |
| 10043813 | SHR/HktIzm | | SHR/Kyushu rat (Kyushu University) was delivered to Shimane University in 2000 and maintained as inbred. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 10038 | SHR/OlaHsd | Spontaneously Hypertensive Rat | | Harlan Sprague Dawley, Inc. | inbred | 1 | symbol |
| 8553013 | SHR/NCrlArc | | To Animal Resources Centre from Charles River | Animal Resources Centre, Australia | inbred | 1 | symbol |
| 13452406 | SHR/NHsdAkr | Spontaneously Hypertensive Rat | SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at the University of Akron breeding colonies, Akron, Ohio | | inbred | 1 | symbol , origin |
| 2325143 | SHR/NHsdMco | Spontaneously Hypertensive Rat | SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. | | inbred | 7 | symbol , origin |
| 631848 | SHR/OlaIpcv | | These are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. A spontaneous recessive mutation in intron 37 (-1 of exon 38) of Sbf 1 was identified in this strain. | | inbred | 17 | symbol , origin |
| 6218997 | SHR/NCrlAnra | | These were originally from Harvard University, Boston MA, then at UNESP, Botucatu, SP, Brazil, now maintained at Behavior Genetics Laboratory, SC, Brazil | | inbred | 5 | symbol |
| 629465 | SHR/NCrlCrlj | | NIH derived strain maintained at the Charles River, Japan. | Charles River Japan, National BioResource Project for the Rat in Japan | inbred | 7 | symbol , old_strain_symbol |
| 9587831 | SHR/NCrlNarl | | Imported from NIH in 2000, now maintained at National Laboratory Animal Center, Taiwan | National Laboratory Animal Center, Taiwan | inbred | 1 | symbol |
| 9586448 | SHR/NCrlPrin | | Substrain of SHR originally from Charles River now maintained at University of California | | inbred | 1 | symbol , origin , old_strain_symbol |
| 634364 | SHR/NIcoCrlf | | A substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. | Charles River, France | inbred | 18 | symbol , origin , old_strain_symbol |
| 2307090 | SHR.BN10/Ipcv | | A segment of chr 10 from BN was introgressed into the SHR background | | congenic | 1 | symbol , origin , old_strain_symbol |
| 728195 | SHR/N-cp | | The spontaneously hypertensive corpulent (SHR/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain in which obese homozygotes {cp/cp) are characterized by genetic obesity, mild hypertension, hyper-insulinemia, and glucose intolera nce. This rat strain was initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female SHR ratof the Okamoto strain. A minimum of 12 backcrosses were carried out to eliminate the non-cp genes of the Ko-letsky strain. The obese (cp/cp) littermates develop glucosuria, proteinuria, and renal structural lesions resemblingdiabetic glomerulosclerosis. | Rat Resource and Research Center | congenic | 1 | symbol , old_strain_name , origin |
| 728189 | SHR/N-di | | Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating wi th contin- ued selection for spontaneous hypertension. | NIH Autoimmune Rat Model Repository and Development Center | congenic | 1 | symbol , old_strain_name |
| 38549352 | SHR/OlaIpcvMcwi | | These are re-derived rats of SHR substrain (SHR/OlaIpcv, RGD:9586450) from Czech Academy of Sciences now maintained at Medical College of Wisconsin. | RGD HRDP, contact Hybrid Rat Diversity Program at
HRDP@mcw.edu | inbred | 1 | symbol , origin |
| 9586450 | SHR/OlaIpcvPrin | | These are substrains of SHR from Czech Academy of Sciences now maintained at University of California | | inbred | 1 | symbol , origin |
| 2290299 | SHR-Tg(Thy1-MAPT)72 | | SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 | | transgenic | 5 | symbol , origin |
| 2290298 | SHR-Tg(Thy1-MAPT)318 | | SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 | | transgenic | 7 | symbol , origin |
| 628907 | SHR.BN-RT1n | | This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR. | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1559046 | SHR-Chr YW/K | | Consomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replac ing the chromosome Y of SHR/Mol by that of wild rats in 1996. | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 8552321 | SHR-Tg(APOC3-CETP)1Tkyo | | The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC3 promoter into SHR/Izm rat fertile eggs. | National BioResource Project for the Rat in Japan | transgenic | 1 | symbol , origin |
| 8552323 | SHR-Tg(APOC3-CETP)2Tkyo | | The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs. | National BioResource Project for the Rat in Japan | transgenic | 1 | symbol , origin |
| 8552325 | SHR-Tg(APOC3-CETP)3Tkyo | | The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC5 promoter into SHR/Izm rat fertile eggs. | National BioResource Project for the Rat in Japan | transgenic | 1 | symbol , origin |
| 8552327 | SHR-Tg(APOC3-CETP)4Tkyo | | The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs. | National BioResource Project for the Rat in Japan | transgenic | 1 | symbol , origin |
| 629502 | SHR.BN-(Il6-Npy) | | This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotes | | congenic | 3 | symbol , origin , old_strain_symbol |
| 150429988 | SHR-Tg(EEF1A1-Wars2)Ipcv | | This strain was derived by microinjecting fertilized eggs with a mix of the Sleeping Beauty construct containing BN Wars2 cDNA under control of the universal EF-1α (human EEF1A1) promoter and mRNA of the SB100X transposase (Ivics et al. 2014). Transgenic rats were detected using PCR with the follow ing primers: Wars2-F 5'-TGT GCT ACA AGT CCA CAC AC-3' and Wars2-R 5'-GCA GAA GGG TCA CGA AGA GA-3'. | | transgenic | 3 | symbol , old_strain_symbol |
| 2302148 | SHR-Tg(EEF1A1-Cd36)10Ipcv | | Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) | | transgenic | 3 | symbol , origin , old_strain_symbol |
| 2302149 | SHR-Tg(EEF1A1-Cd36)19Ipcv | | Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) | | transgenic | 3 | symbol , origin , old_strain_symbol |
| 2302150 | SHR-Tg(EEF1A1-Cd36)93Ipcv | | Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter). | | transgenic | 5 | symbol , origin , old_strain_symbol |
| 150520206 | SHR-Tg(EEF1A1-Folr1 )Ipcv | | Generated by microinjecting SHR/OlaIpcv zygotes with wild type Folr1 cDNA from BN-Lx/Cub under control of EF-1α (human EEF1A1) universal promoter | | transgenic | 1 | symbol , sslp_assay_name , origin , old_strain_symbol |
| 2300216 | SHR-Tg(PEPCK-SREBF1)1Ipcv | | SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signal | | transgenic | 2 | symbol , origin , old_strain_symbol |
| 2313693 | SHR-Tg(PEPCK-SREBF1)2Ipcv | | SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signal | | transgenic | 19 | symbol , origin , old_strain_symbol |
| 1641875 | SHR-Chr YBN/Cub | | BN-Lx/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generations | | consomic | 9 | symbol , origin , old_strain_symbol |
| 2302151 | SHR-Tg(EEF1A1-Cd36)106Ipcv | | Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) | | transgenic | 3 | symbol , origin , old_strain_symbol |
| 1641831 | MWF-Chr 6SHR/Rkb | | MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing | | consomic | 7 | symbol , origin , old_strain_symbol |
| 2312609 | MWF-Chr 8SHR/Rkb | | MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossing | | consomic | 10 | symbol , origin , old_strain_symbol |
| 2317891 | SHR-Chr 6MWF/Rkb | | SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing | | consomic | 7 | symbol , origin , old_strain_symbol |
| 6480210 | SHR-Chr 8MWF/Rkb | | SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing | | consomic | 12 | symbol , origin , old_strain_symbol |
| 7241265 | SHR-Chr YWKY/Akr | | WKY/NHsd males were crosssed with SHR/NHsd females to get F1 animals, the hybrid animals were backcrossed with female SHR/NHsd to transfer the Y chromosome | | consomic | 4 | symbol , origin , old_strain_symbol |
| 1641879 | SS-Chr 19SHR/Rkb | | SS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing | | consomic | 12 | symbol , origin , alias , old_strain_symbol |
| 7241267 | WKY-Chr YSHR/Akr | | SHR/NHsd males were crosssed with WKY/NHsd females to get F1 animals, the hybrid animals were backcrossed with female WKY/NHsd to transfer the Y chromosome | | consomic | 3 | symbol , origin , old_strain_symbol |
| 6902893 | BB.SHR-(Acsm3-Igf2)/K | | Congenics extablished as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats | | congenic | 3 | symbol , origin , old_strain_symbol |
| 1357346 | BB.SHR-(D4Mit6-Spr)/K | | BB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected. | | congenic | 4 | symbol , origin , old_strain_symbol |
| 728142 | BN.SHR-(Il6-Cd36)/Cub | | This congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR. | | congenic | 4 | symbol , origin , old_strain_symbol |
| 2305946 | SHR-Chr 1WKY/Tkyo | | Chromosome 1 from WKY is introgressed into the genomic background of SHR | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2306021 | SHR-Chr 2WKY/Tkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , old_strain_symbol |
| 2305942 | SHR-Chr 3WKY/Tkyo | | Chromosome 3 from WKY is introgressed into the genomic background of SHR | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2303784 | SHR-Chr 4WKY/Tkyo | | Chromosome 3 from WKY is introgressed into the genomic background of SHR | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2305941 | SHR-Chr 15WKY/Tkyo | | Chromosome 15 from WKY is introgressed into the genomic background of SHR | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2305947 | SHR-Chr 19WKY/Tkyo | | Chromosome 19 from WKY is introgressed into the genomic background of SHR | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2312578 | SHR.BN-(D18Rat82)/Ipcv | | F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity | | congenic | 2 | symbol , origin , old_strain_symbol |
