|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
# | Reference Title | Reference Citation |
1. | SMAD4 mutation segregating in a family with juvenile polyposis, aortopathy, and mitral valve dysfunction. | Andrabi S, etal., Am J Med Genet A. 2011 May;155A(5):1165-9. doi: 10.1002/ajmg.a.33968. Epub 2011 Apr 4. |
2. | Genotype-defined cancer risk in juvenile polyposis syndrome. | Aytac E, etal., Br J Surg. 2015 Jan;102(1):114-8. doi: 10.1002/bjs.9693. Epub 2014 Nov 12. |
3. | Smad4 loss in mice causes spontaneous head and neck cancer with increased genomic instability and inflammation. | Bornstein S, etal., J Clin Invest. 2009 Nov;119(11):3408-19. doi: 10.1172/JCI38854. Epub 2009 Oct 19. |
4. | A novel SMAD4 gene mutation in seminoma germ cell tumors. | Bouras M, etal., Cancer Res. 2000 Feb 15;60(4):922-8. |
5. | Transforming growth factor-beta pathway in human renal cell carcinoma and surrounding normal-appearing renal parenchyma. | Cardillo MR, etal., Anal Quant Cytol Histol. 2001 Apr;23(2):109-17. |
6. | [Effect of Budesonide on Smad4, PDGF-A and PAI-1 in a rat model of pulmonary fibrosis]. | Chen JP, etal., Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2012 May;28(5):478-80. |
7. | Emodin protects rat liver from CCl(4)-induced fibrogenesis via inhibition of hepatic stellate cells activation. | Dong MX, etal., World J Gastroenterol. 2009 Oct 14;15(38):4753-62. |
8. | [Effect of schisandrin B on lung mRNA expression of transforming growth factor-beta1 signal transduction molecule in rat lungs exposed to silica]. | Fan LH, etal., Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi. 2011 Apr;29(4):255-9. |
9. | Zhonghua zhong liu za zhi [Chinese journal of oncology] | Fan Z, etal., Zhonghua Zhong Liu Za Zhi. 2001 Mar;23(2):135-7. |
10. | Overlapping spectra of SMAD4 mutations in juvenile polyposis (JP) and JP-HHT syndrome. | Gallione C, etal., Am J Med Genet A. 2010 Feb;152A(2):333-9. doi: 10.1002/ajmg.a.33206. |
11. | SMAD4 mutations found in unselected HHT patients. | Gallione CJ, etal., J Med Genet. 2006 Oct;43(10):793-7. Epub 2006 Apr 13. |
12. | A combined syndrome of juvenile polyposis and hereditary haemorrhagic telangiectasia associated with mutations in MADH4 (SMAD4). | Gallione CJ, etal., Lancet. 2004 Mar 13;363(9412):852-9. |
13. | Disruption of Smad4 in odontoblasts causes multiple keratocystic odontogenic tumors and tooth malformation in mice. | Gao Y, etal., Mol Cell Biol. 2009 Nov;29(21):5941-51. doi: 10.1128/MCB.00706-09. Epub 2009 Aug 24. |
14. | GOAs Human GO annotations | GOA_HUMAN data from the GO Consortium |
15. | DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1. | Hahn SA, etal., Science 1996 Jan 19;271(5247):350-3. |
16. | Interaction between angiotensin II and Smad proteins in fibroblasts in failing heart and in vitro. | Hao J, etal., Am J Physiol Heart Circ Physiol. 2000 Dec;279(6):H3020-30. |
17. | Tumor suppression effects of bilberry extracts and enzymatically modified isoquercitrin in early preneoplastic liver cell lesions induced by piperonyl butoxide promotion in a two-stage rat hepatocarcinogenesis model. | Hara S, etal., Exp Toxicol Pathol. 2014 Aug;66(5-6):225-34. doi: 10.1016/j.etp.2014.02.002. Epub 2014 Mar 26. |
18. | Prevalence of thoracic aortopathy in patients with juvenile Polyposis Syndrome-Hereditary Hemorrhagic Telangiectasia due to SMAD4. | Heald B, etal., Am J Med Genet A. 2015 Aug;167A(8):1758-62. doi: 10.1002/ajmg.a.37093. Epub 2015 Apr 30. |
19. | Loss of BMP2, Smad8, and Smad4 expression in prostate cancer progression. | Horvath LG, etal., Prostate. 2004 May 15;59(3):234-42. |
20. | Common deletion of SMAD4 in juvenile polyposis is a mutational hotspot. | Howe JR, etal., Am J Hum Genet. 2002 May;70(5):1357-62. Epub 2002 Mar 27. |
21. | Mutations in the SMAD4/DPC4 gene in juvenile polyposis. | Howe JR, etal., Science. 1998 May 15;280(5366):1086-8. |
22. | [Changes in TGF-beta1/Smads signaling pathway in rats with chemical hepatocarcinogenesis]. | Hua YP, etal., Nan Fang Yi Ke Da Xue Xue Bao. 2008 Oct;28(10):1848-52. |
23. | Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. | Jones S, etal., Science. 2008 Sep 26;321(5897):1801-6. Epub 2008 Sep 4. |
24. | SMAD4 germinal mosaicism in a family with juvenile polyposis and hypertrophic osteoarthropathy. | Lamireau T, etal., J Pediatr Gastroenterol Nutr. 2005 Jul;41(1):117-20. |
25. | Mutations at a single codon in Mad homology 2 domain of SMAD4 cause Myhre syndrome. | Le Goff C, etal., Nat Genet. 2011 Dec 11;44(1):85-8. doi: 10.1038/ng.1016. |
26. | Expression of DPC4/Smad4 gene in stone-containing intrahepatic bile duct. | Lee KT, etal., J Surg Oncol. 2006 Sep 15;94(4):338-43. doi: 10.1002/jso.20517. |
27. | cAMP inhibits transforming growth factor-beta-stimulated collagen synthesis via inhibition of extracellular signal-regulated kinase 1/2 and Smad signaling in cardiac fibroblasts. | Liu X, etal., Mol Pharmacol. 2006 Dec;70(6):1992-2003. Epub 2006 Sep 7. |
28. | Inactivation of Smad4 leads to impaired ocular development and cataract formation. | Liu Y, etal., Biochem Biophys Res Commun. 2010 Oct 1;400(4):476-82. doi: 10.1016/j.bbrc.2010.08.065. Epub 2010 Aug 22. |
29. | Loss of Smad4 expression predicts liver metastasis in human colorectal cancer. | Losi L, etal., Oncol Rep. 2007 May;17(5):1095-9. |
30. | Effects of platycodins on liver complications of type 2 diabetes. | Luan H, etal., Mol Med Rep. 2014 Sep;10(3):1597-603. doi: 10.3892/mmr.2014.2363. Epub 2014 Jul 4. |
31. | Downregulation of secretory leukocyte proteinase inhibitor in chronic obstructive lung disease: the role of TGF-beta/Smads signaling pathways. | Luo BL, etal., Arch Med Res. 2008 May;39(4):388-96. doi: 10.1016/j.arcmed.2008.02.002. |
32. | Loss of expression, and mutations of Smad 2 and Smad 4 in human cervical cancer. | Maliekal TT, etal., Oncogene. 2003 Jul 31;22(31):4889-97. |
33. | TGFbeta in Cancer. | Massagué J, Cell. 2008 Jul 25;134(2):215-30. doi: 10.1016/j.cell.2008.07.001. |
34. | KAI1, CAR, and Smad4 expression in the progression of colorectal tumor. | Mikami T, etal., J Gastroenterol. 2001 Jul;36(7):465-9. doi: 10.1007/s005350170069. |
35. | Higher frequency of Smad4 gene mutation in human colorectal cancer with distant metastasis. | Miyaki M, etal., Oncogene. 1999 May 20;18(20):3098-103. doi: 10.1038/sj.onc.1202642. |
36. | SMAD4 gene mutation predicts poor prognosis in patients undergoing resection for colorectal liver metastases. | Mizuno T, etal., Eur J Surg Oncol. 2018 May;44(5):684-692. doi: 10.1016/j.ejso.2018.02.247. Epub 2018 Mar 7. |
37. | Dysregulated bone morphogenetic protein signaling in monocrotaline-induced pulmonary arterial hypertension. | Morty RE, etal., Arterioscler Thromb Vasc Biol. 2007 May;27(5):1072-8. Epub 2007 Mar 8. |
38. | Significance of pSmad2/3 and Smad4 in hepatitis C virus-related liver fibrosis and hepatocellular carcinoma. | Moussa MM, etal., APMIS. 2018 Jun;126(6):477-485. doi: 10.1111/apm.12844. |
39. | Altered expression of Smad family members in injured motor neurons of rat. | Okuyama N, etal., Brain Res. 2007 Feb 9;1132(1):36-41. Epub 2006 Dec 12. |
40. | OMIM Disease Annotation Pipeline | OMIM Disease Annotation Pipeline |
41. | TGF-beta signaling is disrupted in endometrioid-type endometrial carcinomas. | Piestrzeniewicz-Ulanska D, etal., Gynecol Oncol. 2004 Oct;95(1):173-80. |
42. | KEGG Annotation Import Pipeline | Pipeline to import KEGG annotations from KEGG into RGD |
43. | PID Annotation Import Pipeline | Pipeline to import Pathway Interaction Database annotations from NCI into RGD |
44. | Deletion of Smad4 reduces hepatic inflammation and fibrogenesis during nonalcoholic steatohepatitis progression. | Qin G, etal., J Dig Dis. 2018 May;19(5):301-313. doi: 10.1111/1751-2980.12599. Epub 2018 Jun 6. |
45. | Smad signaling in the rat model of monocrotaline pulmonary hypertension. | Ramos MF, etal., Toxicol Pathol. 2008 Feb;36(2):311-20. doi: 10.1177/0192623307311402. Epub 2008 Mar 26. |
46. | ClinVar Automated Import and Annotation Pipeline | RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations |
47. | Data Import for Chemical-Gene Interactions | RGD automated import pipeline for gene-chemical interactions |
48. | Mutation analysis of SMAD2, SMAD3, and SMAD4 genes in hereditary non-polyposis colorectal. | Roth S, etal., J Med Genet. 2000 Apr;37(4):298-300. |
49. | Mechanisms of TGF-beta signaling from cell membrane to the nucleus. | Shi Y and Massague J, Cell. 2003 Jun 13;113(6):685-700. |
50. | Oncopreventive effects of theanine and theobromine on dimethylhydrazine-induced colon cancer model. | Shojaei-Zarghani S, etal., Biomed Pharmacother. 2021 Feb;134:111140. doi: 10.1016/j.biopha.2020.111140. Epub 2020 Dec 24. |
51. | Association between Altered Expression and Genetic Variations of Transforming Growth Factor ß-Smad Pathway with Chronic Myeloid Leukemia. | Shokeen Y, etal., Int J Hematol Oncol Stem Cell Res. 2018 Jan 1;12(1):14-22. |
52. | Expression profiling identifies altered expression of genes that contribute to the inhibition of transforming growth factor-beta signaling in ovarian cancer. | Sunde JS, etal., Cancer Res. 2006 Sep 1;66(17):8404-12. |
