Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SHR-Ndufc2em2Mcwi

Symbol: SHR-Ndufc2em2Mcwi
Strain: SHR-Ndufc2em2
Substrain: Mcwi
RGD ID: 9588546
Citation ID: RRID:RGD_9588546
Ontology ID: RS:0003827
Alleles: Ndufc2em2Mcwi
Also Known As: SHR-Ndufc2em2Mcwi; SHR-Ndufc2^[em2Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21151,712,052 - 151,712,162RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01162,369,801 - 162,376,024RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01168,576,274 - 168,582,497RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41154,635,889 - 154,642,112RGD_MAPPER_PIPELINERGSC3.4





Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines
4. Ndufc2 Gene Inhibition Is Associated With Mitochondrial Dysfunction and Increased Stroke Susceptibility in an Animal Model of Complex Human Disease. Rubattu S, etal., J Am Heart Assoc. 2016 Feb 17;5(2). pii: e002701. doi: 10.1161/JAHA.115.002701.
5. Introgressed chromosome 2 quantitative trait loci restores aldosterone regulation and reduces response to salt in the stroke-prone spontaneously hypertensive rat. Sampson AK, etal., J Hypertens. 2014 Oct;32(10):2013-21; discussion 2021. doi: 10.1097/HJH.0000000000000300.

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ndufc2em2Mcwi-var1 chr1 151712052 151712162 CCGGGCCATGAGCCCTTAAGATTCTTGCCGGATGAGGCCCGGAGACTGCCCCCGCCCAAGCTGAACGACCCGCGGCTTGTCTACATCGGCTTCCTGGGCTACTGCACGGGC TTGT delins mRatBN7.2

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-11-03 SHR-Ndufc2em2Mcwi    SHR-Ndufc2em2Mcwi    Name updated 68913 APPROVED
2014-11-03 SHR-Ndufc2em2Mcwi    SHR-Ndufc2em2Mcwi    Name updated 68913 APPROVED