| 631700 | BB.SHR-(Gnal-D18Mit9)/K | | Diabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the ... (more) pan style='font-weight:700;'>SHR allele were selected. This fragment is 24cM long. | | congenic | 9 | symbol , origin , old_strain_symbol |
| 149735371 | SHR-C3em1Kyo | | ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR ;'>SHR/Izm embryos. The DNA of 10 day old pups was extracted and screened for ZFN-induced mutations. Briefly, DNA extracted from ear tissue was amplified using primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'-AATAGAGGCCACCAATGCAC-3'). This mutant revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg). | National BioResource Project for the Rat in Japan | advanced_intercross_line | 1 | symbol , origin |
| 1357980 | BB.SHR-(D4Got41-Tacr1)/K | | Congenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997. | National BioResource Project for the Rat in Japan | congenic | 4 | symbol , origin , old_strain_symbol |
| 127285404 | SHR-Cfbem1Tja | | This strain was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion. | | mutant | 14 | symbol , origin |
| 1642036 | SHR/OlaIpcv-mtBN/Crl | | Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic back ground | | conplastic | 5 | symbol , old_strain_name , origin , old_strain_symbol |
| 1357974 | BB.SHR-(D4Got41-Gimap5)/K | | Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. | | congenic | 6 | symbol , origin , old_strain_symbol |
| 10002782 | SHR-Sbf1m1Ipcv | | Spontaneous mutation in the colony of SHR/OlaIpcv in Prague. | | mutant | 5 | symbol , origin , old_strain_symbol |
| 628908 | SHR.BN-(D1Mit3-Igf2)/Ipcv | | Segment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous st ate by brother x sister mating. | | congenic | 10 | symbol , origin , old_strain_symbol |
| 631590 | SHR.WKY-(D1Wox34-Sah)/Njs | | Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR | | congenic | 3 | symbol , origin , old_strain_symbol |
| 1358996 | SHR.WKY-(D2Rat10-D2Mgh13) | | This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl background | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1359005 | SHR.WKY-(D2Rat15-D2Rat50) | | This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) to parental strain SHR/NCrl | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1358992 | SHR.WKY-(D2Rat40-D2Rat50) | | Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markers | | congenic | 4 | symbol , origin , old_strain_symbol |
| 1549799 | BB.SHR-(D6Rat184-D6Rat3)/K | | Congenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000. | National BioResource Project for the Rat in Japan | congenic | 9 | symbol , origin , old_strain_symbol |
| 38599208 | SHR-Prdx2em1Izm | | This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 7-bp deletion (5'-CTCCGGC-3', c.6_13del7) in the exon2 of Prdx2 gene. Target sequence is 5?-CCTC CGGCAACGCGCACATCGGA-3?(PAM sequence:CCT). | National BioResource Project for the Rat in Japan | mutant | 5 | symbol , old_strain_name , origin |
| 38599206 | SHR-Prdx2em2Izm | | This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 6-bp deletion (5'-CTCCGG-3', c.6_12del6) in the exon2 of Prdx2 gene.
Target sequence is 5?-CCTCC GGCAACGCGCACATCGGA-3?(PAM sequence:CCT). | National BioResource Project for the Rat in Japan | mutant | 1 | symbol , old_strain_name , origin |
| 628909 | SHR.BN-(D13Arb5-Ren1)/Ipcv | | Segment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity. | | congenic | 12 | symbol , origin , old_strain_symbol |
| 629548 | SHR.BN-(D1Mit3-Igf2)/1lpcv | | SHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv. | | congenic | 1 | symbol , origin , old_strain_symbol |
| 629481 | SHR.WKY-(D1Wox33-D1Got194) | | This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background. | | congenic | 1 | symbol , origin , old_strain_symbol |
| 629136826 | SHR/OlaIpcv-mtF344/Crl | | Mitochodrial genome of SHR/OlaIpcv was selectively replaced byF344/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of F344/Crl on SHR/OlaIpcv nuclear genetic b ackground | | conplastic | 1 | symbol , old_strain_name , origin |
| 150520204 | SHR/OlaIpcv-mtLEW/Ipcv | | Mitochodrial genome of SHR/OlaIpcv was selectively replaced by LEW/Ipcv to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of LEW/Ipcv on SHR/OlaIpcv nuclear genetic background. | | conplastic | 4 | symbol , origin , alternate_id |
| 1358999 | WKY.SHR-(D2Rat174-D2Rat28) | | This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl | | congenic | 3 | symbol , origin , old_strain_symbol |
| 1359007 | WKY.SHR-(D2Rat174-D2Rat62) | | This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1359006 | WKY.SHR-(D2Rat27-D2Rat243) | | This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1359001 | WKY.SHR-(D2Rat42-D2Rat139) | | Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers | | congenic | 3 | symbol , origin , old_strain_symbol |
| 1357976 | BB.SHR-(D4Got41-D4Rat171)/K | | Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. | | congenic | 7 | symbol , origin , old_strain_symbol |
| 150429605 | MWF.SHR-(D6Rat1-D6Mgh4)/Rkb | | The congenic MWF.SHR-(D6Rat1-D6Mgh4)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR :700;'>SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | | congenic | 1 | symbol , origin |
| 150429603 | MWF.SHR-(D6Rat1-D6Mit8)/Rkb | | The congenic MWF.SHR-(D6Rat1-D6Mit8)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR :700;'>SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | | congenic | 1 | symbol , origin |
| 150520205 | SHR-Gja8m1+/-Cub | | This strain is derived from SHR/OlaIpcv where a spontaneous mutation was observed in the NH2-terminal cytosolic domain of Cx50, L7Q. The connexin50 mutation in heterozygous state affects significantly the lipid profile and the oxidative stress paramet ers in SHR rats. | | mutant | 25 | symbol , origin , old_strain_symbol |
| 2293729 | SHR-Gja8m1-/-Cub | | This strain is a coisogenic mutant derived from SHR/OlaIpcv where a mutation is observed in the NH2-terminal cytosolic domain of Cx50, L7Q | | mutant | 16 | symbol , origin , old_strain_symbol , alternate_id |
| 13207518 | SHR-Hspa1em1Mcwi | | CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos. | Contact MCW rat distribution at mcwcustomrats@mcw.edu | mutant | 1 | symbol , origin , old_strain_symbol |
| 2306894 | SHR.BN-(D4Rat33-D4Rat54)/Jk | | Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals | Genetica | congenic | 6 | symbol , origin , old_strain_symbol |
| 61106 | SHR.BN-(D8Mit5-D8Mgh6)/Ipcv | | A segment of chr. 8 is transferred from the normotensive BN-Lx/Cub rat to the SHR/Ola. | | congenic | 14 | symbol , origin , old_strain_symbol |
| 2314532 | SHR.SS-(D8Uia1-D8Rat90)/Mco | | SS/Jr females were bred with SHR/NHsd males and their male F1 were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further sele ction was done using microsatellite markers | | congenic | 3 | symbol , origin , old_strain_symbol |
| 1358994 | SHR.WKY-(D2Rat161-D2Rat241) | | This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) congenic strain to the parental strain SHR/NCrl | | congenic | 2 | symbol , origin , old_strain_symbol |
| 2314530 | SS.SHR-(D8Uia1-D8Rat90)/Mco | | SS/Jr females were bred with SHR/NHsd males and their female F1 were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite marke rs | | congenic | 3 | symbol , origin , old_strain_symbol |
| 6903920 | SS.SHR-(D9Mco72-D9Uia4)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 4 | symbol , origin , old_strain_symbol |
| 6903934 | SS.SHR-(D9Rat7-D9Mco91)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 1 | symbol , origin , old_strain_symbol |
| 2303153 | SS.SHR-(D9Rat7-D9Mco93)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 4 | symbol , origin , old_strain_symbol |
| 6903932 | SS.SHR-(D9Rat7-D9Rat52)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 1 | symbol , origin , old_strain_symbol |
| 6903936 | SS.SHR-(D9Rat7-D9Rat84)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 7 | symbol , origin , old_strain_symbol |
| 1358993 | WKY.SHR-(D2Rat161-D2Rat185) | | This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl | | congenic | 1 | symbol , origin , old_strain_symbol |
| 1359009 | WKY.SHR-(D2Rat174-D2Rat185) | | Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1358997 | WKY.SHR-(D2Rat241-D2Rat185) | | This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl | | congenic | 1 | symbol , origin , old_strain_symbol |
| 631699 | BB.SHR-(D6Rat184-D6Rat101)/K | | Congenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females. | | congenic | 1 | symbol , origin , old_strain_symbol |
| 150429601 | MWF.SHR-(D6Rat1-D6Rat30)/Rkb | | The congenic MWF.SHR-(D6Rat1-D6Rat30)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR t:700;'>SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | | congenic | 1 | symbol , origin |
| 150429606 | MWF.SHR-(D6Rat1-D6Rat81)/Rkb | | The congenic MWF.SHR-(D6Rat1-D6Rat81)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR t:700;'>SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | | congenic | 3 | symbol , origin |