53. | SMAD4 haploinsufficiency associates with augmented colonic inflammation in select humans and mice. | Szigeti R, etal., Ann Clin Lab Sci. 2012 Fall;42(4):401-8. |
54. | Biologically different subgroups of invasive ductal carcinoma of the pancreas: Dpc4 status according to the ratio of intraductal carcinoma components. | Takahashi H, etal., Clin Cancer Res. 2004 Jun 1;10(11):3772-9. doi: 10.1158/1078-0432.CCR-03-0120. |
55. | Allelic imbalance in chromosome band 18q21 and SMAD4 mutations in ovarian cancers. | Takakura S, etal., Genes Chromosomes Cancer. 1999 Mar;24(3):264-71. |
56. | Inhibiting scar formation in vitro and in vivo by adenovirus-mediated mutant Smad4: a preliminary report. | Tan WQ, etal., Exp Dermatol. 2011 Feb;20(2):119-24. doi: 10.1111/j.1600-0625.2010.01186.x. |
57. | [Smad4 and TGF-beta1 expression and clinical significance in bladder transitional cell carcinoma] | Tang ZY, etal., Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2006 Jun;31(3):363-6. |
58. | MicroRNA-224 targets SMAD family member 4 to promote cell proliferation and negatively influence patient survival. | Wang Y, etal., PLoS One. 2013 Jul 29;8(7):e68744. doi: 10.1371/journal.pone.0068744. Print 2013. |
59. | [Expressions of transforming growth factor-beta(1) and Smad4 in rat models of chronic nonbacterial prostatitis and their clinical significance]. | Wang YM, etal., Zhonghua Nan Ke Xue. 2010 Jun;16(6):490-4. |
60. | Treatment with cardiotonic pills(®) after ischemia-reperfusion ameliorates myocardial fibrosis in rats. | Wei XH, etal., Microcirculation. 2013 Jan;20(1):17-29. doi: 10.1111/micc.12002. |
61. | Targeting RICTOR Sensitizes SMAD4-Negative Colon Cancer to Irinotecan. | Wong CK, etal., Mol Cancer Res. 2020 Mar;18(3):414-423. doi: 10.1158/1541-7786.MCR-19-0525. Epub 2020 Jan 13. |
62. | Pancreatic cancer: molecular pathogenesis and new therapeutic targets. | Wong HH and Lemoine NR, Nat Rev Gastroenterol Hepatol. 2009 Jul;6(7):412-22. Epub 2009 Jun 9. |
63. | Comprehensive analysis of SMAD4 mutations and protein expression in juvenile polyposis: evidence for a distinct genetic pathway and polyp morphology in SMAD4 mutation carriers. | Woodford-Richens KL, etal., Am J Pathol. 2001 Oct;159(4):1293-300. |
64. | Alterations of Smad signaling in human breast carcinoma are associated with poor outcome: a tissue microarray study. | Xie W, etal., Cancer Res. 2002 Jan 15;62(2):497-505. |
65. | TGF-beta signaling alterations and susceptibility to colorectal cancer. | Xu Y and Pasche B, Hum Mol Genet. 2007 Apr 15;16 Spec No 1:R14-20. |
66. | Non-virus-mediated transfer of siRNAs against Runx2 and Smad4 inhibit heterotopic ossification in rats. | Xue T, etal., Gene Ther. 2010 Mar;17(3):370-9. doi: 10.1038/gt.2009.154. Epub 2009 Nov 26. |
67. | Reduced Expression of SMAD4 Is Associated with Poor Survival in Colon Cancer. | Yan P, etal., Clin Cancer Res. 2016 Jun 15;22(12):3037-47. doi: 10.1158/1078-0432.CCR-15-0939. Epub 2016 Feb 9. |
68. | Inactivation of Smad4 is a prognostic factor in intrahepatic cholangiocarcinoma. | Yan XQ, etal., Chin Med J (Engl). 2013 Aug;126(16):3039-43. |
69. | Smad4 expression in hepatocellular carcinoma differs by hepatitis status. | Yao L, etal., Asian Pac J Cancer Prev. 2012;13(4):1297-303. doi: 10.7314/apjcp.2012.13.4.1297. |
70. | Apoptosis incidence and protein expression of p53, TGF-beta receptor II, p27Kip1, and Smad4 in benign, premalignant, and malignant human prostate. | Zeng L, etal., Hum Pathol. 2004 Mar;35(3):290-7. |
71. | Involvement of mutations in the DPC4 promoter in endometrial carcinoma development. | Zhou Y, etal., Mol Carcinog. 1999 May;25(1):64-72. |
PMID:7958924 | PMID:7958925 | PMID:8564959 | PMID:8637600 | PMID:8653691 | PMID:8774881 | PMID:8861901 | PMID:8889548 | PMID:9098646 | PMID:9111321 | PMID:9214508 | PMID:9256479 |
PMID:9285560 | PMID:9288972 | PMID:9311995 | PMID:9389648 | PMID:9436979 | PMID:9482899 | PMID:9660945 | PMID:9679056 | PMID:9707553 | PMID:9732876 | PMID:9741623 | PMID:9759503 |
PMID:9811934 | PMID:9843199 | PMID:9843571 | PMID:9892009 | PMID:10085121 | PMID:10085140 | PMID:10092624 | PMID:10199400 | PMID:10220381 | PMID:10224145 | PMID:10398437 | PMID:10400705 |
PMID:10531062 | PMID:10531362 | PMID:10549282 | PMID:10557285 | PMID:10575014 | PMID:10583507 | PMID:10636916 | PMID:10647180 | PMID:10647776 | PMID:10660046 | PMID:10708948 | PMID:10708949 |
PMID:10781087 | PMID:10823886 | PMID:10846168 | PMID:10871368 | PMID:10878024 | PMID:10887155 | PMID:10890911 | PMID:10896788 | PMID:10942775 | PMID:10980615 | PMID:10995777 | PMID:11027280 |
PMID:11042172 | PMID:11094085 | PMID:11102446 | PMID:11114293 | PMID:11121043 | PMID:11160896 | PMID:11163184 | PMID:11224571 | PMID:11264182 | PMID:11265759 | PMID:11274206 | PMID:11278302 |
PMID:11278756 | PMID:11387330 | PMID:11401430 | PMID:11432852 | PMID:11555647 | PMID:11571638 | PMID:11700304 | PMID:11741830 | PMID:11779503 | PMID:11779505 | PMID:11783110 | PMID:11818334 |
PMID:11836524 | PMID:11866987 | PMID:11927552 | PMID:12000714 | PMID:12010891 | PMID:12023040 | PMID:12077092 | PMID:12097320 | PMID:12099698 | PMID:12116240 | PMID:12136244 | PMID:12150994 |
PMID:12161428 | PMID:12167862 | PMID:12191474 | PMID:12202226 | PMID:12202987 | PMID:12209716 | PMID:12226080 | PMID:12370310 | PMID:12374795 | PMID:12411310 | PMID:12414627 | PMID:12417513 |
PMID:12419246 | PMID:12429655 | PMID:12477932 | PMID:12483531 | PMID:12524424 | PMID:12531695 | PMID:12543979 | PMID:12548549 | PMID:12551947 | PMID:12569386 | PMID:12576474 | PMID:12618756 |
PMID:12621041 | PMID:12631740 | PMID:12650946 | PMID:12700666 | PMID:12720172 | PMID:12732634 | PMID:12740389 | PMID:12758167 | PMID:12764135 | PMID:12794086 | PMID:12801888 | PMID:12802277 |
PMID:12808092 | PMID:12813045 | PMID:12815042 | PMID:12857746 | PMID:12874272 | PMID:12904571 | PMID:12917407 | PMID:12952364 | PMID:14514699 | PMID:14525983 | PMID:14555988 | PMID:14607700 |
PMID:14612411 | PMID:14612423 | PMID:14612439 | PMID:14630787 | PMID:14630914 | PMID:14633973 | PMID:14639103 | PMID:14647410 | PMID:14647445 | PMID:14669329 | PMID:14671321 | PMID:14687659 |
PMID:14691252 | PMID:14699069 | PMID:14701756 | PMID:14715079 | PMID:14727154 | PMID:14729983 | PMID:14766211 | PMID:14966294 | PMID:14988407 | PMID:14993265 | PMID:15014009 | PMID:15028714 |
PMID:15033661 | PMID:15063137 | PMID:15069531 | PMID:15084259 | PMID:15107966 | PMID:15150278 | PMID:15157044 | PMID:15166010 | PMID:15231748 | PMID:15235019 | PMID:15240101 | PMID:15280432 |
PMID:15314162 | PMID:15350224 | PMID:15359284 | PMID:15367885 | PMID:15467747 | PMID:15489334 | PMID:15531914 | PMID:15561701 | PMID:15588252 | PMID:15592428 | PMID:15592526 | PMID:15621726 |
PMID:15637079 | PMID:15708501 | PMID:15735739 | PMID:15736060 | PMID:15761153 | PMID:15781469 | PMID:15799969 | PMID:15814640 | PMID:15817471 | PMID:15820681 | PMID:15846069 | PMID:15849193 |
PMID:15855639 | PMID:15867212 | PMID:15881652 | PMID:15886208 | PMID:15922743 | PMID:15940269 | PMID:16007207 | PMID:16007227 | PMID:16009940 | PMID:16082587 | PMID:16135802 | PMID:16146757 |
PMID:16172383 | PMID:16189514 | PMID:16223572 | PMID:16288847 | PMID:16322555 | PMID:16344560 | PMID:16362038 | PMID:16436638 | PMID:16478646 | PMID:16516194 | PMID:16627986 | PMID:16714330 |
PMID:16751102 | PMID:16754688 | PMID:16777850 | PMID:16865698 | PMID:16916642 | PMID:16953227 | PMID:16959612 | PMID:17016646 | PMID:17023741 | PMID:17043799 | PMID:17053951 | PMID:17099224 |
PMID:17132729 | PMID:17151782 | PMID:17167985 | PMID:17183365 | PMID:17190602 | PMID:17200344 | PMID:17251190 | PMID:17283070 | PMID:17301079 | PMID:17353364 | PMID:17436386 | PMID:17438144 |
PMID:17469085 | PMID:17469184 | PMID:17476473 | PMID:17478078 | PMID:17583730 | PMID:17591695 | PMID:17591701 | PMID:17643425 | PMID:17659731 | PMID:17847004 | PMID:17854080 | PMID:17873119 |
PMID:17875924 | PMID:17994767 | PMID:17997817 | PMID:18029348 | PMID:18055455 | PMID:18178612 | PMID:18213629 | PMID:18215124 | PMID:18310076 | PMID:18310088 | PMID:18321803 | PMID:18413775 |
PMID:18425078 | PMID:18471510 | PMID:18505344 | PMID:18511908 | PMID:18519565 | PMID:18519681 | PMID:18568018 | PMID:18620728 | PMID:18664273 | PMID:18729074 | PMID:18783722 | PMID:18823382 |
PMID:18832382 | PMID:18949401 | PMID:18985820 | PMID:19032343 | PMID:19064568 | PMID:19135894 | PMID:19139564 | PMID:19144825 | PMID:19183329 | PMID:19211612 | PMID:19247629 | PMID:19266212 |
PMID:19270646 | PMID:19270816 | PMID:19273710 | PMID:19274049 | PMID:19284991 | PMID:19321257 | PMID:19328798 | PMID:19341727 | PMID:19351817 | PMID:19366699 | PMID:19419955 | PMID:19420158 |
PMID:19453261 | PMID:19463221 | PMID:19527492 | PMID:19528490 | PMID:19538865 | PMID:19548527 | PMID:19558215 | PMID:19584151 | PMID:19624886 | PMID:19626374 | PMID:19686287 | PMID:19688145 |
PMID:19690946 | PMID:19730683 | PMID:19752858 | PMID:19768112 | PMID:19834456 | PMID:19856310 | PMID:19913121 | PMID:19916025 | PMID:19917253 | PMID:19996292 | PMID:20012971 | PMID:20097766 |
PMID:20118412 | PMID:20142324 | PMID:20165854 | PMID:20200332 | PMID:20211142 | PMID:20235236 | PMID:20237276 | PMID:20301299 | PMID:20301525 | PMID:20301642 | PMID:20307265 | PMID:20346360 |
