Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SHR.PD-(D8Rat42-D8Arb23)/Cub

Symbol: SHR.PD-(D8Rat42-D8Arb23)/Cub
Strain: SHR.PD-(D8Rat42-D8Arb23)
Substrain: Cub
RGD ID: 1641851
RRID: RGD_1641851
Ontology ID: RS:0001423
Alleles: Zbtb16Lx;   Zbtb16
Also known as: PD5; SHR.PD-(D8Rat42-D8Arb23)/Cub; SHR-Lx PD5; SHR-Lx PD5
Type: congenic
Source: Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic
Origin: A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-Lx strain
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2848,432,652 - 49,868,959RGD_MAPPER_PIPELINE
Rnor_6.0852,446,316 - 53,840,120RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0851,046,971 - 52,459,221RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4851,376,771 - 52,822,796RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

References


Region

Position Markers

Flank 1 / 1 (D8Rat42)
Rat AssemblyChrPosition (strand)Source
mRatBN7.2848,432,652 - 48,432,767 (+)MAPPER
Rnor_6.0852,446,316 - 52,446,430NCBI
Rnor_5.0851,046,971 - 51,047,085UniSTS
RGSC_v3.4851,376,772 - 51,376,886UniSTS
RGSC_v3.4851,376,771 - 51,376,886RGD
RGSC_v3.1851,395,826 - 51,395,940RGD
Celera847,993,823 - 47,993,937UniSTS
RH 3.4 Map8502.0RGD
RH 3.4 Map8502.0UniSTS
RH 2.0 Map8371.1RGD
SHRSP x BN Map836.87RGD
FHH x ACI Map843.5799RGD
Cytogenetic Map8q23UniSTS