| 14394501 | SHR-Klrb1aem1Mcwi | | CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. | Contact MCW rat distribution at mcwcustomrats@mcw.edu | mutant | 1 | symbol , origin |
| 14394504 | SHR-Klrb1aem2Mcwi | | CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos. | Contact MCW rat distribution at mcwcustomrats@mcw.edu | mutant | 1 | symbol , origin |
| 9588544 | SHR-Ndufc2em1Mcwi | | This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a 9-bp deletion in exon 1. | | mutant | 2 | symbol , origin , old_strain_symbol |
| 9588546 | SHR-Ndufc2em2Mcwi | | This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1. | | mutant | 2 | symbol , origin , old_strain_symbol |
| 2300217 | SHR.BN-(D10Mgh3-Srebf1)/Ipcv | | 53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv background | | congenic | 4 | symbol , origin , old_strain_symbol |
| 2306893 | SHR.BN-(D16Rat87-D16Mgh1)/Jk | | Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals | Genetica | congenic | 6 | symbol , origin , old_strain_symbol |
| 2316925 | SHR.BN-(D3Rat159-D3Rat1)/Mco | | 50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd | | congenic | 5 | symbol , origin , old_strain_symbol |
| 1641863 | SHR.PD-(D8Mgh9-D8Rat149)/Cub | | A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv. | | congenic | 6 | symbol , origin , old_strain_symbol |
| 1641851 | SHR.PD-(D8Rat42-D8Arb23)/Cub | | A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-Lx strain | | congenic | 8 | symbol , origin , old_strain_symbol |
| 2314531 | SHR.SS-(D13Rat1-D13Mgh6)/Mco | | SS/Jr females were bred with SHR/NHsd males and their male F1 were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further sele ction was done using microsatellite markers | | congenic | 3 | symbol , origin , old_strain_symbol |
| 2306109 | SHR.WKY-(D3Mgh6-D3Rat1)/Tkyo | | This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred ho mozygous in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1579703 | SS.SHR-(D2Rat61-D2Mco18)/Mco | | Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. | | congenic | 5 | symbol , origin , old_strain_symbol |
| 1579696 | SS.SHR-(D6Wox13-D6Rat84)/Mco | | Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. | | congenic | 3 | symbol , origin , old_strain_symbol |
| 2303152 | SS.SHR-(D9Mco72-D9Mco93)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 4 | symbol , origin , old_strain_symbol |
| 6903914 | SS.SHR-(D9Mco72-D9Rat55)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 1 | symbol , origin , old_strain_symbol |
| 6903912 | SS.SHR-(D9Mco72-D9Rat89)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 1 | symbol , origin , old_strain_symbol |
| 2303150 | SS.SHR-(D9Mco74-D9Rat64)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 3 | symbol , origin , old_strain_symbol |
| 6903928 | SS.SHR-(D9Rat7-D9Got111)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 2 | symbol , origin , old_strain_symbol |
| 2303149 | SS.SHR-(D9Wox16-D9Mco73)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region. | | congenic | 1 | symbol , origin , old_strain_symbol |
| 2303151 | SS.SHR-(D9Wox16-D9Mco77)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 1 | symbol , origin , old_strain_symbol |
| 2303154 | SS.SHR-(D9Wox16-D9Mco85)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 5 | symbol , origin , old_strain_symbol |
| 1579702 | SS.SHR-(D9Wox16-D9Rat64)/Mco | | Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. | | congenic | 4 | symbol , origin , old_strain_symbol |
| 2303148 | SS.SHR-(D9Wox16-D9Rat76)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 2 | symbol , origin , old_strain_symbol |
| 629482 | WKY.SHR-(D1Wox19-D1Mit2)/Njs | | Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY | | congenic | 7 | symbol , origin , old_strain_symbol |
| 150429602 | MWF.SHR-(D6Rat1-D6Rat106)/Rkb | | The congenic MWF.SHR-(D6Rat1-D6Rat106)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR ht:700;'>SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | | congenic | 1 | symbol , origin |
| 150429607 | MWF.SHR-(D6Rat1-D6Rat115)/Rkb | | The congenic MWF.SHR-(D6Rat1-D6Rat115)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR ht:700;'>SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | | congenic | 1 | symbol , origin , old_strain_symbol |
| 150429604 | MWF.SHR-(D6Rat1-D6Rat121)/Rkb | | The congenic MWF.SHR-(D6Rat1-D6Rat121)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR ht:700;'>SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | | congenic | 1 | symbol , origin |
| 150429608 | MWF.SHR-(D6Rat1-D6Rat184)/Rkb | | The congenic MWF.SHR-(D6Rat1-D6Rat184)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR ht:700;'>SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | | congenic | 1 | symbol , origin |
| 405849382 | SHR-Tti2em1Ipcv+/+ | | This is the wild type littermate of the Tti2 knockout rats. The knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first ex on using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and this wild type littermates were used as controls. | | mutant | 1 | symbol , origin |
| 405849381 | SHR-Tti2em1Ipcv+/- | | This Tti2 knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and phenotyping while their wild type littermates were used as controls. | | mutant | 1 | symbol , origin , old_strain_symbol |
| 7241271 | SHR.BN-(D10Mit4-D10Wox11)/Cub | | Segment of chromosome 10 from BN.Lx/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenic | | congenic | 2 | symbol , origin , old_strain_symbol |
| 11040455 | SHR.BN-(D16Rat88-D16Rat9)/Cub | | Segment of chromosome 16 from BN.Lx/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenic | | congenic | 1 | symbol , origin , old_strain_symbol |
| 2306892 | SHR.BN-(D2Rat114-D2Rat123)/Jk | | Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals | Genetica | congenic | 9 | symbol , origin , old_strain_symbol |
| 2306895 | SHR.BN-(D2Rat226-D2Rat294)/Jk | | Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals | Genetica | congenic | 11 | symbol , origin , old_strain_symbol |
| 634382 | SHR.BN-(D5Wox12-D5Wox20)/Ipcv | | This congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv background | | congenic | 5 | symbol , old_strain_name , origin , old_strain_symbol |
| 2316927 | SHR.BN-(D6Rat40-D6Rat170)/Mco | | 45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd | | congenic | 4 | symbol , origin , old_strain_symbol |
| 1559048 | SHR.ODS-Gulood/Shi | | A congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous rats were backcrossed to SHR span> to generate the congenics. Introduced to Nagoya University in 1995. | National BioResource Project for the Rat in Japan | congenic | 13 | symbol , origin , old_strain_symbol |
| 9854709 | SHR.WKY-(D12Rat1-D12Mit3)/Tja | | This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk | Rat Resource and Research Center | congenic | 1 | symbol , origin , old_strain_symbol |
| 629487 | SHR.WKY-(D1Wox19-D1Wox34)/Njs | | Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR | | congenic | 7 | symbol , origin , old_strain_symbol |
| 2306108 | SHR.WKY-(D3Mit9-D3Wox16)/Tkyo | | This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred ho mozygous in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2306100 | SHR.WKY-(D3Tkyo7-D3Rat1)/Tkyo | | This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred ho mozygous in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1579691 | SS.SHR-(D11Mgh3-D11Rat31)/Mco | | Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1579697 | SS.SHR-(D13Rat63-D13Mit1)/Mco | | Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. | | congenic | 5 | symbol , origin , old_strain_symbol |
| 150517549 | SS.SHR-(D2Rat46- D2Mco48)/Mco | | This SS congenic carries the chromosomal fragment from the spontaneously hypertensive rat (SHR). Recombinant Progeny Testing (RPT) was used to fine-map the proteinuria locus. The congenic was developed from the recombinant families by fixing the tran sferred genomic interval (D2Rat46- D2Mco48) in the homozygous SHR/SHR state | | congenic | 1 | symbol , origin , old_strain_symbol |
| 11354926 | SS.SHR-(D9Mco110-D9Got111)/Bj | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again t o duplicate the recombinant region. | | congenic | 5 | symbol , origin , old_strain_symbol |
| 11354928 | SS.SHR-(D9Mco110-D9Mco114)/Bj | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again t o duplicate the recombinant region. | | congenic | 1 | symbol , origin , old_strain_symbol |
| 11354903 | SS.SHR-(D9Mco110-D9Mco121)/Bj | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again t o duplicate the recombinant region. | | congenic | 5 | symbol , origin , old_strain_symbol |
| 11354901 | SS.SHR-(D9Mco110-D9Mco124)/Bj | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again t o duplicate the recombinant region. | | congenic | 7 | symbol , origin , old_strain_symbol |
| 11354924 | SS.SHR-(D9Mco113-D9Mco124)/Bj | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again t o duplicate the recombinant region. | | congenic | 12 | symbol , origin , old_strain_symbol |
| 11354930 | SS.SHR-(D9Mco115-D9Mco124)/Bj | | This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again t o duplicate the recombinant region. | | congenic | 1 | symbol , origin , old_strain_symbol |
| 6903925 | SS.SHR-(D9Mco72-D9Mco105)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 6 | symbol , origin , old_strain_symbol |