PMID:20350217 | PMID:20404275 | PMID:20473902 | PMID:20564330 | PMID:20565773 | PMID:20577838 | PMID:20581473 | PMID:20603019 | PMID:20622003 | PMID:20628086 | PMID:20634891 | PMID:20667911 |
PMID:20682711 | PMID:20682989 | PMID:20685810 | PMID:20734064 | PMID:20734429 | PMID:20797318 | PMID:20862427 | PMID:20885978 | PMID:20959473 | PMID:21036691 | PMID:21068203 | PMID:21095583 |
PMID:21105199 | PMID:21112326 | PMID:21126430 | PMID:21152044 | PMID:21245094 | PMID:21259057 | PMID:21263249 | PMID:21289291 | PMID:21289624 | PMID:21294585 | PMID:21297662 | PMID:21330551 |
PMID:21352803 | PMID:21412070 | PMID:21421563 | PMID:21454478 | PMID:21492476 | PMID:21532621 | PMID:21540640 | PMID:21597466 | PMID:21705453 | PMID:21709185 | PMID:21726607 | PMID:21726812 |
PMID:21782795 | PMID:21791112 | PMID:21828274 | PMID:21835029 | PMID:21873635 | PMID:21898662 | PMID:21945631 | PMID:21947082 | PMID:21964812 | PMID:21968601 | PMID:21988832 | PMID:22002709 |
PMID:22020746 | PMID:22024061 | PMID:22028478 | PMID:22033265 | PMID:22045334 | PMID:22109972 | PMID:22115830 | PMID:22130069 | PMID:22209340 | PMID:22243968 | PMID:22266936 | PMID:22278155 |
PMID:22301403 | PMID:22310290 | PMID:22314103 | PMID:22316667 | PMID:22321641 | PMID:22331366 | PMID:22344298 | PMID:22351431 | PMID:22357933 | PMID:22377565 | PMID:22442258 | PMID:22461896 |
PMID:22504380 | PMID:22534828 | PMID:22585601 | PMID:22617360 | PMID:22658931 | PMID:22674574 | PMID:22689943 | PMID:22710759 | PMID:22748914 | PMID:22821565 | PMID:22860091 | PMID:22898364 |
PMID:22945649 | PMID:22965423 | PMID:23018642 | PMID:23047509 | PMID:23112421 | PMID:23139211 | PMID:23152365 | PMID:23154409 | PMID:23201680 | PMID:23207623 | PMID:23221074 | PMID:23226455 |
PMID:23239472 | PMID:23298711 | PMID:23344532 | PMID:23360922 | PMID:23362281 | PMID:23397142 | PMID:23399955 | PMID:23414517 | PMID:23470568 | PMID:23538390 | PMID:23591524 | PMID:23592428 |
PMID:23602568 | PMID:23668999 | PMID:23788427 | PMID:23800974 | PMID:23817620 | PMID:23826135 | PMID:23832538 | PMID:23863096 | PMID:23891973 | PMID:23929584 | PMID:23973329 | PMID:23975369 |
PMID:23999427 | PMID:24008158 | PMID:24052079 | PMID:24071738 | PMID:24074918 | PMID:24078030 | PMID:24102952 | PMID:24157709 | PMID:24211445 | PMID:24235142 | PMID:24265041 | PMID:24307592 |
PMID:24312718 | PMID:24324267 | PMID:24340014 | PMID:24382352 | PMID:24386371 | PMID:24412244 | PMID:24424121 | PMID:24504368 | PMID:24525918 | PMID:24580733 | PMID:24584437 | PMID:24613014 |
PMID:24618609 | PMID:24641900 | PMID:24659668 | PMID:24665063 | PMID:24704720 | PMID:24739390 | PMID:24859161 | PMID:24928394 | PMID:24952347 | PMID:25059663 | PMID:25060566 | PMID:25061104 |
PMID:25105734 | PMID:25114173 | PMID:25119169 | PMID:25207745 | PMID:25220407 | PMID:25228630 | PMID:25241761 | PMID:25264609 | PMID:25267569 | PMID:25310401 | PMID:25333693 | PMID:25370208 |
PMID:25373906 | PMID:25393365 | PMID:25416956 | PMID:25426619 | PMID:25464861 | PMID:25482028 | PMID:25502805 | PMID:25514493 | PMID:25523445 | PMID:25531314 | PMID:25531329 | PMID:25609649 |
PMID:25634752 | PMID:25639227 | PMID:25639869 | PMID:25640309 | PMID:25670202 | PMID:25680269 | PMID:25681512 | PMID:25684678 | PMID:25695693 | PMID:25742737 | PMID:25760429 | PMID:25769430 |
PMID:25890228 | PMID:25893305 | PMID:25910212 | PMID:25921273 | PMID:26019136 | PMID:26022109 | PMID:26046389 | PMID:26077733 | PMID:26079547 | PMID:26159157 | PMID:26165824 | PMID:26171675 |
PMID:26186194 | PMID:26261604 | PMID:26284758 | PMID:26339396 | PMID:26341919 | PMID:26344197 | PMID:26383977 | PMID:26464677 | PMID:26555259 | PMID:26572829 | PMID:26625141 | PMID:26647806 |
PMID:26673895 | PMID:26687479 | PMID:26699655 | PMID:26747772 | PMID:26754455 | PMID:26786210 | PMID:26817584 | PMID:26848620 | PMID:26871637 | PMID:26878725 | PMID:26974954 | PMID:26977879 |
PMID:26978681 | PMID:26986629 | PMID:27060206 | PMID:27107012 | PMID:27124039 | PMID:27146957 | PMID:27279345 | PMID:27286257 | PMID:27302097 | PMID:27375208 | PMID:27383203 | PMID:27412941 |
PMID:27432539 | PMID:27438138 | PMID:27492861 | PMID:27492974 | PMID:27498705 | PMID:27528036 | PMID:27595937 | PMID:27685626 | PMID:27703004 | PMID:27769780 | PMID:27833918 | PMID:27845895 |
PMID:27914767 | PMID:28042090 | PMID:28055015 | PMID:28100650 | PMID:28115363 | PMID:28145479 | PMID:28160547 | PMID:28174172 | PMID:28188630 | PMID:28199217 | PMID:28240243 | PMID:28244607 |
PMID:28256094 | PMID:28319113 | PMID:28339284 | PMID:28348487 | PMID:28349818 | PMID:28356064 | PMID:28370334 | PMID:28376920 | PMID:28393199 | PMID:28406602 | PMID:28415588 | PMID:28417919 |
PMID:28423626 | PMID:28440445 | PMID:28443643 | PMID:28445620 | PMID:28468752 | PMID:28514442 | PMID:28522603 | PMID:28577946 | PMID:28631567 | PMID:28638476 | PMID:28655924 | PMID:28666732 |
PMID:28670958 | PMID:28674107 | PMID:28716708 | PMID:28759002 | PMID:28821833 | PMID:28827661 | PMID:28852126 | PMID:28867604 | PMID:28874282 | PMID:28901475 | PMID:28924364 | PMID:28938919 |
PMID:28984049 | PMID:28986522 | PMID:29065177 | PMID:29103024 | PMID:29117863 | PMID:29146913 | PMID:29221668 | PMID:29230941 | PMID:29329157 | PMID:29331421 | PMID:29393426 | PMID:29468299 |
PMID:29512734 | PMID:29602802 | PMID:29693254 | PMID:29703253 | PMID:29725250 | PMID:29734252 | PMID:29749509 | PMID:29844126 | PMID:29856490 | PMID:29892012 | PMID:29922945 | PMID:29938690 |
PMID:29960168 | PMID:29986996 | PMID:29997244 | PMID:30060237 | PMID:30196345 | PMID:30212393 | PMID:30232004 | PMID:30251589 | PMID:30376214 | PMID:30389135 | PMID:30421464 | PMID:30444564 |
PMID:30530919 | PMID:30575147 | PMID:30587545 | PMID:30617054 | PMID:30636020 | PMID:30653987 | PMID:30659096 | PMID:30664791 | PMID:30705034 | PMID:30718277 | PMID:30730996 | PMID:30737378 |
PMID:30741461 | PMID:30745456 | PMID:30779466 | PMID:30804502 | PMID:30809044 | PMID:30820854 | PMID:30915745 | PMID:30946932 | PMID:30979374 | PMID:30980801 | PMID:30997579 | PMID:31056731 |
PMID:31082421 | PMID:31091453 | PMID:31130994 | PMID:31177911 | PMID:31209059 | PMID:31221662 | PMID:31242417 | PMID:31388669 | PMID:31432189 | PMID:31467278 | PMID:31481467 | PMID:31489963 |
PMID:31500428 | PMID:31515488 | PMID:31582430 | PMID:31591477 | PMID:31654632 | PMID:31681835 | PMID:31684910 | PMID:31721429 | PMID:31837202 | PMID:31912090 | PMID:31970414 | PMID:32029901 |
PMID:32043194 | PMID:32081064 | PMID:32151199 | PMID:32155285 | PMID:32237038 | PMID:32239614 | PMID:32296183 | PMID:32314446 | PMID:32323744 | PMID:32366274 | PMID:32371398 | PMID:32376602 |
PMID:32398773 | PMID:32415058 | PMID:32429474 | PMID:32432764 | PMID:32434004 | PMID:32439219 | PMID:32524577 | PMID:32573775 | PMID:32628850 | PMID:32737864 | PMID:32814053 | PMID:32886291 |
PMID:32897998 | PMID:32929850 | PMID:33053339 | PMID:33079408 | PMID:33097490 | PMID:33146409 | PMID:33199824 | PMID:33293694 | PMID:33303972 | PMID:33306668 | PMID:33326750 | PMID:33327804 |
PMID:33347393 | PMID:33372356 | PMID:33417952 | PMID:33495811 | PMID:33509126 | PMID:33529121 | PMID:33546553 | PMID:33605573 | PMID:33608451 | PMID:33686239 | PMID:33746597 | PMID:33760133 |
PMID:33768677 | PMID:33774196 | PMID:33794845 | PMID:33961781 | PMID:33990575 | PMID:34002944 | PMID:34048444 | PMID:34070531 | PMID:34114372 | PMID:34163033 | PMID:34301194 | PMID:34320363 |
PMID:34329870 | PMID:34362797 | PMID:34381046 | PMID:34383767 | PMID:34528447 | PMID:34703008 | PMID:34717960 | PMID:34785655 | PMID:34957936 | PMID:35025139 | PMID:35034624 | PMID:35151205 |
PMID:35199612 | PMID:35220882 | PMID:35318442 | PMID:35359452 | PMID:35426367 | PMID:35456471 | PMID:35475028 | PMID:35484112 | PMID:35545731 | PMID:35680374 | PMID:35716259 | PMID:35751569 |
PMID:35811497 | PMID:35831314 | PMID:35863523 | PMID:35879950 | PMID:35898699 | PMID:35942952 | PMID:35945219 | PMID:36038259 | PMID:36049049 | PMID:36053032 | PMID:36114006 | PMID:36120950 |
PMID:36194927 | PMID:36203070 | PMID:36213818 | PMID:36215168 | PMID:36219392 | PMID:36377587 | PMID:36418055 | PMID:36450103 | PMID:36469259 | PMID:36496093 | PMID:36543142 | PMID:36546711 |
PMID:36579465 | PMID:36635499 | PMID:36740808 | PMID:36916236 | PMID:36916534 | PMID:36991117 | PMID:37175608 | PMID:37428273 | PMID:37488750 | PMID:37596505 | PMID:37610394 | PMID:37648039 |
PMID:37664931 | PMID:37816352 | PMID:37827155 | PMID:37962020 | PMID:38270141 | PMID:38286358 | PMID:38421638 | PMID:38456416 | PMID:38504385 | PMID:38509727 | PMID:38914552 |
SMAD4 (Homo sapiens - human) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Smad4 (Mus musculus - house mouse) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Smad4 (Rattus norvegicus - Norway rat) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Smad4 (Chinchilla lanigera - long-tailed chinchilla) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMAD4 (Pan paniscus - bonobo/pygmy chimpanzee) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMAD4 (Canis lupus familiaris - dog) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Smad4 (Ictidomys tridecemlineatus - thirteen-lined ground squirrel) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMAD4 (Sus scrofa - pig) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMAD4 (Chlorocebus sabaeus - green monkey) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Smad4 (Heterocephalus glaber - naked mole-rat) |
|
.