Flank 2 / 1 (D8Arb23)
Rat AssemblyChrPosition (strand)Source
mRatBN7.2849,868,652 - 49,868,959 (+)MAPPER
Rnor_6.0853,839,814 - 53,840,120NCBI
Rnor_5.0852,458,915 - 52,459,221UniSTS
RGSC_v3.4852,822,490 - 52,822,796UniSTS
RGSC_v3.1852,841,543 - 52,841,850RGD
Celera849,420,246 - 49,420,552UniSTS
Cytogenetic Map8q23UniSTS
Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Zbtb16Lx-var1 chr8 53132882 53135845 CCTGGGCCAGTGAGCACCTGCACTGGGCTATGTGTCTGTTGTTTGCTCCATGATCCCACTGACCAGATACCACCATGCCAAGAGGCACGCTCCTAATTTCCTCCTGCTGACCCAGATGCATCTGGCTGGGAACCCTGCCCTGTCCACACAGCTTCTACAAGAGCCCATCTTTGTTTCCAGACACCATGTTCTCTCCACTCACCACTCACTATGCAGCCAACCATTGTAGGAAATCTAGGGGGAAAAGGACGGAACAGGGAGAGACAGAGACAGACAGACAAAGACCCTAAAACACTCCTCTCATTGATAAAAACACTCCTCCCATCCACAGCCCACCGATATGCCATATGTCTTCTTTCCCAACTACACACAGGTGCACACACACAGAAGTGCACACTCACAGCCATGCACTCACACATGCACACAGGTGCACAAACATACACGTGCGCACACACACACAGAACATGCATGCACCCACATACAAGGGCTCACACATGCCTGGGTATGCATCCTGGGTCTTATTATTGCATAGCCCTCCAGGCTCAGAAAGAGTTAAGTTACCCTCAGTGCATAAATCAAAAGTTCAAGGCTGCACCACACCACAATGATCTCCTCTTTACATATGACGAGAACCAGAGAGAGGCTACAGTCCCAAGCATCCTGAGTGGGTCTCCCAGGCCCGCACAGGTTACACCGCCGGGGTCAGGGTGGAGGACCTTTAGCAGCAACATTCATTTCCTGAACAGGACAAGCCCTCCTGACCATAAAGCTAATAAGAACTTCCTCGCACGGCCGAGCTCCGGCTGACAGGGCGACTTGTCACCGGTCACGCAGGAGGAAAACGCTGGTTCCCATTAGAGGCTTATGATGCCAGGTGCTCCTAATAAGGCACCTCAGCGAGAAACAAGAGCCTGCTAAGTCCTGGCTCCAACTCTGGAAGTAATCAGGCCCGGGCTTCGGGGATTAAGGAGGGGCCTTCCTTGAAGAAATGGGGGAGGGGGTGGCCTCCGTAGACCCCTGGCAGCCGCTAACCTGCTGAATGACTTAAATAAATAAATTCCCAACCATCCTTCCATTTCTTTCCCAGTCACCATAAAAGACTCCCCCAAATTAACACTAGTAATGCTTCCCCTCCGTACTCTGGGCTTGATGGATTGCCCAGAGGGCCATTACGTTAGGGCCAGATCTGCTTCCCATGGTGGCAAGGAGGGTCGTGCCAACAGTCCTAATGGCACTGAGATCACAACCCTCAGCTAATCCACTTAGCCCAGAAGAGGATGACAAGGGGCTCAGTGGCTCTCCTATCAGGCTGGGGTCACAAGGGAAGTGGAAGGTACATAGGCTACTCCCGACTCCATGCCTGCTGCTACCAGTTAACTCACTCTTTGCTTCTGCATATTACCGCCCCGTCCTGTGTAAAGACCACAGTTTGATGGAGGGTGGGTCTTATTTTTAGCAGGTCCGATGGATGTGCTGCATATCTTTACCGAGACTGGGGACTCCTATGGGCTGAAAAGAACTTAAGACAGGACTAGAGTTTTTACCTCTTCACCAAAATATCGGAAACCAGGTCTTTTAGAAATCCCCCCAGCAGTGCCCTGCTGTTTCAGGAAGTCCTTCCTCTTACCTAACTTGGATGCTTCCTCTGGTAATGCTCAACTCAATCTGTGCACATTGTAGACACTCGGGCCTCAGGGTCAGAGTGGAACGTGAGTTCAGAACTGAGATTCAAACAGGATTTGGGGGAGTTTTAGCCGAAGTTTCCATGCTGACAAGAAAGGGCCAGAGCCCCTCCCCACAGCTGCAGAGTTAAGCTTCGCATAGGCAAAACCCAAGCATAGCTGTTTTCAGACTGAGCCAGCATCATAAGAACACAGGGGCTTTTAAGGGGAAACAGTAAAAGGGGGGGATTTCTGATTCTACTGGCGTGGAATTAACAATGCGGAATTTTTATTTTCGAAAATGGGTTTCTTTTCCCCTCCCTGTTCTGGTTTTTCTGTTTTTCTAGTCAGCATAAATAAAAAGCTAGAGGCCAGTCGCTCTGTCCATAAGCCGTGACTCGGGGCTTCCTGGATCTGTGTGGTCTGGCCCCCTGAACACCTGTTGACTACTGCATTTGCAGGTGACTGGCCTCTGAAGTGACCAGGAGACATGAGAAGCCGGAGCAGCTCCCTCAGCTTTAGGGAAAATGAGTCCTGGTATCCTTCCCTGCTTACCACAGACAAGTCCACTAACCTCTTGGGCTTTCCTTGGCCCTCAGGAATGTAAAACTAACAACCCCCTAACAGGCCAGCTAGGAGCTAACCAGAGCACTTAGCCCAGAAGCTGACATGTGACATTGAAAGCTGTCCCTGAACCACTATGGGAAGGATGCCTAGGGAGAGAGCTCCCAGCCCTTAGCGTTCAATGTGAGACCAGCCCATGATTGCCCGCAGTAAGGTAGTCCCTGTGCCAACTGCCCCTGCACCACAGAGCCCCACACACAGCCCTGAGCATGCAGAGTAGACACCGCCTCTGTGCTCTGCATGTAGGGCTGACAGCAGCAGCACTGCCCAGCTACGTTTAAAGAACTGGCATGAGTCACGAGGCCCTGGGTCAATGGGACAAAGTGTACCCGGACGCCAGGGTGCATCCATCGACTTCCCAGGAAAGCCAAGAGGTGCATGCAGTCAGTCACCACCCCAACACACACACTCACCACAGCAGTTTTACAATGCTGAAGGCATAGACAGGCCATACCGGAGAGCAATGTCTCTGGGAAGCAGGGGTTGAATGACATAGCACGCCGTGAACCTGTACTGCAGGCTTGTCCTTCTGCACAATAGCAATGGCTACCAAATGGCTGACACCTACGGAGCGCATGCATTGTGCGTTTCCATGCGTGGCAAATATTTACACGTCACCCCTTATAATGACCCCCTGAGTGGGTCCTGTTATTCCCATTTTACAAATGAACAGACAGGC - deletion

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_characteristics This differential segment spans 1.4 Mb and encompasses 14 genes only. 1580747
strain_characteristics after further derivation the congenic segment spans 788 kb and contains 7 genes: Plzf, Htr3a, Htr3b, Usp28, Zw10, Tmprss5 and Drd2 7794824