| 6903922 | SS.SHR-(D9Mco72-D9Mco106)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 4 | symbol , origin , old_strain_symbol |
| 6903917 | SS.SHR-(D9Mco72-D9Mco109)/Mco | | This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region | | congenic | 2 | symbol , origin , old_strain_symbol |
| 629504 | WKY.SHR-(D1Mit3-D1Rat57)/Iwai | | Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY | | congenic | 2 | symbol , origin , old_strain_symbol |
| 2300215 | SHR.BN-(D10Mgh3-D10Rat85)/Ipcv | | Congenic substrain derived from SHR.BN-(D10Mgh3-Srebf1)/Ipcv | | congenic | 3 | symbol , origin , old_strain_symbol , old_qtl_symbol |
| 629503 | SHR.BN-(D19Rat57-D19Mit7)/Ipcv | | The segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother an d sister mating. | | congenic | 8 | symbol , origin , old_strain_symbol |
| 631578 | SHR.BN-(D2Rat171-D2Arb24)/Ipcv | | This congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv background | | congenic | 8 | symbol , origin , old_strain_symbol |
| 2306033 | SHR.Cg-Leprcp/NDmcr | | Nonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1600338 | SHR.F344-(D12Mgh5-D12Mgh6)/Snk | | Segment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic technique | | congenic | 6 | symbol , origin , old_strain_symbol |
| 11528588 | SHR.LEW-(D4Rat76-D4Mgh11)/Anra | | This congenic strain contains a LEW chromosome 4 segment containing a QTL affecting anxiety-related response transferred to the SHR background. | | congenic | 5 | symbol , old_strain_name , origin , old_strain_symbol |
| 631589 | SHR.WKY-(D1Wox34-D1Rat164)/Njs | | Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR | | congenic | 4 | symbol , origin , old_strain_symbol |
| 9854707 | SHR.WKY-(D4Rat143-D4Rat10)/Tja | | This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk | Rat Resource and Research Center | congenic | 1 | symbol , origin , old_strain_symbol |
| 2306120 | SHR.WKY-(D4Wox27-D4Rat15)/Tkyo | | This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred ho mozygous in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 7411707 | SHRSP.SHR-(D1Mgh5-D1Got87)/Izm | | male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were th en backcrossed to SHRSP/Izm | National BioResource Project for the Rat in Japan | congenic | 3 | symbol , origin , old_strain_symbol |
| 7257722 | WKY.SHR-(D1Mgh14-D1Rat77)/Iwai | | Fragment of the chromosome 1 derived from SHR/NCrlj and repeated backcross to WKY/NCrlCrlj | | congenic | 1 | symbol , origin , old_strain_symbol |
| 7247594 | WKY.SHR-(D1Rat90-D1Mit18)/Iwai | | Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY | | congenic | 1 | symbol , origin , old_strain_symbol |
| 19259464 | SHR-Camk2n1em1Tja-/- | SHR-Camk2n1em1Tja-/Camk2n1em1Tja- | SHR-Camk2n1-/- knockout rats were generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1, into one-cell stage SHR/NC rl embryos that were implanted into pseudopregnant rats. Heterozygous progeny, from a founder harboring a 38bp deletion in Camk2n1, were intercrossed to generate homozygous knockout rats. | | mutant | 8 | symbol , origin , name |
| 11040525 | SHR-Ndufc2em1Mcwi+/+ | SHR-Ndufc2em1Mcwi+/Ndufc2em1Mcwi+ | ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | | mutant | 1 | symbol , origin , name , old_strain_symbol |
| 11040519 | SHR-Ndufc2em1Mcwi-/+ | SHR-Ndufc2em1Mcwi-/Ndufc2em1Mcwi+ | ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | | mutant | 1 | symbol , origin , name , old_strain_symbol |
| 11040527 | SHR-Ndufc2em2Mcwi+/+ | SHR-Ndufc2em2Mcwi+/Ndufc2em2Mcwi+ | ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | | mutant | 1 | symbol , origin , name , old_strain_symbol |
| 11040521 | SHR-Ndufc2em2Mcwi-/+ | SHR-Ndufc2em2Mcwi-/Ndufc2em2Mcwi+ | ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | | mutant | 5 | symbol , origin , name , old_strain_symbol |
| 126848794 | SHR-Zbtb16em1Ipcv+/- | | TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon. The founder was bred with SHR to generate more heterozygous animals. The homozygous animals die perinatally because of multiple developmental abnormalities. | | mutant | 11 | symbol , origin , old_strain_symbol |
| 2307087 | SHR.BN-(D18Rat32-D18Rat12)/Ipcv | | A segment of chr 18 from BN was introgressed into the SHR background | | congenic | 1 | symbol , origin , old_strain_symbol |
| 2312579 | SHR.BN-(D18Rat40-D18Rat82)/Ipcv | | F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity | | congenic | 6 | symbol , origin , old_strain_symbol |
| 2312577 | SHR.BN-(D18Rat99-D18Rat82)/Ipcv | | F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity | | congenic | 4 | symbol , origin , old_strain_symbol |
| 9854711 | SHR.WKY-(D16Rat88-D16Rat15)/Tja | | This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk | Rat Resource and Research Center | congenic | 1 | symbol , origin , old_strain_symbol |
| 1641850 | SHR.WKY-(D1Got158-D1Got161)/Njs | | This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1643002 | SHR.WKY-(D1Rat420-D1Got161)/Njs | | Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR | | congenic | 2 | symbol , origin , old_strain_symbol |
| 1641858 | SHR.WKY-(D1Rat420-D1Rat278)/Njs | | This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region | | congenic | 2 | symbol , origin , old_strain_symbol |
| 2306114 | SHR.WKY-(D3Mgh16-D3Rat110)/Tkyo | | This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred ho mozygous in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2306115 | SHR.WKY-(D3Mgh16-D3Rat166)/Tkyo | | This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred ho mozygous in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 329848962 | SHRSP.SHR-(D1Got82-D1Rat97)/Izm | | A subcongenic strain generated by backcrossing SHRSP.SHR-(D1Mgh5-D1Got87)/Izm (NBRP Rat No.0709, RGD:7411707) to SHRSP/Izm. A segment of the QTL region of chromosome 1 involved in salt-i nduced stroke (Niiya et al. Sci Rep. 2018; 8; 9403) has been exchanged. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin |
| 10043791 | SHRSP.SHR-(D1Mgh5-D1Rat213)/Izm | | male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were th en backcrossed to SHRSP/Izm | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 11565132 | SHRSP.SHR-(D1Rat95-D1Got87)/Izm | | A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin , old_strain_symbol |
| 150517550 | SS.SHR-(D2Rat127- D2Rat230)/Mco | | This SS congenic carries the chromosomal fragment from the spontaneously hypertensive rat (SHR). Recombinant Progeny Testing (RPT) was used to fine-map the proteinuria locus. The congenic was developed from the recombinant families by fixing the tran sferred genomic interval (D2Rat127- D2Rat230) in the homozygous SHR/SHR state | | congenic | 1 | symbol , origin , old_strain_symbol |
| 2312580 | SHR.BN-(D18Rat113-D18Rat82)/Ipcv | | SHR/OlaIpcv were crossed with BN/Crl, F1 animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv a nd segment of interest fixed by intercrossing heterozygotes | | congenic | 3 | symbol , origin , old_strain_symbol |
| 2305966 | SHR.SHRSP-(D1Rat93-D1Rat269)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , old_strain_symbol |
| 2306099 | SHR.WKY-(D15Tkyo3-D15Rat68)/Tkyo | | This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred ho mozygous in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2314243 | SHR.WKY-(D1Mgh2-D1Wox10)/IzmTkyo | | Developed by the depositor | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 4142549 | SHR.WKY-(D4Wox27-D4Rat4)/IzmTkyo | | This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 38599201 | SHRSP.SHR-(D18Rat73-D18Rat8)/Izm | | A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin |
| 7411709 | SHRSP.SHR-(D1Mit30-D1Rat269)/Izm | | male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then back crossed to SHRSP/Izm | National BioResource Project for the Rat in Japan | congenic | 3 | symbol , origin , old_strain_symbol |
| 11565130 | SHRSP.SHR-(D1Rat23-D1Rat213)/Izm | | A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin , old_strain_symbol |
| 2305973 | SHRSP.SHR-(D1Rat93-D1Rat269)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 3 | symbol , old_strain_symbol |
| 631591 | WKY.SHR-(D1Rat56-D1M7Mit206)/Njs | | Congenic substrain derived by backcrossing congenic strain WKY.SHR-(DWox19-D1Mit2) to WKY | | congenic | 4 | symbol , origin , old_strain_symbol |
| 2305967 | SHR.SHRSP-(D18Rat73-D18Rat11)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , old_strain_symbol |
| 2306118 | SHR.WKY-(D15Rat95-D15Rat106)/Tkyo | | This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred ho mozygous in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 4142540 | SHR.WKY-(D4Rat10-D4Rat15)/IzmTkyo | | This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 4142548 | SHR.WKY-(D4Wox27-D4Rat10)/IzmTkyo | | This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 4142547 | SHR.WKY-(D4Wox27-D4Rat11)/IzmTkyo | | This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2305971 | SHRSP.SHR-(D18Rat73-D18Rat11)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 3 | symbol , old_strain_symbol |
| 11565128 | SHRSP.SHR-(D18Rat73-D18Rat52)/Izm | | A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin , old_strain_symbol |
| 11565125 | SHRSP.SHR-(D18Rat87-D18Got66)/Izm | | A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin , old_strain_symbol |