Variants in SMAD4
1841 total Variants ![]() |
Name | Type | Condition(s) | Position(s) | Clinical significance |
NM_005359.6(SMAD4):c.638A>G (p.Asn213Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311854]|Hereditary cancer-predisposing syndrome [RCV000564817]|Juvenile polyposis syndrome [RCV000548532]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999047] | Chr18:51054964 [GRCh38] Chr18:48581334 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1228_1229del (p.Gln410fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002316529]|Juvenile polyposis syndrome [RCV002231357] | Chr18:51067106..51067107 [GRCh38] Chr18:48593476..48593477 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.380G>A (p.Cys127Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311853]|Juvenile polyposis syndrome [RCV000524554] | Chr18:51048816 [GRCh38] Chr18:48575186 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.250-5T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311944]|Juvenile polyposis syndrome [RCV000902773] | Chr18:51048681 [GRCh38] Chr18:48575051 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.425-8C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002231362] | Chr18:51049287 [GRCh38] Chr18:48575657 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.855C>T (p.Asn285=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311906]|Hereditary cancer-predisposing syndrome [RCV000562277]|Juvenile polyposis syndrome [RCV000872461]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001080]|not provided [RCV003478264]|not specified [RCV000608699] | Chr18:51058407 [GRCh38] Chr18:48584777 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1283A>C (p.Lys428Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311913] | Chr18:51067162 [GRCh38] Chr18:48593532 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.625A>G (p.Thr209Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559167]|Juvenile polyposis syndrome [RCV002231714] | Chr18:51054951 [GRCh38] Chr18:48581321 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.763G>T (p.Gly255Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311855]|Hereditary cancer-predisposing syndrome [RCV000568236]|Juvenile polyposis syndrome [RCV000540866]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003476249]|not provided [RCV002291657] | Chr18:51058220 [GRCh38] Chr18:48584590 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.9T>C (p.Asn3=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311907]|Hereditary cancer-predisposing syndrome [RCV000567859]|Juvenile polyposis syndrome [RCV002232643]|not specified [RCV003323621] | Chr18:51047055 [GRCh38] Chr18:48573425 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.909T>G (p.Pro303=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311857]|Hereditary cancer-predisposing syndrome [RCV000563754]|Juvenile polyposis syndrome [RCV001083899]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999051]|not provided [RCV000759352]|not specified [RCV000602454] | Chr18:51059870 [GRCh38] Chr18:48586240 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.621T>C (p.Asn207=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002358481]|Hereditary cancer-predisposing syndrome [RCV003584650]|Juvenile polyposis syndrome [RCV000544908] | Chr18:51054947 [GRCh38] Chr18:48581317 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1098A>G (p.Gln366=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002323939]|Hereditary cancer-predisposing syndrome [RCV000777277]|Juvenile polyposis syndrome [RCV000545033]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003804]|not specified [RCV000608407] | Chr18:51065565 [GRCh38] Chr18:48591935 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.632C>G (p.Thr211Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317327] | Chr18:51054958 [GRCh38] Chr18:48581328 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.84A>G (p.Gln28=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311856]|Hereditary cancer-predisposing syndrome [RCV000572232]|Juvenile polyposis syndrome [RCV001086440]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999050]|not provided [RCV000679592]|not specified [RCV002476125] | Chr18:51047130 [GRCh38] Chr18:48573500 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.914A>C (p.His305Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002376966]|Juvenile polyposis syndrome [RCV002527609]|not provided [RCV000522043] | Chr18:51059875 [GRCh38] Chr18:48586245 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1219G>C (p.Val407Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311850]|Hereditary cancer-predisposing syndrome [RCV000562603]|Juvenile polyposis syndrome [RCV000558005]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003476248]|Myhre syndrome [RCV000764164]|not provided [RCV001662542] | Chr18:51067098 [GRCh38] Chr18:48593468 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.516G>A (p.Leu172=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311916]|Juvenile polyposis syndrome [RCV001458693] | Chr18:51054842 [GRCh38] Chr18:48581212 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.320A>G (p.Asn107Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311945] | Chr18:51048756 [GRCh38] Chr18:48575126 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.424+1G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002328206]|Juvenile polyposis syndrome [RCV003094604] | Chr18:51048861 [GRCh38] Chr18:48575231 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1447+1G>A | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000032042] | Chr18:51076777 [GRCh38] Chr18:48603147 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.1244_1247delACAG (p.Asp415Glufs) | deletion | Jp/hht [RCV000021727]|Juvenile polyposis syndrome [RCV000020634]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021727] | Chr18:51067123..51067126 [GRCh38] Chr18:48593493..48593496 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.(?_-17093)_(1659_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021675] | Chr18:51013658..51078467 [GRCh38] Chr18:48540028..48604837 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.189_197delAAATGGAGCins44 (p.?) | indel | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021676] | Chr18:51047235..51047243 [GRCh38] Chr18:48573605..48573613 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.905-32= | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021677] | Chr18:51059834 [GRCh38] Chr18:48586204 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.302G>A (p.Trp101Ter) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021678] | Chr18:51048738 [GRCh38] Chr18:48575108 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.354G>A (p.Ala118=) | single nucleotide variant | Carcinoma of colon [RCV001357816]|Familial thoracic aortic aneurysm and aortic dissection [RCV002310631]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000021679]|Hereditary cancer-predisposing syndrome [RCV000128170]|Juvenile polyposis syndrome [RCV001507222]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000349756]|Myhre syndrome [RCV000291347]|not provided [RCV000679589]|not specified [RCV000213003] | Chr18:51048790 [GRCh38] Chr18:48575160 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|conflicting data from submitters |
NM_005359.6(SMAD4):c.373_374insAT (p.Ser125fs) | insertion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021680] | Chr18:51048809..51048810 [GRCh38] Chr18:48575179..48575180 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.375_381dup (p.Val128fs) | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021681] | Chr18:51048810..51048811 [GRCh38] Chr18:48575180..48575181 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.403C>T (p.Arg135Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003162257]|Hereditary cancer-predisposing syndrome [RCV003584515]|Juvenile polyposis syndrome [RCV001376608]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004018652]|not provided [RCV001556662] | Chr18:51048839 [GRCh38] Chr18:48575209 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.425-6A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002326681]|Juvenile polyposis syndrome [RCV003595857]|not provided [RCV000235856] | Chr18:51049289 [GRCh38] Chr18:48575659 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.430_431del (p.Ser144fs) | microsatellite | Familial thoracic aortic aneurysm and aortic dissection [RCV002311523]|Juvenile polyposis syndrome [RCV001376568]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004018653] | Chr18:51049296..51049297 [GRCh38] Chr18:48575666..48575667 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.437T>A (p.Leu146Ter) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021685] | Chr18:51049307 [GRCh38] Chr18:48575677 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.516_527del (p.Ser173_Gly176del) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021686] | Chr18:51054842..51054853 [GRCh38] Chr18:48581212..48581223 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.533C>G (p.Ser178Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310632]|Juvenile polyposis syndrome [RCV002288516]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001310210] | Chr18:51054859 [GRCh38] Chr18:48581229 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.538C>T (p.Gln180Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV003064518] | Chr18:51054864 [GRCh38] Chr18:48581234 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.608del (p.Pro203fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021689] | Chr18:51054931 [GRCh38] Chr18:48581301 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.668-?_1659+?del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021690] | Chr18:48584495..48604837 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.692dup (p.Ser232fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002310633]|Hereditary cancer-predisposing syndrome [RCV000214505]|Juvenile polyposis of stomach [RCV000009069]|Juvenile polyposis syndrome [RCV001386505]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021692]|not provided [RCV002054467] | Chr18:51058143..51058144 [GRCh38] Chr18:48584513..48584514 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.731_732insGCCC(p.Gln245Profs) | insertion | Familial thoracic aortic aneurysm and aortic dissection [RCV002381259]|Juvenile polyposis syndrome [RCV002513159]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003450650] | Chr18:51058186..51058187 [GRCh38] Chr18:48584558..48584559 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.788-?_1659+?del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021694] | Chr18:48584710..48604837 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.829_830delAC (p.Pro278Terfs) | deletion | Juvenile polyposis syndrome [RCV000021695] | Chr18:51058381..51058382 [GRCh38] Chr18:48584751..48584752 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.831_832del (p.Thr277_Pro278insTer) | microsatellite | Juvenile polyposis syndrome [RCV001797981] | Chr18:51058379..51058380 [GRCh38] Chr18:48584749..48584750 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.905-52A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003315506]|not provided [RCV001668133]|not specified [RCV001001443] | Chr18:51059814 [GRCh38] Chr18:48586184 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.925_928dup (p.Phe310fs) | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021698] | Chr18:51059884..51059885 [GRCh38] Chr18:48586254..48586255 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.970T>C (p.Cys324Arg) | single nucleotide variant | not provided [RCV000236187] | Chr18:51065437 [GRCh38] Chr18:48591807 [GRCh37] Chr18:18q21.2 |
pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.971del (p.Cys324fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021700] | Chr18:51065438 [GRCh38] Chr18:48591808 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1081C>A (p.Arg361Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001851989]|Neoplasm of the large intestine [RCV000443865] | Chr18:51065548 [GRCh38] Chr18:48591918 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.988G>A (p.Glu330Lys) | single nucleotide variant | JP and JP/HHT [RCV000021703] | Chr18:51065455 [GRCh38] Chr18:48591825 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.989A>G (p.Glu330Gly) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000129952]|not provided [RCV000059737] | Chr18:51065456 [GRCh38] Chr18:48591826 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|not provided |