| 631592 | WKY.SHR-(D1Rat236-D1M7Mit206)/Njs | | Congenic substrain derived by backcrossing congenic strain WKY.SHR-(D1Wox19-D1Mit2) to WKY | | congenic | 4 | symbol , origin , old_strain_symbol |
| 4142550 | SHR.WKY-(D4Rat101-D4Rat15)/IzmTkyo | | This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 4142545 | SHR.WKY-(D3Rat108-D3Rat166)/IzmTkyo | | This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 150429760 | SHRSP.SHR-(rs198233821-rs198932221)/Utx | | A congenic strain made by introducing IgH haplotype block (a segment of chr6:146,030,387 to 154,214,590 ,Rn5 assembly of the rat genome). from SHR-B2 (SHR/Utx) into SHR-A3 (SHR ='font-weight:700;'>SHRSP/BbbUtx). The igH block contains sequences that are highly divergent between of SHR-A3 and SHR-B2 . | | congenic | 2 | symbol , origin , old_strain_symbol |
| 6480205 | MWF-Chr 6SHR Chr 8SHR/Rkb | | Chr 8 and chr 6 were introgressed from albuminuria-resistant SHR/FubRkb into the sensitive isogenic background of MWF/FubRkb | | consomic | 1 | symbol , origin , old_strain_symbol |
| 150340617 | SHRSP.SHR-(rs197197017 -rs198445122)/Utx | | A congenic strain made by introducing B2 fragment (a segment of chromosome 1, 154.7 Mb - 203 Mb) from SHR/Utx into SHRSP/BbbUtx.The B2 fragment contains wild-type Stim1 as confirmed by sequencing. | | congenic | 12 | symbol , old_strain_name , origin , old_strain_symbol |
| 11565122 | SHR.Cg-Leprcp-Tg(APOB)110/Dmcr | | A BAC clone (CTD-2257F14) containing whole human APOB gene was maicroinjected into fertilized eggs of Wistar rats (Takeda Pharmaceutical Company). Then this Tg rats were backcrossed 9 times with SHR/NDmcr-cp rats (NBRP No.0446, SHR .Cg-Leprcp/NDmcr)(RGD: 2306033) | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1358989 | WKY.SHR-(D2Rat174-D2Rat28)(D2Rat161-D2Rat185) | | This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl | | congenic | 2 | symbol , origin , old_strain_symbol |
| 2316928 | SHR.BN-(D3Rat159-D3Rat1)(D6Rat40-D6Rat170)/Mco | | this double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allele | | congenic | 4 | symbol , origin , old_strain_symbol |
| 38599187 | SHRSP.SHR-(D1Mgh5-D1Got87)(D18Rat73-D18Rat11)/Izm | | A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University. | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin |
| 7411705 | SHR.SHRSP-(D1Rat93-D1Rat269)(D18Rat73-D18Rat11)/Izm | | constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments | National BioResource Project for the Rat in Japan | congenic | 2 | symbol , old_strain_symbol |
| 38599188 | SHRSP.SHR-(D1Rat23-D1Rat213)(D18Rat73-D18Rat11)/Izm | | A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University. | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin |
| 38599202 | SHRSP.SHR-(D1Rat23-D1Rat213)(D18Rat73-D18Rat52)/Izm | | A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin |
| 7411703 | SHRSP.SHR-(D1Rat93-D1Rat269)(D18Rat73-D18Rat11)/Izm | | constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 728147 | BN.PD-(D8Rat39-D8Rat35),SHR-(D4Mgh2-Cd36),SHR-(D20Wox3-D20Mgh5)/Cub | | This is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM. | | congenic | 7 | symbol , old_strain_symbol |
| 1581619 | BN.PD-(D8Rat39-D8Rat35),SHR-(D2Mit4-D2Rat28),SHR-(D2Rat103-D2Rat107)/Cub | | This triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-Lx. | | congenic | 10 | symbol , origin , old_strain_symbol |
| 61010 | SHRSP | Spontaneously Hypertensive Rat, Stroke Prone | The A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHR style='font-weight:700;'>SHRSP/A3N. Pathophysiology reviewed by Volpe and Rubattu (1994). | | inbred | 14 | symbol , origin |
| 61116 | SHRSP/A3 | | Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness. | | inbred | 21 | symbol , origin , old_strain_symbol |
| 1302606 | SHRSP/Ta | | This strain originated from Takeda Chemical Industries, Ltd., Japan | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , old_strain_symbol |
| 1302727 | SHRSR/Ta | | Strain is from Takeda Chemical Industries, Ltd., Osaka, Japan. | National BioResource Project for the Rat in Japan | inbred | 2 | symbol |
| 2304120 | SHRSP/2Ta | | Kyo > Ta (1972) | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , old_strain_symbol |
| 728184 | SHRSP/A3N | | To NIH in 1975 from Yamori at F36. SHR was isolated from Wistar Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesi ons. (517) | | inbred | 33 | symbol , origin |
| 1581618 | SHRSP/Bbb | | This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany. | | inbred | 21 | symbol , origin , old_strain_symbol |
| 1559047 | SHRSP/Ezo | | Substrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan | National BioResource Project for the Rat in Japan | inbred | 8 | symbol , origin |
| 2325209 | SHRSP/Hos | | Substrain of SHRSP purchased from Sankyo Lab Service, Japan. | | inbred | 1 | symbol , origin |
| 631599 | SHRSP/Izm | | Strain has been maintained at Kyoto University. | National BioResource Project for the Rat in Japan | inbred | 48 | symbol |
| 10044232 | SHRSP/Kpo | | Okamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 10039 | SHRSP/Riv | Spontaneously Hypertensive Rat, Stroke Prone | | | inbred | 1 | symbol |
| 2307168 | SHRSR/Bbb | Spontaneously Hypertensive Rat, Stroke Resistant | This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany. | | inbred | 3 | symbol , origin , old_strain_symbol |
| 10045578 | MSHRSP/Kpo | | Okamoto et al. found that a few rats developed higher blood pressure (over 230 mmHg) at 10 weeks old. They selected SHRSP rats that show severe hypertension from young age and M-SHRSP (malignant or precocious SHR nt-weight:700;'>SHRSP) rat was established in 1985. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 10045576 | SHRSP/2Kpo | | Okamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 734759 | SHRSP/Gcrc | Spontaneously hypertensive rat, stroke prone | SHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH | | inbred | 35 | symbol , origin , old_strain_symbol |
| 1559041 | SHRSP/Ngsk | | Substrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980. | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin |
| 737971 | SHRSP/Rivm | | unknown | | inbred | 1 | symbol |
| 2306103 | SHRSP/Sums | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | inbred | 1 | symbol |
| 1558660 | SHRSP/Tkyo | | Substrain of SHRSP rats maintained at International Medical Center of Japan, Tokyo | | inbred | 12 | symbol , origin |
| 2306051 | SHRSP/2Dmcr | | Developed by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 2306044 | SHRSP/3Dmcr | | Developed by the DEPOSITOR, this is one of the SHRSP substrains, A4 line | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 2306049 | SHRSP/4Dmcr | | Developed by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , old_strain_symbol |
| 2306050 | SHRSP/5Dmcr | | Developed by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis | National BioResource Project for the Rat in Japan | inbred | 1 | symbol , origin , alias , old_strain_symbol |
| 631691 | SHRSP/A3Izm | | Substrain originates from the SHRSP/Izm strain. | | inbred | 2 | symbol , origin |
| 2311051 | SHRSP/A3NCrl | Stroke Prone Rats | The Spontaneously Hypertensive Stroke Prone Rat (SHRSP) was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002. | Charles River Laboratories | inbred | 17 | symbol , origin |
| 8142383 | SHRSP/BbbUtx | | Animals transferred from Harvard University/Brigham (Dr Klaus Lindpaintner) originating from SHRSP colony at University of Heidelberg | | inbred | 20 | symbol , origin , old_strain_symbol |
| 155782877 | SHRSP/NgskMeltw | | Imported from Kyoto University in 2010, now maintained at Molecular Embryological & DNA Methylation Lab at National Chung Hsing University, Taiwan. | | inbred | 1 | symbol |
| 2302132 | SHRSP-Tg(Tagln-ACE2)6918Bdr | | Trangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryos | | transgenic | 2 | symbol , origin , old_strain_symbol |
| 10043620 | SHRSP.WKY-(D1Smu13)/Izm | | This congenic strain was made by introducing chromosome 1 region (D1Smu13) of WKY into SHRSP/Izm. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 631281 | WKY.SHRSP-(Fst-Pklr)/Gcrc | | Congenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. | | congenic | 3 | symbol , origin , old_strain_symbol |
| 737866 | WKY.SHRSP-(D2Rat14-D2Mit5) | | A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKY | | congenic | 2 | symbol , origin , old_strain_symbol |
| 631601 | WKY.SHRSP-(Asgr1-Vamp2)/Bbb | | Both the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aoki | | congenic | 9 | symbol , origin , old_strain_symbol |
| 737865 | WKY.SHRSP-(D2Rat14-D2Mgh12) | | A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY. | | congenic | 2 | symbol , origin , old_strain_symbol |
| 631693 | WKY.SHRSP-(Shbg-Atp1b2)/Bbb | | This strain has the blood pressure locus from chr 10 | | congenic | 1 | symbol , old_strain_symbol |
| 11553896 | SHRSP-Spp1em1Mcwi | | CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. | Contact MCW rat distribution at mcwcustomrats@mcw.edu | mutant | 1 | symbol , origin , old_strain_symbol |
| 13792813 | SHRSP-Spp1em2Mcwi | | CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene. | Contact MCW rat distribution at mcwcustomrats@mcw.edu | mutant | 1 | symbol , origin |
| 39128170 | SHRSP-Stim1em1Izm | | "This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHR yle='font-weight:700;'>SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence.
The sequence of the guide RNA target site is as follows,
Stim1: 5'-GCAGGGTAGCTGAAACACAC-3'
The sequence of the ssODN for homologous recombination is as follows,
5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'" | National BioResource Project for the Rat in Japan | mutant | 1 | symbol , origin , old_strain_symbol |
| 2307167 | SHRSP.SHRSR-(Klk1-D1Mit3)/Bbb | | SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest | | congenic | 5 | symbol , origin , old_strain_symbol |
| 2302110 | SHRSP.WKY-(Apbb1-D1Arb21)/Izm | | SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection | National BioResource Project for the Rat in Japan | congenic | 5 | symbol , origin , old_strain_symbol |
| 731189 | SHRSP.WKY-(Klk1-D1Rat116)/Izm | | A segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method. | | congenic | 10 | symbol , origin , old_strain_symbol |
| 2307160 | SHRSR.SHRSP-(Klk1-D1Mit3)/Bbb | | SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest | | congenic | 3 | symbol , origin , old_strain_symbol |
| 629495 | WKY.SHRSP-(Mt1pa-D1Rat57)/Bbb | | Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY | | congenic | 1 | symbol , origin , old_strain_symbol |
| 1302689 | WKY.SHRSP-(Ntrk3-D1Smu13)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 2 | symbol , origin , old_strain_symbol |
| 2307166 | SHRSP.SHRSR-(Klk1-Mt1-ps1)/Bbb | | SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest | | congenic | 4 | symbol , origin , old_strain_symbol |
| 2302109 | SHRSP.WKY-(D1Mgh5-D1Rat44)/Izm | | SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection | National BioResource Project for the Rat in Japan | congenic | 4 | symbol , origin , old_strain_symbol |
| 2305975 | SHRSP.WKY-(D1Mgh5-D1Wox18)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2302108 | SHRSP.WKY-(D1Mgh5-D1Wox29)/Izm | | SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection | National BioResource Project for the Rat in Japan | congenic | 4 | symbol , origin , old_strain_symbol |
| 2307159 | SHRSR.SHRSP-(Klk1-Mt1-ps1)/Bbb | | SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest | | congenic | 4 | symbol , origin , old_strain_symbol |
| 10043794 | WKY.SHRSP-(D1Mgh5-D1Arb21)/Izm | | A congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 631600 | WKY.SHRSP-(Mt1pa-D1Rat200)/Bbb | | Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY | | congenic | 6 | symbol , origin , old_strain_symbol |
| 2304102 | SHRSP.WKY-(D1Mgh5-D1Rat106)/Izm | | This is a congenic strain developed by the depositor. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2305969 | SHRSP.WKY-(D1Mgh5-D1Rat178)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304100 | SHRSP.WKY-(D1Rat39-D1Arb21)/Izm | | This is a congenic strain developed by the depositor. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304101 | SHRSP.WKY-(D1Rat43-D1Arb21)/Izm | | This is a congenic strain developed by the depositor. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2302106 | SHRSP.WKY-(D1Rat44-D1Arb21)/Izm | | SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection | National BioResource Project for the Rat in Japan | congenic | 3 | symbol , origin , old_strain_symbol |
| 2304099 | SHRSP.WKY-(D1Smu12-D1Arb21)/Izm | | This is a congenic strain developed by the depositor. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304094 | SHRSP.WKY-(D1Smu12-D1Rat44)/Izm | | This is a congenic strain developed by the depositor. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304098 | SHRSP.WKY-(D1Smu13-D1Arb21)/Izm | | Developed by the depositor | National BioResource Project for the Rat in Japan | congenic | 3 | symbol , old_strain_symbol |
| 4889411 | SHRSP.WKY-(D1Smu13-D1Wox33)/Izm | | About 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(D1Smu13-D1Arb21)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which we re then mated brother-sister to get the desired congenic strain | National BioResource Project for the Rat in Japan | congenic | 5 | symbol , origin , old_strain_symbol |
| 2305968 | SHRSP.WKY-(D1Wox18-D1Rat39)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 1600343 | SHRSP.WKY-(D1Wox29-D1Arb21)/Izm | | This congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy | National BioResource Project for the Rat in Japan | congenic | 14 | symbol , origin , old_strain_symbol |
| 631279 | SHRSP.WKY-(D2Rat13-D2Mit5)/Gcrc | | Congenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. | | congenic | 8 | symbol , origin , old_strain_symbol |
| 737862 | SHRSP.WKY-(D2Rat14-D2Mit5)/Gcrc | | A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. | | congenic | 3 | symbol , origin , old_strain_symbol |
| 737863 | SHRSP.WKY-(D2Wox9-D2Mgh12)/Gcrc | | A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP | | congenic | 8 | symbol , origin , old_strain_symbol |
| 13432201 | SHRSP.WKY-(D3Mgh16-D3Wox3)/Gcrc | | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X s ister mating was carried out to generate sub-strains containing smaller congenic intervals. | | congenic | 6 | symbol , origin , old_strain_symbol |
| 2305939 | SHRSP.WKY-(D9Mit6-D9Rat83)/Tkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2290275 | SHRSP.WKY-(D3Tkyo7-D3Rat1)/Tkyo | | The desired fragment is transferred from WKY to SHRSP | National Bio Resource Project Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 11565135 | WKY.SHRSP-(D1Rat25-St8sia2)/Izm | | A congenic strain established by introducing segments of chromosome 1 from SHRSP/Izm into WKY/Izm. | National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. | congenic | 1 | symbol , origin , old_strain_symbol |
| 1302632 | WKY.SHRSP-(D1Smu11-D1Arb21)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1302675 | WKY.SHRSP-(D1Smu13-D1Smu11)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 2 | symbol , origin , old_strain_symbol |
| 1302692 | WKY.SHRSP-(D1Wox18-D1Rat44)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1302715 | WKY.SHRSP-(D1Wox18-D1Wox29)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1302636 | WKY.SHRSP-(D1Wox29-D1Arb21)/Izm | | This congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background | National BioResource Project for the Rat in Japan | congenic | 30 | symbol , origin , old_strain_symbol |
| 1302705 | WKY.SHRSP-(D1Wox29-D1Smu13)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 631280 | WKY.SHRSP-(D2Mit5-D2Mgh12)/Gcrc | | Congenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. | | congenic | 8 | symbol , origin , old_strain_symbol |
| 10043811 | SHRSP.MES-CybaMES/Izm | | A congenic strain made by introducing a genetic locus of Cyba from Matsumoto Eosinophilic Shinshu (MES/Slc) rat into SHRSP/Izm rat. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2304093 | SHRSP.WKY-(D1Rat106-D1Arb21)/Izm | | Developed by the depositor | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 8552271 | SHRSP.WKY-(D1Rat27-D1Wox18)/Tkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304096 | SHRSP.WKY-(D1Rat49-D1Arb21)/1Izm | | Developed by the depositor | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304097 | SHRSP.WKY-(D1Rat49-D1Arb21)/2Izm | | This is a congenic strain developed by the depositor. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2301367 | SHRSP.WKY-(D2Mit5-D2Rat133)/Gcrc | | Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment | | congenic | 2 | symbol , origin , old_strain_symbol |
| 731191 | SHRSP.WKY-(D2Rat14-D2Mgh12)/Gcrc | | A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. | | congenic | 4 | symbol , origin , old_strain_symbol |
| 2301370 | SHRSP.WKY-(D2Wox9-D2Rat231)/Gcrc | | Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment | | congenic | 4 | symbol , origin , old_strain_symbol |
| 13432204 | SHRSP.WKY-(D3Mgh16-D3Mit10)/Gcrc | | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X s ister mating was carried out to generate sub-strains containing smaller congenic intervals. | | congenic | 1 | symbol , origin , old_strain_symbol |
| 13432200 | SHRSP.WKY-(D3Mgh16-D3Rat80)/Gcrc | | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X s ister mating was carried out to generate sub-strains containing smaller congenic intervals. | | congenic | 5 | symbol , origin , old_strain_symbol |
| 2290276 | SHRSP.WKY-(D3Mgh16-D3Mgh15)/Tkyo | | This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygo us in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , alias , old_strain_symbol |
| 2290281 | SHRSP.WKY-(D3Rat227-D3Rat1)/Tkyo | | This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygo us in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 728166 | WKY.SHRSP-(D1Rat112-D1Wox29)/Izm | | A segment from SHRSP/Izm was transferred on a WKY/Izm background | | congenic | 1 | symbol , origin , old_strain_symbol |
| 4889414 | WKY.SHRSP-(D1Rat171-D1Wox33)/Izm | | About 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(D1Smu13-D1Smu11)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which we re then mated brother-sister to get the desired congenic strain | National BioResource Project for the Rat in Japan | congenic | 7 | symbol , origin , old_strain_symbol |
| 1302629 | WKY.SHRSP-(D1Rat49-D1Rat112)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1302681 | WKY.SHRSP-(D1Smu11-D1Rat112)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1302703 | WKY.SHRSP-(D1Wox29-D1Rat112)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 1302704 | WKY.SHRSP-(D1Wox29-D1Rat199)/Izm | | The desired fragment is transferred from SHRSP to WKY. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2304315 | SHRSP.WKY-(Calca-D1Arb21)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 8552267 | SHRSP.WKY-(D1Rat116-D1Wox10)/Tkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 8552273 | SHRSP.WKY-(D1Tkyo57-D1Wox18)/Tkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 8552269 | SHRSP.WKY-(D1Tkyo58-D1Rat90)/Tkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2301371 | SHRSP.WKY-(D2Mit21-D2Rat157)/Gcrc | | Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment | | congenic | 6 | symbol , origin , old_strain_symbol |
| 631278 | SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc | | Congenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background. | | congenic | 15 | symbol , origin , old_strain_symbol |
| 2301369 | SHRSP.WKY-(D2Rat132-D2Rat53)/Gcrc | | Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment | | congenic | 2 | symbol , origin , old_strain_symbol |