NM_005359.6(SMAD4):c.1037del (p.Pro346fs) | deletion | Juvenile polyposis syndrome [RCV002228050] | Chr18:51065502 [GRCh38] Chr18:48591872 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1042_1043del (p.Val348fs) | deletion | Juvenile polyposis syndrome [RCV001797982] | Chr18:51065508..51065509 [GRCh38] Chr18:48591878..48591879 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1055G>A (p.Gly352Glu) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021708] | Chr18:51065522 [GRCh38] Chr18:48591892 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1058A>C (p.Tyr353Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585818] | Chr18:51065525 [GRCh38] Chr18:48591895 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1081C>G (p.Arg361Gly) | single nucleotide variant | Breast neoplasm [RCV000418132]|Carcinoma of esophagus [RCV000436432]|Gastric adenocarcinoma [RCV000418748]|Juvenile polyposis syndrome [RCV002228051]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV002470716]|Lung adenocarcinoma [RCV000428136]|Neoplasm of the large intestine [RCV000428393]|Neoplasm of uterine cervix [RCV000425278]|Pancreatic adenocarcinoma [RCV000441273]|Squamous cell carcinoma of the head and neck [RCV000438396] | Chr18:51065548 [GRCh38] Chr18:48591918 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1082G>A (p.Arg361His) | single nucleotide variant | Breast neoplasm [RCV000441473]|Carcinoma of esophagus [RCV000423753]|Familial thoracic aortic aneurysm and aortic dissection [RCV002316201]|Gastric adenocarcinoma [RCV000439037]|Juvenile polyposis syndrome [RCV000635423]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004018654]|Lung adenocarcinoma [RCV000434006]|Myhre syndrome [RCV000763030]|Neoplasm of the large intestine [RCV000431203]|Neoplasm of uterine cervix [RCV000419206]|Pancreatic adenocarcinoma [RCV000431590]|Squamous cell carcinoma of the head and neck [RCV000421390]|not provided [RCV000520995] | Chr18:51065549 [GRCh38] Chr18:48591919 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1082G>T (p.Arg361Leu) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021713] | Chr18:51065549 [GRCh38] Chr18:48591919 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1087T>C (p.Cys363Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561259] | Chr18:51065554 [GRCh38] Chr18:48591924 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1088_1090del (p.Cys363del) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002428202] | Chr18:51065553..51065555 [GRCh38] Chr18:48591923..48591925 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1091T>G (p.Leu364Trp) | single nucleotide variant | Juvenile polyposis syndrome [RCV002015235] | Chr18:51065558 [GRCh38] Chr18:48591928 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1102_1103del (p.Ser368fs) | microsatellite | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021717] | Chr18:51065566..51065567 [GRCh38] Chr18:48591936..48591937 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1113del (p.His371fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021718] | Chr18:51065580 [GRCh38] Chr18:48591950 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1139G>A (p.Arg380Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002453278]|Juvenile polyposis syndrome [RCV001376547]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004018695] | Chr18:51065606 [GRCh38] Chr18:48591976 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.1139+1G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV001991320] | Chr18:51065607 [GRCh38] Chr18:48591977 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1148T>A (p.Ile383Lys) | single nucleotide variant | not provided [RCV001354075] | Chr18:51067027 [GRCh38] Chr18:48593397 [GRCh37] Chr18:18q21.2 |
pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.1162C>T (p.Gln388Ter) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021723]|Juvenile polyposis syndrome [RCV001851990] | Chr18:51067041 [GRCh38] Chr18:48593411 [GRCh37] Chr18:18q21.2 |
pathogenic|not provided |
NM_005359.6(SMAD4):c.1168G>A (p.Glu390Lys) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021724] | Chr18:51067047 [GRCh38] Chr18:48593417 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1193G>A (p.Trp398Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596862] | Chr18:51067072 [GRCh38] Chr18:48593442 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1242del (p.Asp415fs) | deletion | Juvenile polyposis syndrome [RCV002228052] | Chr18:51067121 [GRCh38] Chr18:48593491 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1268del (p.Gly423fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021730] | Chr18:51067146 [GRCh38] Chr18:48593516 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1333C>T (p.Arg445Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310634]|Gallbladder cancer [RCV001374448]|Juvenile polyposis syndrome [RCV001376567]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000023059]|not provided [RCV000493396] | Chr18:51076662 [GRCh38] Chr18:48603032 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1342C>T (p.Gln448Ter) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021732] | Chr18:51076671 [GRCh38] Chr18:48603041 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1343_1365del (p.Gln448fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021733] | Chr18:51076672..51076694 [GRCh38] Chr18:48603042..48603064 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1361_1364del (p.Ala454fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002318946] | Chr18:51076690..51076693 [GRCh38] Chr18:48603060..48603063 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1409_1410insCCCT (p.Gly471fs) | insertion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021735] | Chr18:51076738..51076739 [GRCh38] Chr18:48603108..48603109 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1411_1435del (p.Gly471fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021736] | Chr18:51076740..51076764 [GRCh38] Chr18:48603110..48603134 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1421del (p.Gly473_Ser474insTer) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021737] | Chr18:51076750 [GRCh38] Chr18:48603120 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1472G>T (p.Gly491Val) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021738] | Chr18:51078280 [GRCh38] Chr18:48604650 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1478A>C (p.Asp493Ala) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021739] | Chr18:51078286 [GRCh38] Chr18:48604656 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1525T>A (p.Trp509Arg) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021740] | Chr18:51078333 [GRCh38] Chr18:48604703 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1527G>A (p.Trp509Ter) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021741] | Chr18:51078335 [GRCh38] Chr18:48604705 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1529G>T (p.Gly510Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002400831] | Chr18:51078337 [GRCh38] Chr18:48604707 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1544del (p.Arg515fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021743] | Chr18:51078352 [GRCh38] Chr18:48604722 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.1547_1550dupAGAG (p.Ser517Argfs) | microsatellite | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021744] | Chr18:51078354..51078355 [GRCh38] Chr18:48604724..48604725 [GRCh37] Chr18:18q21.2 |
pathogenic |
SMAD4:c.1550_1551insAGAG (p.Ser517delinsArgGluHisfs) | insertion | Juvenile polyposis syndrome [RCV000021745] | Chr18:51078358..51078359 [GRCh38] Chr18:48604728..48604729 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1564_1565del (p.Pro522fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021746] | Chr18:51078372..51078373 [GRCh38] Chr18:48604742..48604743 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1571G>T (p.Trp524Leu) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021747] | Chr18:51078379 [GRCh38] Chr18:48604749 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1587dup (p.His530fs) | duplication | Juvenile polyposis syndrome [RCV001387140] | Chr18:51078394..51078395 [GRCh38] Chr18:48604764..48604765 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1588del (p.His530fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021749] | Chr18:51078396 [GRCh38] Chr18:48604766 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1586_1587dup (p.His530fs) | duplication | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021750] | Chr18:51078393..51078394 [GRCh38] Chr18:48604763..48604764 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1594del (p.Ala532fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021751] | Chr18:51078400 [GRCh38] Chr18:48604770 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1596_1597delinsT (p.Leu533fs) | indel | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021752] | Chr18:51078404..51078405 [GRCh38] Chr18:48604774..48604775 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1597del (p.Leu533fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021753] | Chr18:51078403 [GRCh38] Chr18:48604773 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1597C>G (p.Leu533Val) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021754] | Chr18:51078405 [GRCh38] Chr18:48604775 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1598T>G (p.Leu533Arg) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021755] | Chr18:51078406 [GRCh38] Chr18:48604776 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1600C>T (p.Gln534Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596863] | Chr18:51078408 [GRCh38] Chr18:48604778 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1598T>C (p.Leu533Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV001991338] | Chr18:51078406 [GRCh38] Chr18:48604776 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1607dup (p.Asp537fs) | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021758] | Chr18:51078414..51078415 [GRCh38] Chr18:48604784..48604785 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1612_1625del (p.Glu538fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021759] | Chr18:51078418..51078431 [GRCh38] Chr18:48604788..48604801 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1139+274del | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000021760] | Chr18:51065877 [GRCh38] Chr18:48592247 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1072G>T (p.Gly358Ter) | single nucleotide variant | Carcinoma of pancreas [RCV000009062] | Chr18:51065539 [GRCh38] Chr18:48591909 [GRCh37] Chr18:18q21.2 |
pathogenic|other |
NM_005359.6(SMAD4):c.1236C>G (p.Tyr412Ter) | single nucleotide variant | Carcinoma of pancreas [RCV000009063] | Chr18:51067115 [GRCh38] Chr18:48593485 [GRCh37] Chr18:18q21.2 |
pathogenic|other |
NM_005359.6(SMAD4):c.1477G>C (p.Asp493His) | single nucleotide variant | Carcinoma of pancreas [RCV000009064] | Chr18:51078285 [GRCh38] Chr18:48604655 [GRCh37] Chr18:18q21.2 |
pathogenic|other |
NM_005359.6(SMAD4):c.1543A>T (p.Arg515Ter) | single nucleotide variant | Carcinoma of pancreas [RCV000009065] | Chr18:51078351 [GRCh38] Chr18:48604721 [GRCh37] Chr18:18q21.2 |
pathogenic|other |
SMAD4, 4-BP DEL, NT1372 | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000009066] | Chr18:18q21.1 | pathogenic |
SMAD4, 2-BP DEL | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000009067] | Chr18:18q21.1 | pathogenic |
SMAD4, 1-BP INS | insertion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000009068]|Juvenile polyposis of stomach [RCV000009069]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000009070] | Chr18:18q21.1 | pathogenic |
NM_005359.6(SMAD4):c.1081C>T (p.Arg361Cys) | single nucleotide variant | Breast neoplasm [RCV000424666]|Carcinoma of esophagus [RCV000435832]|Familial thoracic aortic aneurysm and aortic dissection [RCV002311508]|Gastric adenocarcinoma [RCV000419013]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000009071]|Juvenile polyposis syndrome [RCV001376609]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000009072]|Lung adenocarcinoma [RCV000429075]|Neoplasm of the large intestine [RCV000434956]|Neoplasm of uterine cervix [RCV000440366]|Pancreatic adenocarcinoma [RCV000419899]|SMAD4-related disorder [RCV003924819]|Squamous cell carcinoma of the head and neck [RCV000430148]|not provided [RCV000059732] | Chr18:51065548 [GRCh38] Chr18:48591918 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|not provided |
SMAD4, 2-BP DEL, 959AC | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000009073] | Chr18:18q21.1 | pathogenic |
NM_005359.6(SMAD4):c.1157G>A (p.Gly386Asp) | single nucleotide variant | Carcinoma of esophagus [RCV000435285]|Gastric adenocarcinoma [RCV000444854]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000009074]|Lung adenocarcinoma [RCV000431620]|Neoplasm of the large intestine [RCV000422272]|Pancreatic adenocarcinoma [RCV000425012]|Prostate adenocarcinoma [RCV000443856] | Chr18:51067036 [GRCh38] Chr18:48593406 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1054G>A (p.Gly352Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001731312]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000009075]|not provided [RCV000059731] | Chr18:51065521 [GRCh38] Chr18:48591891 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|not provided |
SMAD4, 14-BP DEL, NT1612 | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000009076] | Chr18:18q21.1 | pathogenic |
SMAD4, 2-BP DEL/1-BP INS, 1596CC/T | indel | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000009077] | Chr18:18q21.1 | pathogenic |