| 2301368 | SHRSP.WKY-(D2Wox15-D2Rat133)/Gcrc | | Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment | | congenic | 2 | symbol , origin , old_strain_symbol |
| 7411676 | SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc | | Congenic strain created by speed congenic strategy where the desired region from Chromosome 3 of WKY/Gcrc was introgressed into the SHRSP/Gcrc background. | | congenic | 11 | symbol , origin , old_strain_symbol |
| 13432199 | SHRSP.WKY-(D3Wox20-D3Rat114)/Gcrc | | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X s ister mating was carried out to generate sub-strains containing smaller congenic intervals. | | congenic | 2 | symbol , origin , old_strain_symbol |
| 2304295 | SHRSP.WKY-(Igf1r-D1Rat36)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2290274 | SHRSP.WKY-(D15Rat2-D15Rat94)/Tkyo | | This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygo us in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2290280 | SHRSP.WKY-(D3Mgh16-D3Rat110)/Tkyo | | The desired fragment is transferred from WKY to SHRSP | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 631694 | WKY.SHRSP-(D1Rat200-D1Rat216)/Bbb | | This single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY b ackground while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(D1Rat200-D1Rat216) | | congenic | 3 | symbol , origin , old_strain_symbol |
| 2307169 | SHRSP.SHRSR-(D1Rat134-Mt1-ps1)/Bbb | | SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest | | congenic | 4 | symbol , origin , old_strain_symbol |
| 2304283 | SHRSP.WKY-(D1Mgh5-D1Wox18)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2290277 | SHRSP.WKY-(D3Rat227-D3Rat166)/Tkyo | | The desired fragment is transferred from WKY to SHRSP | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2300018 | SHRSP.ZUC-(D5Rat4-D5Rat36)/IzmDmcr | | Selective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/Izm | National BioResource Project for the Rat in Japan | congenic | 18 | symbol , origin , old_strain_symbol |
| 2307161 | SHRSR.SHRSP-(D1Rat134-Mt1-ps1)/Bbb | | SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest | | congenic | 4 | symbol , origin , old_strain_symbol |
| 2304309 | SHRSP.WKY-(D1Mgh5-D1Rat106)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304284 | SHRSP.WKY-(D1Mgh5-D1Rat116)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304313 | SHRSP.WKY-(D1Mgh5-D1Rat178)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304289 | SHRSP.WKY-(D1Mgh5-D1Rat349)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304302 | SHRSP.WKY-(D1Rat44-D1Arb21)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 4140406 | SHRSP.WKY-(D1Wox29-D1Arb21)/IzmDmcr | | To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover th e QTL region between D1Wox29 and D1Arb21. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 13432202 | SHRSP.WKY-(D3Mgh16-rs65433898)/Gcrc | | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X s ister mating was carried out to generate sub-strains containing smaller congenic intervals. | | congenic | 6 | symbol , origin , old_strain_symbol |
| 2290279 | SHRSP.WKY-(D15Rat68-D15Rat106)/Tkyo | | This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygo us in 2005. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 4140414 | WKY.SHRSP-(D1Wox29-D1Arb21)/IzmDmcr | | To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover th e QTL region between D1Wox29 and D1Arb21. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2314246 | SHRSP.WKY-(D1Rat117-D1Rat90)/IzmTkyo | | Developed by the Depositor | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304304 | SHRSP.WKY-(D1Rat209-D1Arb21)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2304277 | SHRSP.WKY-(D1Rat36-D1Rat106)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 13432203 | SHRSP.WKY-(D3Mgh16-rs197649383)/Gcrc | | Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X s ister mating was carried out to generate sub-strains containing smaller congenic intervals. | | congenic | 3 | symbol , origin , old_strain_symbol |
| 2304301 | SHRSP.WKY-(Slco3a1-D1Rat106)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2311049 | SHROB/KolGmiCrl-Leprcp/Crl | | This mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001. | Charles River Laboratories | coisogenic | 1 | symbol , old_strain_symbol |
| 2305948 | SHRSP.WKY-(D8Rat77-D8Rat16)(D8Tkyo10)/Tkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2290273 | SHRSP.WKY-(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)/IzmTkyo | | The desired fragment is transferred from WKY to SHRSP | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2305979 | WKY.SHRSP-(D1Wox29-D1Arb21)(Bcl2-D13Mgh7)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 2290282 | SHRSP.WKY-(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)/IzmTkyo | | The desired fragment is transferred from WKY to SHRSP | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 10043808 | WKY.SHRSP-(D1Mgh5-D1Arb21)(D4Mgh7-D4Rat68)/Izm | | A congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 728139 | WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2)/Bbb | | This double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHR >SHRSP-(Shbg-Atp1b2) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(Shbg-Atp1b2) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLs | | congenic | 5 | symbol , origin , old_strain_symbol |
| 2305974 | WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 11040952 | WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Mgh16-D3Rat144)/Izm | | A congenic strain made by introducing a segments of chromosome 1 and 3 from SHRSP/Izm into WKY/Izm. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 2304312 | SHRSP.WKY-(D1Mgh5-D1Rat36)(D1Rat44-D1Arb21)/IzmTkyo | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 7411679 | SHRSP.WKY-(D2Rat13-D2Rat157)(D3Mgh16-D3Rat114)/Gcrc | | F1 rats generated by crossing SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc and SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc were backcrossed to SHRSP.WKY-(D2Rat13-D2Rat157)/Gcr c; heterozygous animals for chr 3 fragment were crossed with homozygous animals for chr 2; animals that were homozygous for both fragments were intercrossed to get the desired bicongenic strain | | congenic | 5 | symbol , origin , old_strain_symbol |
| 2305972 | WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)(Bcl2-D13Mgh7)/Izm | | Developed by the DEPOSITOR | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , old_strain_symbol |
| 12879428 | WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Rat36-D3Rat144)(D4Mgh7-D4Rat68)/Izm | | A double congenic strain bade by introducing segments of chromosome 1, 3, and 4 from SHRSP/Izm into WKY/Izm. This strain was established by mating between WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Mgh16-D3Rat144)/Izm(NBRP Rat No:0713)and WKY.SHRSP-(D1Mgh5-D1Arb21) (D4Mgh7-D4Rat68)/IzmCNBRP Rat No:0714). This strain was established and is maintained in Shimane University. | National BioResource Project for the Rat in Japan | congenic | 1 | symbol , origin , old_strain_symbol |
| 7771610 | SHRSP-Chr 1F344/Rkb | | SHRSP/Bbb male was crossed with female F344/Crl to get F1 animals which in turn were backcrossed with female SHRSP, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing | | consomic | 8 | symbol , origin , old_strain_symbol |
| 2305949 | SHRSP-Chr 1WKY/Tkyo | | Chromosome 1 from WKY is introgressed into the genomic background of SHRSP | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2303785 | SHRSP-Chr 3WKY/Tkyo | | Chromosome 3 from WKY is introgressed into the genomic background of SHRSP | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2305944 | SHRSP-Chr 4WKY/Tkyo | | Chromosome 4 from WKY is introgressed into the genomic background of SHRSP | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2305940 | SHRSP-Chr 7WKY/Tkyo | | Chromosome 7 from WKY is introgressed into the genomic background of SHRSP | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2305945 | SHRSP-Chr 13WKY/Tkyo | | Chromosome 13 from WKY is introgressed into the genomic background of SHRSP | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 2305943 | SHRSP-Chr 15WKY/Tkyo | | Chromosome 15 from WKY is introgressed into the genomic background of SHRSP | National BioResource Project for the Rat in Japan | consomic | 1 | symbol , origin , old_strain_symbol |
| 70451 | OKA | | From faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 da ys. | | inbred | 1 | origin |
| 7245556 | WKHT/Edh | | WKHT rats are derived from a cross between SHR and WKY. Brother/sister inbreeding of the hybrids and successive generations was performed, selecting for the hypertension, but not the behavioral hyperactivity, of the SHR. | Rat Resource and Research Center | inbred | 8 | origin |
| 70454 | WKY/N | | National Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (19 92) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain. | NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center | inbred | 10 | origin |
| 2313735 | SD-Tg(H1/tetO-RNAi:Insr)14Bdr | | Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter | | transgenic | 4 | origin , old_strain_symbol |
| 2313734 | SD-Tg(H1/tetO-RNAi:Insr)29Bdr | | Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter | | transgenic | 9 | origin , old_strain_symbol |
| 61098 | BXH/Ipcv | | These recombinant inbred strains are derived from the (BN-Lx/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republic | | recombinant_inbred | 11 | old_strain_name , origin |
| 68049 | HXB-1-43/Ipcv | | Set of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs. | | recombinant_inbred | 3 | old_strain_name , origin |
| 2307124 | BXH10/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307127 | BXH11/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307139 | BXH12/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307123 | BXH13/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307121 | BXH2/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 8 | origin |
| 2307134 | BXH3/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307115 | BXH5/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307136 | BXH6/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307126 | BXH8/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307129 | BXH9/Cub | | Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | | recombinant_inbred | 1 | origin |