NM_005359.6(SMAD4):c.1448-10T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001190156]|Juvenile polyposis syndrome [RCV000552812]|not provided [RCV001696942] | Chr18:51078246 [GRCh38] Chr18:48604616 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1139+10G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002231353] | Chr18:51065616 [GRCh38] Chr18:48591986 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.525A>G (p.Glu175=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319040]|Juvenile polyposis syndrome [RCV001088063]|SMAD4-related disorder [RCV003960284]|not provided [RCV000756669] | Chr18:51054851 [GRCh38] Chr18:48581221 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.472G>T (p.Val158Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV002231364] | Chr18:51054798 [GRCh38] Chr18:48581168 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.464G>A (p.Ser155Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311918]|Juvenile polyposis syndrome [RCV000691266]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001085] | Chr18:51054790 [GRCh38] Chr18:48581160 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.566G>T (p.Arg189Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311929]|Hereditary cancer-predisposing syndrome [RCV000564479] | Chr18:51054892 [GRCh38] Chr18:48581262 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.905G>A (p.Trp302Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317329] | Chr18:51059866 [GRCh38] Chr18:48586236 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.479A>G (p.Asp160Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002341293]|Juvenile polyposis syndrome [RCV000557020]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999045]|not provided [RCV000996687] | Chr18:51054805 [GRCh38] Chr18:48581175 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.903del (p.Trp302fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002317322] | Chr18:51058455 [GRCh38] Chr18:48584825 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1254T>G (p.Ala418=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311851]|Juvenile polyposis syndrome [RCV002231358] | Chr18:51067133 [GRCh38] Chr18:48593503 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.425-5T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315233] | Chr18:51049290 [GRCh38] Chr18:48575660 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1632G>C (p.Pro544=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002231360] | Chr18:51078440 [GRCh38] Chr18:48604810 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.861T>C (p.His287=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311939]|Juvenile polyposis syndrome [RCV002060496] | Chr18:51058413 [GRCh38] Chr18:48584783 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.966T>C (p.Tyr322=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002377042]|Hereditary cancer-predisposing syndrome [RCV003584652]|Juvenile polyposis syndrome [RCV000546621]|not provided [RCV003478135] | Chr18:51065433 [GRCh38] Chr18:48591803 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.189A>G (p.Thr63=) | single nucleotide variant | Juvenile polyposis syndrome [RCV000547978]|SMAD4-related disorder [RCV003935421] | Chr18:51047235 [GRCh38] Chr18:48573605 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140-1G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002456004]|not provided [RCV000518874] | Chr18:51067018 [GRCh38] Chr18:48593388 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1534G>A (p.Asp512Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV002231359] | Chr18:51078342 [GRCh38] Chr18:48604712 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1159G>A (p.Val387Met) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311924]|Juvenile polyposis syndrome [RCV001226236] | Chr18:51067038 [GRCh38] Chr18:48593408 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1349_1376del (p.Gln450fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002315870]|Juvenile polyposis syndrome [RCV003762803] | Chr18:51076669..51076696 [GRCh38] Chr18:48603039..48603066 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.275_276del (p.His92fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002317330]|Juvenile polyposis syndrome [RCV003596041] | Chr18:51048711..51048712 [GRCh38] Chr18:48575081..48575082 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.894C>T (p.Pro298=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311910]|Hereditary cancer-predisposing syndrome [RCV000566413]|Juvenile polyposis syndrome [RCV001417499]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001081]|not provided [RCV000759351]|not specified [RCV001821680] | Chr18:51058446 [GRCh38] Chr18:48584816 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1059C>G (p.Tyr353Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002404587]|not provided [RCV000581805] | Chr18:51065526 [GRCh38] Chr18:48591896 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.702T>G (p.Ser234Arg) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000580278] | Chr18:51058159 [GRCh38] Chr18:48584529 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(?_48573411)_(48604843_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000529456] | Chr18:48573411..48604843 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1393G>T (p.Val465Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV000542466]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999041] | Chr18:51076722 [GRCh38] Chr18:48603092 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1138del (p.Arg380fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002323940]|Juvenile polyposis syndrome [RCV002231352] | Chr18:51065604 [GRCh38] Chr18:48591974 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.315C>T (p.His105=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315869]|Hereditary cancer-predisposing syndrome [RCV000564616] | Chr18:51048751 [GRCh38] Chr18:48575121 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1499T>C (p.Ile500Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001852006]|Myhre syndrome [RCV000023060]|not provided [RCV000059734] | Chr18:51078307 [GRCh38] Chr18:48604677 [GRCh37] Chr18:18q21.2 |
pathogenic|not provided |
NM_005359.6(SMAD4):c.1498A>G (p.Ile500Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558272]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000635427]|Intellectual disability [RCV001260808]|Juvenile polyposis syndrome [RCV001376590]|Myhre syndrome [RCV000023061]|Myhre syndrome [RCV000763031]|Myhre syndrome [RCV001249691]|Neurodevelopmental delay [RCV001375955]|not provided [RCV000059733] | Chr18:51078306 [GRCh38] Chr18:48604676 [GRCh37] Chr18:18q21.2 |
pathogenic|not provided |
NM_005359.6(SMAD4):c.1500A>G (p.Ile500Met) | single nucleotide variant | Myhre syndrome [RCV000023062]|not provided [RCV000059735] | Chr18:51078308 [GRCh38] Chr18:48604678 [GRCh37] Chr18:18q21.2 |
pathogenic|not provided |
NM_005359.6(SMAD4):c.1573A>G (p.Ile525Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV001170612]|Familial thoracic aortic aneurysm and aortic dissection [RCV002310997]|Gastrointestinal polyposis [RCV000148889]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000123259]|Hereditary cancer-predisposing syndrome [RCV000771070]|Juvenile polyposis syndrome [RCV001420980]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000383039]|Myhre syndrome [RCV000327173]|not provided [RCV000034710]|not specified [RCV000213006] | Chr18:51078381 [GRCh38] Chr18:48604751 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|conflicting data from submitters |
NM_005359.6(SMAD4):c.565C>T (p.Arg189Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310998]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000196842]|Hereditary cancer-predisposing syndrome [RCV000115884]|Juvenile polyposis syndrome [RCV001507132]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315550]|not provided [RCV000034711]|not specified [RCV000122057] | Chr18:51054891 [GRCh38] Chr18:48581261 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided |
GRCh38/hg38 18q21.1-23(chr18:50068129-80252149)x3 | copy number gain | See cases [RCV000050989] | Chr18:50068129..80252149 [GRCh38] Chr18:47594499..78010032 [GRCh37] Chr18:45848497..76111023 [NCBI36] Chr18:18q21.1-23 |
pathogenic |
GRCh38/hg38 18p11.32-q23(chr18:148963-80252149)x3 | copy number gain | See cases [RCV000051048] | Chr18:148963..80252149 [GRCh38] Chr18:148963..78010032 [GRCh37] Chr18:138963..76111023 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
GRCh38/hg38 18q11.1-23(chr18:20960320-80234429)x3 | copy number gain | See cases [RCV000052543] | Chr18:20960320..80234429 [GRCh38] Chr18:18540281..77992312 [GRCh37] Chr18:16794279..76093303 [NCBI36] Chr18:18q11.1-23 |
pathogenic |
GRCh38/hg38 18p11.32-q23(chr18:53345-80209986)x3 | copy number gain | See cases [RCV000052501] | Chr18:53345..80209986 [GRCh38] Chr18:53345..77967869 [GRCh37] Chr18:43345..76068860 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
GRCh38/hg38 18q11.1-23(chr18:20989762-80209986)x3 | copy number gain | See cases [RCV000052549] | Chr18:20989762..80209986 [GRCh38] Chr18:18569723..77967869 [GRCh37] Chr18:16823721..76068860 [NCBI36] Chr18:18q11.1-23 |
pathogenic |
GRCh38/hg38 18p11.32-q23(chr18:148763-80252290)x3 | copy number gain | See cases [RCV000052507] | Chr18:148763..80252290 [GRCh38] Chr18:148763..78010173 [GRCh37] Chr18:138763..76111164 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
GRCh38/hg38 18q12.1-22.1(chr18:29249202-65448117)x3 | copy number gain | Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052563]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052563]|See cases [RCV000052563] | Chr18:29249202..65448117 [GRCh38] Chr18:26829167..63115353 [GRCh37] Chr18:25083165..61266333 [NCBI36] Chr18:18q12.1-22.1 |
pathogenic |
GRCh38/hg38 18p11.32-q23(chr18:148963-80244381)x3 | copy number gain | See cases [RCV000052514] | Chr18:148963..80244381 [GRCh38] Chr18:148963..78002264 [GRCh37] Chr18:138963..76103255 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.38A>G (p.Asn13Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311543]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000662613]|Hereditary cancer-predisposing syndrome [RCV000561032]|Juvenile polyposis syndrome [RCV001293427]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315582]|Pulmonary hypertension, primary, 1 [RCV000488661]|not provided [RCV000059736]|not specified [RCV000122056] | Chr18:51047084 [GRCh38] Chr18:48573454 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance|not provided |
NM_005359.6(SMAD4):c.1549_1550del (p.Ser517fs) | microsatellite | Familial thoracic aortic aneurysm and aortic dissection [RCV002319075]|Juvenile polyposis syndrome [RCV001381916]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003472053]|not provided [RCV000657356] | Chr18:51078355..51078356 [GRCh38] Chr18:48604725..48604726 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1134_1135del (p.Arg378fs) | microsatellite | Familial thoracic aortic aneurysm and aortic dissection [RCV002325331]|Juvenile polyposis syndrome [RCV000698896]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004026002]|not provided [RCV000657385] | Chr18:51065596..51065597 [GRCh38] Chr18:48591966..48591967 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1308+2T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000662091]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000662093]|Myhre syndrome [RCV000662092] | Chr18:51067189 [GRCh38] Chr18:48593559 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.982dup (p.Tyr328fs) | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000021701] | Chr18:51065447..51065448 [GRCh38] Chr18:48591817..48591818 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1486C>T (p.Arg496Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311544]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000541839]|Hereditary cancer-predisposing syndrome [RCV003584539]|Juvenile polyposis syndrome [RCV002228175]|Moyamoya angiopathy [RCV001261800]|Myhre syndrome [RCV000074360]|Myhre syndrome [RCV002483120]|SMAD4-related disorder [RCV003398656]|not provided [RCV000160962] | Chr18:51078294 [GRCh38] Chr18:48604664 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.1351_1375del (p.Ala451fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002381421]|Hereditary cancer-predisposing syndrome [RCV000115881]|Juvenile polyposis syndrome [RCV003761747]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004019614]|not provided [RCV000235213] | Chr18:51076673..51076697 [GRCh38] Chr18:48603043..48603067 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity |
NM_005359.6(SMAD4):c.424+5G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV000770696]|Familial thoracic aortic aneurysm and aortic dissection [RCV002311002]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000204731]|Hereditary cancer-predisposing syndrome [RCV000115883]|Juvenile polyposis syndrome [RCV002228348]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000306889]|Myhre syndrome [RCV000346296]|not provided [RCV000656977]|not specified [RCV000213004] | Chr18:51048865 [GRCh38] Chr18:48575235 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.790A>G (p.Ser264Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002415593]|Juvenile polyposis syndrome [RCV003595862]|not provided [RCV000115885] | Chr18:51058342 [GRCh38] Chr18:48584712 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.228A>G (p.Arg76=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311006]|Hereditary cancer-predisposing syndrome [RCV000165905]|Juvenile polyposis syndrome [RCV001084830]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997307]|not provided [RCV000760074]|not specified [RCV000601814] | Chr18:51047274 [GRCh38] Chr18:48573644 [GRCh37] Chr18:18q21.2 |
benign|likely benign|uncertain significance |
NM_005359.5(SMAD4):c.(?_-1)_249+?dup | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000123257] | Chr18:51047046..51047295 [GRCh38] Chr18:48573416..48573665 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance|not provided |
NM_005359.5:c.1448-?_1659+?dup | duplication | Juvenile polyposis syndrome [RCV000123258] | Chr18:18q21.2 | not provided |