| 2307094 | HXB1/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307083 | HXB10/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307091 | HXB13/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307092 | HXB14/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307095 | HXB15/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307085 | HXB17/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307082 | HXB18/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307096 | HXB2/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307080 | HXB20/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307097 | HXB21/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307088 | HXB22/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307093 | HXB23/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307084 | HXB24/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307098 | HXB25/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307078 | HXB27/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307089 | HXB29/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307079 | HXB3/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307081 | HXB31/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307077 | HXB4/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307099 | HXB5/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 2307086 | HXB7/Ipcv | | Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | | recombinant_inbred | 1 | origin |
| 4142546 | AMI/Tj | | Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
| 401827899 | BXH13/CubMcwi | | This recombinant inbred was originally derived from founder strains BN-Lx/Cub and SHR/OlaIpcv at Charles University, Department of Biology, Prague, Czech Republic. This substrain was maintained at the Medical College of Wisconsin. | RGD HRDP, contact HRDP | recombinant_inbred | 1 | origin |
| 149735530 | BXH2/CubMcwi | | These are re-derived rats of BXH2/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv | RGD HRDP, contact HRDP | recombinant_inbred | 1 | origin |
| 149735533 | BXH3/CubMcwi | | These are re-derived rats of BXH3/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv. | RGD HRDP, contact HRDP | recombinant_inbred | 1 | origin |
| 629499 | BXS/Ipcv | | These recombinant inbred strains are obtained by crossing normotensive BN-Lx/Cub with hypertensive SHR/Ola progenitor strains. | | recombinant_inbred | 2 | origin |
| 155663365 | CD-Tg(RNECO-180E22)208Arno | | This transgenic model line 208 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. | | transgenic | 1 | origin |
| 155663366 | CD-Tg(RNECO-180E22)424Arno | | This transgenic model line 424 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. | | transgenic | 1 | origin |
| 155663367 | CD-Tg(RNECO-180E22)733Arno | | This transgenic model line 733 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. | | transgenic | 1 | origin |
| 155663368 | CD-Tg(RNECO-180E22)737Arno | | This transgenic model line 737 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. | | transgenic | 1 | origin |
| 68019 | CRDH | Cohen Rosenthal Diabetic Hypertensive | As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x si ster mated (Cohen et al, 1993, Rosenthal et al 1995). | | inbred | 19 | origin |
| 61099 | HXB/Ipcv | | Derived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published. | | recombinant_inbred | 9 | origin |
| 149735520 | HXB2/IpcvMcwi | | These are re-derived rats of HXB2/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub. | RGD HRDP, contact HRDP | recombinant_inbred | 1 | origin |
| 149735521 | HXB20/IpcvMcwi | | These are re-derived rats of HXB20/Ipcv now maintained at Medical College of Wisconsin. The parent strain wasDerived from founder strains SHR/OlaIpcv and BN-Lx/Cub | RGD HRDP, contact HRDP | recombinant_inbred | 1 | origin |
| 149735519 | HXB31/IpcvMcwi | | These are re-derived rats of HXB31/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | RGD HRDP, contact HRDP | recombinant_inbred | 1 | origin |
| 149735518 | HXB4/IpcvMcwi | | These are re-derived rats of HXB4/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub | RGD HRDP, contact HRDP | recombinant_inbred | 1 | origin |
| 2307138 | PXO1/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307132 | PXO10/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307356 | PXO2/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307355 | PXO3-1/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307116 | PXO3-2/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307135 | PXO4/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307128 | PXO5-1/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307117 | PXO5-2/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307137 | PXO6-1/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307125 | PXO6-2/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307130 | PXO6-3/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307119 | PXO7-1/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307120 | PXO7-2/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307122 | PXO8-1/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307131 | PXO8-2/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 2307118 | PXO9/Cub | | Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. | | recombinant_inbred | 1 | origin |
| 11564350 | SCR/Sscr | Shumiya Cataract Rat | Genetic Cataract rat SCR（Shumiya Cataract Rat）was segrigated from a SHR-fa strain colony that developed nuclear cataract at adult stage. This strain is a double mutant caused by recessive gene (ctr1) and dominant lethal gene (Ctr2l) and established by Dr. Shumiya at Tokyo Metropolitan Institute of Gerontology. In 2003, this strain was introduced to Kyoritsu College of Pharmacy (keio University Faculty of Pharmacy). ctr1 is lanosterol synthase (Lss) and Ctr2 is farnesyl diphosphate farnesyl transferase 1 (Fdft1). | | congenic | 5 | origin |
| 68137 | SHHF | | JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusi on with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile. | | inbred | 24 | origin |
| 2313221 | SHHF-Leprcp/Crl | | Developed by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001. | Charles River Laboratories | congenic | 1 | origin |
| 401901201 | SHHFcp/+/Mcc | | The lean SHHFcp/+ is heterozygous for the corpulent allele and is the control model for the obese SHHFcp/cp. The Breeding stock for this colony was transferred to Dr. Sylvia McCune at the University of Chicago Medical School in 1983 from the laboratory of J.E. Miller at G.D. Searle and Company. The animals were developed by backcrossing the SHROB rat to the SHR/N rat. Dr. McCune obtained the colony after the seventh backcross and continued to inbreed past 20 generations to fix the congestive heart failure trait. | | inbred | 8 | origin |
| 401901199 | SHHFcp/+/MccGmiCrl | | The lean SHHFcp/+ is heterozygous for the corpulent allele and is the control model for the obese SHHFcp/cp. The Breeding stock for this colony was transferred to Dr. Sylvia McCune at the University of Chicago Medical School in 1983 from the laboratory of J.E. Miller at G.D. Searle and Company. The animals were developed by backcrossing the SHROB rat to the SHR/N rat. Dr. McCune obtained the colony after the seventh backcross and continued to inbreed past 20 generations to fix the congestive heart failure trait. To Genetic Models, Inc. in 1994. To Charles River in 2001. | Charles River Laboratories | inbred | 12 | origin |
| 401901202 | SHHFcp/cp/Mcc | | The obese SHHFcp/cp are homozygous for the corpulent allele. The Breeding stock for this colony was transferred to Dr. Sylvia McCune at the University of Chicago Medical School in 1983 from the laboratory of J.E. Miller at G.D. Searle and Company. The animals were developed by backcrossing the ... (more) n style='font-weight:700;'>SHROB rat to the SHR/N rat. Dr. McCune obtained the colony after the seventh backcross and continued to inbreed past 20 generations to fix the congestive heart failure trait. | | inbred | 1 | origin |
| 401901198 | SHHFcp/cp/MccGmiCrl | | The obese SHHFcp/cp are homozygous for the corpulent allele. The Breeding stock for this colony was transferred to Dr. Sylvia McCune at the University of Chicago Medical School in 1983 from the laboratory of J.E. Miller at G.D. Searle and Company. The animals were developed by backcrossing the ... (more) n style='font-weight:700;'>SHROB rat to the SHR/N rat. Dr. McCune obtained the colony after the seventh backcross and continued to inbreed past 20 generations to fix the congestive heart failure trait. To Genetic Models, Inc. in 1994. To Charles River in 2001. | Charles River Laboratories | inbred | 19 | origin |
| 69369 | SS | | From a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of th e strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in identifying the loci responsible for salt-induced hypertension. | | inbred | 3 | origin |
| 7245527 | WKHA/Edh | | derived from a cross between SHR/N and WKY/N starting in 1980; followed by selected brother/sister inbreedings from F2 generation forward, selecting WKHA for highest activity and lowest blood pressure | Rat Resource and Research Center | inbred | 9 | origin |
| 68186 | WKHA/N | | From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure. | | inbred | 3 | origin |
| 68187 | WKHT/N | | From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992). | | inbred | 1 | origin |
| 61119 | WKY/NCrlCrlj | | Originated from outbred Wistar of Kyoto University. To NIH from Kyoto University in 1971 and sib mating has started. To Charles River Laboratories, Inc from NIH in 1974 at F11, and to Charles River Japan, Inc. in 1981 at F25. (May 27, 2010). Used as control strain for the SHR 0;'>SHR strain. | Charles River Laboratories Japan, National BioResource Project for the Rat in Japan | inbred | 6 | origin |
| 1581622 | SD-Tg(Ubc-eGFP-RNAi:Dazl)17-9GarRrrc | | This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) | Rat Resource and Research Center | transgenic | 3 | old_strain_name , origin , old_strain_symbol |
| 1581617 | SD-Tg(Ubc-eGFP-RNAi:Dazl)16-13Gar | | This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) | | transgenic | 1 | origin , old_strain_symbol |
| 2314415 | LEW-Tg(H1/tetO-RNAi:Insr)4Hrjb | | LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter | | transgenic | 6 | origin |
| 2314414 | LEW-Tg(H1/tetO-RNAi:Insr)87Hrjb | | LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter | | transgenic | 2 | origin |