NM_005359.6(SMAD4):c.1606C>T (p.Leu536=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002399492]|Hereditary cancer-predisposing syndrome [RCV003584555]|Juvenile polyposis syndrome [RCV000123260]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997421] | Chr18:51078414 [GRCh38] Chr18:48604784 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1653A>G (p.Leu551=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310679]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000123261]|Hereditary cancer-predisposing syndrome [RCV000162721]|Juvenile polyposis syndrome [RCV001450073]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125528]|Myhre syndrome [RCV001125527]|SMAD4-related disorder [RCV003894971]|not provided [RCV000858658]|not specified [RCV000439984] | Chr18:51078461 [GRCh38] Chr18:48604831 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.31A>G (p.Thr11Ala) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000123262] | Chr18:51047077 [GRCh38] Chr18:48573447 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.575C>T (p.Thr192Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312542]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000123263]|Hereditary cancer-predisposing syndrome [RCV000575742]|Juvenile polyposis syndrome [RCV001293440]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315821]|not provided [RCV000236059] | Chr18:51054901 [GRCh38] Chr18:48581271 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.671A>T (p.Gln224Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310680]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000123264]|Hereditary cancer-predisposing syndrome [RCV003584556]|Juvenile polyposis syndrome [RCV001358798]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315822]|Myhre syndrome [RCV002483236]|SMAD4-related disorder [RCV003422007]|not provided [RCV000986028] | Chr18:51058128 [GRCh38] Chr18:48584498 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.880A>G (p.Met294Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310678]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000195767]|Hereditary cancer-predisposing syndrome [RCV000129038]|Juvenile polyposis syndrome [RCV001450076]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315778]|SMAD4-related disorder [RCV003925209]|not provided [RCV000586799]|not specified [RCV000122058] | Chr18:51058432 [GRCh38] Chr18:48584802 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided |
NM_005359.6(SMAD4):c.947A>G (p.Asn316Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV000770697]|Familial thoracic aortic aneurysm and aortic dissection [RCV002311007]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000411125]|Hereditary cancer-predisposing syndrome [RCV000132146]|Juvenile polyposis syndrome [RCV001358781]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315779]|not provided [RCV000657009]|not specified [RCV000122059] | Chr18:51059908 [GRCh38] Chr18:48586278 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided |
NM_005359.6(SMAD4):c.1086T>C (p.Phe362=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV000770698]|Familial thoracic aortic aneurysm and aortic dissection [RCV002310676]|Generalized juvenile polyposis/juvenile polyposis coli [RCV001083846]|Hereditary cancer-predisposing syndrome [RCV000128172]|Juvenile polyposis syndrome [RCV001507168]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000273483]|Myhre syndrome [RCV000388633]|not provided [RCV000587945]|not specified [RCV000213005] | Chr18:51065553 [GRCh38] Chr18:48591923 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|conflicting data from submitters |
NM_005359.6(SMAD4):c.1392C>T (p.Ala464=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310677]|Generalized juvenile polyposis/juvenile polyposis coli [RCV001081790]|Hereditary cancer-predisposing syndrome [RCV000163069]|Juvenile polyposis syndrome [RCV001507176]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127538]|Myhre syndrome [RCV001127537]|not provided [RCV000588941]|not specified [RCV000428000] | Chr18:51076721 [GRCh38] Chr18:48603091 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.1358C>T (p.Thr453Ile) | single nucleotide variant | not provided [RCV000171276] | Chr18:51076687 [GRCh38] Chr18:48603057 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.455-6A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001083669]|Hereditary cancer-predisposing syndrome [RCV000580717]|Juvenile polyposis syndrome [RCV001507245]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000303525]|Myhre syndrome [RCV000343024]|not provided [RCV003477534]|not specified [RCV000153972] | Chr18:51054775 [GRCh38] Chr18:48581145 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_005359.6(SMAD4):c.1140-10T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002453458]|Generalized juvenile polyposis/juvenile polyposis coli [RCV001080462]|Hereditary cancer-predisposing syndrome [RCV000579485]|Juvenile polyposis syndrome [RCV001507129]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127535]|Myhre syndrome [RCV001127536]|Myhre syndrome [RCV002492489]|not provided [RCV000586605]|not specified [RCV000128173] | Chr18:51067009 [GRCh38] Chr18:48593379 [GRCh37] Chr18:18q21.2 |
benign|likely benign|uncertain significance |
NM_005359.6(SMAD4):c.*11C>T | single nucleotide variant | Carcinoma of colon [RCV001354685]|Familial thoracic aortic aneurysm and aortic dissection [RCV000770700]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000338717]|Hereditary cancer-predisposing syndrome [RCV000581104]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000281314]|Myhre syndrome [RCV000398463]|not provided [RCV001699207]|not specified [RCV000128174] | Chr18:51078478 [GRCh38] Chr18:48604848 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_005359.6(SMAD4):c.249+9T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000409145]|Juvenile polyposis syndrome [RCV001420974]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316514] | Chr18:51047304 [GRCh38] Chr18:48573674 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-75G>A | single nucleotide variant | not provided [RCV001565097] | Chr18:51058050 [GRCh38] Chr18:48584420 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1547dup (p.Ser517fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002399512]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000144660]|Juvenile polyposis syndrome [RCV002228678]|not provided [RCV000657426] | Chr18:51078354..51078355 [GRCh38] Chr18:48604724..48604725 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1633A>G (p.Ile545Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001348852] | Chr18:51078441 [GRCh38] Chr18:48604811 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.865C>A (p.Gln289Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001294481] | Chr18:51058417 [GRCh38] Chr18:48584787 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1216G>A (p.Ala406Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002354447]|not provided [RCV000173811] | Chr18:51067095 [GRCh38] Chr18:48593465 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.175A>G (p.Thr59Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310716]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000411833]|Hereditary cancer-predisposing syndrome [RCV000130371]|Juvenile polyposis syndrome [RCV002228494]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315889] | Chr18:51047221 [GRCh38] Chr18:48573591 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.746_747delinsCC (p.Gln249Pro) | indel | Familial thoracic aortic aneurysm and aortic dissection [RCV002311017]|Hereditary cancer-predisposing syndrome [RCV000130885]|Juvenile polyposis syndrome [RCV001081446]|not provided [RCV000586288]|not specified [RCV004562296] | Chr18:51058203..51058204 [GRCh38] Chr18:48584573..48584574 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.1106A>G (p.Asn369Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311018]|Hereditary cancer-predisposing syndrome [RCV000131130]|Isolated thoracic aortic aneurysm [RCV001374834]|Juvenile polyposis syndrome [RCV000555043]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474774]|Myhre syndrome [RCV002478399]|not provided [RCV000679584]|not specified [RCV004525878] | Chr18:51065573 [GRCh38] Chr18:48591943 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1245_1248del (p.Asp415Glufs) | deletion | Carcinoma of colon [RCV001357425]|Familial thoracic aortic aneurysm and aortic dissection [RCV002311019]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000205495]|Hereditary cancer-predisposing syndrome [RCV000131266]|Juvenile polyposis syndrome [RCV001376606]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003485541]|Myhre syndrome [RCV000768095]|Myhre syndrome [RCV003227672]|not provided [RCV000254690] | Chr18:51067121..51067124 [GRCh38] Chr18:48593491..48593494 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.5(SMAD4):c.1344_1368del25 (p.Ala451Leufs) | deletion | Hereditary cancer-predisposing syndrome [RCV000131747]|Neoplastic Syndromes, Hereditary [RCV000131747] | Chr18:51076673..51076697 [GRCh38] Chr18:48603043..48603067 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1447+4dup | duplication | Hereditary cancer-predisposing syndrome [RCV000131763] | Chr18:51076778..51076779 [GRCh38] Chr18:48603148..48603149 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1139+2dup | duplication | Hereditary cancer-predisposing syndrome [RCV000132014] | Chr18:51065607..51065608 [GRCh38] Chr18:48591977..48591978 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1345C>T (p.Gln449Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310714]|Hereditary cancer-predisposing syndrome [RCV000129151]|Juvenile polyposis syndrome [RCV001386506] | Chr18:51076674 [GRCh38] Chr18:48603044 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1635T>G (p.Ile545Met) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310715]|Hereditary cancer-predisposing syndrome [RCV000129652]|Juvenile polyposis syndrome [RCV000635470]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997515]|not provided [RCV001550801] | Chr18:51078443 [GRCh38] Chr18:48604813 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+1G>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000129707] | Chr18:51067188 [GRCh38] Chr18:48593558 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1448-5G>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000129765]|Juvenile polyposis syndrome [RCV001419460] | Chr18:51078251 [GRCh38] Chr18:48604621 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
GRCh38/hg38 18p11.32-q23(chr18:149089-80234391)x3 | copy number gain | See cases [RCV000134110] | Chr18:149089..80234391 [GRCh38] Chr18:149089..77992274 [GRCh37] Chr18:139089..76093265 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
GRCh38/hg38 18q12.2-22.1(chr18:38794728-65632804)x3 | copy number gain | See cases [RCV000136910] | Chr18:38794728..65632804 [GRCh38] Chr18:36374692..63300040 [GRCh37] Chr18:34628690..61451020 [NCBI36] Chr18:18q12.2-22.1 |
pathogenic |
GRCh38/hg38 18q12.1-23(chr18:32123105-80252149)x3 | copy number gain | See cases [RCV000136890] | Chr18:32123105..80252149 [GRCh38] Chr18:29703068..78010032 [GRCh37] Chr18:27957066..76111023 [NCBI36] Chr18:18q12.1-23 |
pathogenic |
GRCh38/hg38 18q21.1-23(chr18:49199411-80254946)x3 | copy number gain | See cases [RCV000137342] | Chr18:49199411..80254946 [GRCh38] Chr18:46725781..78012829 [GRCh37] Chr18:44979779..76113817 [NCBI36] Chr18:18q21.1-23 |
pathogenic |
GRCh38/hg38 18q12.3-23(chr18:42651392-80254946)x3 | copy number gain | See cases [RCV000138034] | Chr18:42651392..80254946 [GRCh38] Chr18:40231357..78012829 [GRCh37] Chr18:38485355..76113817 [NCBI36] Chr18:18q12.3-23 |
pathogenic |
GRCh38/hg38 18p11.32-q23(chr18:118760-80254946)x3 | copy number gain | See cases [RCV000138656] | Chr18:118760..80254946 [GRCh38] Chr18:118760..78012829 [GRCh37] Chr18:108760..76113817 [NCBI36] Chr18:18p11.32-q23 |
pathogenic|conflicting data from submitters |
GRCh38/hg38 18p11.32-q23(chr18:149089-80254936)x3 | copy number gain | See cases [RCV000139397] | Chr18:149089..80254936 [GRCh38] Chr18:149089..78012819 [GRCh37] Chr18:139089..76113807 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
GRCh38/hg38 18p11.32-q23(chr18:136227-80256240)x3 | copy number gain | See cases [RCV000142244] | Chr18:136227..80256240 [GRCh38] Chr18:136227..78014123 [GRCh37] Chr18:126227..76115097 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
GRCh38/hg38 18q12.3-23(chr18:40367455-80256240)x3 | copy number gain | See cases [RCV000142227] | Chr18:40367455..80256240 [GRCh38] Chr18:37947419..78014123 [GRCh37] Chr18:36201417..76115097 [NCBI36] Chr18:18q12.3-23 |
pathogenic |
GRCh38/hg38 18q11.1-22.3(chr18:20962119-74691446)x3 | copy number gain | See cases [RCV000143057] | Chr18:20962119..74691446 [GRCh38] Chr18:18542080..72403402 [GRCh37] Chr18:16796078..70532390 [NCBI36] Chr18:18q11.1-22.3 |
pathogenic |
GRCh38/hg38 18p11.32-q23(chr18:136226-80256240)x3 | copy number gain | See cases [RCV000143218] | Chr18:136226..80256240 [GRCh38] Chr18:136226..78014123 [GRCh37] Chr18:126226..76115097 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
GRCh38/hg38 18p11.32-q23(chr18:148963-80252149)x3 | copy number gain | See cases [RCV000148072] | Chr18:148963..80252149 [GRCh38] Chr18:148963..78010032 [GRCh37] Chr18:138963..76111023 [NCBI36] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.326delinsAAATATGAAC (p.Leu109delinsGlnIleTer) | indel | not provided [RCV000153948] | Chr18:51048762 [GRCh38] Chr18:48575132 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1231_1232del (p.Ser411fs) | microsatellite | Juvenile polyposis syndrome [RCV001054868]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003462106]|not provided [RCV000160956] | Chr18:51067108..51067109 [GRCh38] Chr18:48593478..48593479 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.607C>G (p.Pro203Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002313013]|Hereditary cancer-predisposing syndrome [RCV000561819]|Juvenile polyposis syndrome [RCV000534543]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474835]|not provided [RCV000160958] | Chr18:51054933 [GRCh38] Chr18:48581303 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.677C>T (p.Ala226Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312690]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000199953]|Hereditary cancer-predisposing syndrome [RCV000449407]|Juvenile polyposis syndrome [RCV001420989]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000260140]|Myhre syndrome [RCV000334040]|Myhre syndrome [RCV000515353]|Myhre syndrome [RCV003483531]|not provided [RCV000160959] | Chr18:51058134 [GRCh38] Chr18:48584504 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided |
NM_005359.6(SMAD4):c.917A>G (p.Asn306Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310721]|Hereditary cancer-predisposing syndrome [RCV000217266]|Juvenile polyposis syndrome [RCV000468723]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003998531]|Myhre syndrome [RCV002485004]|not provided [RCV000656978]|not specified [RCV000160960] | Chr18:51059878 [GRCh38] Chr18:48586248 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1239C>A (p.Tyr413Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV001850275]|not provided [RCV000160963] | Chr18:51067118 [GRCh38] Chr18:48593488 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1634T>A (p.Ile545Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312691]|Juvenile polyposis syndrome [RCV000686325]|not provided [RCV000160964] | Chr18:51078442 [GRCh38] Chr18:48604812 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1258_1259dup (p.Ala421fs) | duplication | Hereditary cancer-predisposing syndrome [RCV000160965]|Juvenile polyposis syndrome [RCV001052787] | Chr18:51067135..51067136 [GRCh38] Chr18:48593505..48593506 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1338_1339del (p.Gln446fs) | deletion | not provided [RCV000160966] | Chr18:51076666..51076667 [GRCh38] Chr18:48603036..48603037 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.466ATG[1] (p.Met157del) | microsatellite | Familial thoracic aortic aneurysm and aortic dissection [RCV002310735]|Juvenile polyposis syndrome [RCV000532091]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474860] | Chr18:51054792..51054794 [GRCh38] Chr18:48581162..48581164 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1046C>T (p.Thr349Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310736]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000197959]|Hereditary cancer-predisposing syndrome [RCV000164559]|Juvenile polyposis syndrome [RCV001328514]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316025]|not provided [RCV001770124] | Chr18:51065513 [GRCh38] Chr18:48591883 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.776C>T (p.Thr259Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310737] | Chr18:51058233 [GRCh38] Chr18:48584603 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.898_904+1dup | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002310738] | Chr18:51058449..51058450 [GRCh38] Chr18:48584819..48584820 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.104T>C (p.Phe35Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310739] | Chr18:51047150 [GRCh38] Chr18:48573520 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.743A>T (p.Gln248Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310740]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000196374]|Hereditary cancer-predisposing syndrome [RCV000164798]|Juvenile polyposis syndrome [RCV001328522]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316029]|not provided [RCV001508829] | Chr18:51058200 [GRCh38] Chr18:48584570 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.153dup (p.Asp52fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002312693]|Juvenile polyposis syndrome [RCV000695541]|not provided [RCV000478516] | Chr18:51047193..51047194 [GRCh38] Chr18:48573563..48573564 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.599T>C (p.Leu200Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312694] | Chr18:51054925 [GRCh38] Chr18:48581295 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.474G>A (p.Val158=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311023]|Juvenile polyposis syndrome [RCV001451527]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003995402] | Chr18:51054800 [GRCh38] Chr18:48581170 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1248A>G (p.Arg416=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311024]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000412222]|Juvenile polyposis syndrome [RCV001446529]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316041]|not provided [RCV003477615] | Chr18:51067127 [GRCh38] Chr18:48593497 [GRCh37] Chr18:18q21.2 |
benign|likely benign|uncertain significance |
NM_005359.6(SMAD4):c.102A>G (p.Thr34=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310722]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000409431]|Hereditary cancer-predisposing syndrome [RCV000162365]|Juvenile polyposis syndrome [RCV001507225]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315970]|not provided [RCV000679583]|not specified [RCV000438148] | Chr18:51047148 [GRCh38] Chr18:48573518 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_005359.6(SMAD4):c.20C>T (p.Thr7Met) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310723]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000196213]|Hereditary cancer-predisposing syndrome [RCV000162438]|Juvenile polyposis syndrome [RCV001328507]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123230]|Myhre syndrome [RCV000764159]|Myhre syndrome [RCV001123231]|Pulmonary arterial hypertension [RCV002285148]|SMAD4-related disorder [RCV003398830]|not provided [RCV000589285]|not specified [RCV002468936] | Chr18:51047066 [GRCh38] Chr18:48573436 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.852A>G (p.Gln284=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310724]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000200571]|Generalized juvenile polyposis/juvenile polyposis coli [RCV003330520]|Hereditary cancer-predisposing syndrome [RCV000162465]|Juvenile polyposis syndrome [RCV001450056]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124423]|Myhre syndrome [RCV001124424]|not provided [RCV000589728]|not specified [RCV000417748] | Chr18:51058404 [GRCh38] Chr18:48584774 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided |
NM_005359.6(SMAD4):c.276T>C (p.His92=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310725]|Hereditary cancer-predisposing syndrome [RCV000162560]|Juvenile polyposis syndrome [RCV001084691]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003995202]|not provided [RCV000590687] | Chr18:51048712 [GRCh38] Chr18:48575082 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1547A>G (p.Gln516Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311025]|Juvenile polyposis syndrome [RCV002516479] | Chr18:51078355 [GRCh38] Chr18:48604725 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.535A>G (p.Ile179Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311026]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000233612]|Hereditary cancer-predisposing syndrome [RCV000165366]|Juvenile polyposis syndrome [RCV001293445]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV002470782]|Myhre syndrome [RCV000764161]|not provided [RCV000236451] | Chr18:51054861 [GRCh38] Chr18:48581231 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.483A>G (p.Glu161=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000162711]|Juvenile polyposis syndrome [RCV001070710] | Chr18:51054809 [GRCh38] Chr18:48581179 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.940A>G (p.Ile314Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310726]|Hereditary cancer-predisposing syndrome [RCV000162740]|Juvenile polyposis syndrome [RCV000462441]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474847]|not provided [RCV002277319] | Chr18:51059901 [GRCh38] Chr18:48586271 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.21G>A (p.Thr7=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310727]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000412290]|Hereditary cancer-predisposing syndrome [RCV000162750]|Juvenile polyposis syndrome [RCV001450081]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124331]|Myhre syndrome [RCV001124332]|SMAD4-related disorder [RCV003927534]|not provided [RCV000760073]|not specified [RCV002222413] | Chr18:51047067 [GRCh38] Chr18:48573437 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.1139+3A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311027]|Juvenile polyposis syndrome [RCV001052725] | Chr18:51065609 [GRCh38] Chr18:48591979 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.5(SMAD4):c.1571_1574delGGATins19 (p.?) | indel | Hereditary cancer-predisposing syndrome [RCV000165521] | Chr18:51078379..51078382 [GRCh38] Chr18:48604749..48604752 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.231A>G (p.Thr77=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310728]|Hereditary cancer-predisposing syndrome [RCV000162808]|Juvenile polyposis syndrome [RCV001422393] | Chr18:51047277 [GRCh38] Chr18:48573647 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1242dup (p.Asp415fs) | duplication | Hereditary cancer-predisposing syndrome [RCV000163070] | Chr18:51067120..51067121 [GRCh38] Chr18:48593490..48593491 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1422A>C (p.Ser474=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310729]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000412158]|Hereditary cancer-predisposing syndrome [RCV000163190]|Juvenile polyposis syndrome [RCV001450084]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003315990]|not provided [RCV000679585]|not specified [RCV000781851] | Chr18:51076751 [GRCh38] Chr18:48603121 [GRCh37] Chr18:18q21.2 |
benign|likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1561A>C (p.Thr521Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312695] | Chr18:51078369 [GRCh38] Chr18:48604739 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1310T>G (p.Val437Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312696] | Chr18:51076639 [GRCh38] Chr18:48603009 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.875C>T (p.Pro292Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310731]|Hereditary cancer-predisposing syndrome [RCV000163557]|Juvenile polyposis syndrome [RCV000469746]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474849]|Nephroblastoma [RCV000761013]|not provided [RCV001589026] | Chr18:51058427 [GRCh38] Chr18:48584797 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.484T>C (p.Tyr162His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312692]|Juvenile polyposis syndrome [RCV001347025] | Chr18:51054810 [GRCh38] Chr18:48581180 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1461T>A (p.Ala487=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310732]|Hereditary cancer-predisposing syndrome [RCV000163835]|Juvenile polyposis syndrome [RCV000199216]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003995288]|SMAD4-related disorder [RCV003937501]|not specified [RCV000608517] | Chr18:51078269 [GRCh38] Chr18:48604639 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.647A>G (p.Asn216Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310733]|Hereditary cancer-predisposing syndrome [RCV000164044]|Juvenile polyposis syndrome [RCV000686995] | Chr18:51054973 [GRCh38] Chr18:48581343 [GRCh37] Chr18:18q21.2 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.1393G>A (p.Val465Met) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310734]|Hereditary cancer-predisposing syndrome [RCV000772720]|Juvenile polyposis syndrome [RCV000527871]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474854] | Chr18:51076722 [GRCh38] Chr18:48603092 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1448G>A (p.Ser483Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002390398]|Juvenile polyposis syndrome [RCV001371135] | Chr18:51078256 [GRCh38] Chr18:48604626 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1354_1381dup (p.Gln461fs) | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000168084]|Juvenile polyposis syndrome [RCV001389136] | Chr18:51076682..51076683 [GRCh38] Chr18:48603052..48603053 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.172A>G (p.Ile58Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312697]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000168179]|Hereditary cancer-predisposing syndrome [RCV000573396]|Juvenile polyposis syndrome [RCV001358793]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316067]|Myhre syndrome [RCV002505218]|not provided [RCV001753578]|not specified [RCV001818403] | Chr18:51047218 [GRCh38] Chr18:48573588 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.521C>A (p.Thr174Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002312698]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000168261]|Hereditary cancer-predisposing syndrome [RCV000567416]|Juvenile polyposis syndrome [RCV001312225]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316069]|not provided [RCV000236619]|not specified [RCV002281990] | Chr18:51054847 [GRCh38] Chr18:48581217 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
GRCh37/hg19 18p11.32-q23(chr18:163323-78005236)x3 | copy number gain | See cases [RCV000240130] | Chr18:163323..78005236 [GRCh37] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.1059C>T (p.Tyr353=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317724]|Hereditary cancer-predisposing syndrome [RCV000775645]|Juvenile polyposis syndrome [RCV000196990]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003996963]|not specified [RCV000424497] | Chr18:51065526 [GRCh38] Chr18:48591896 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.871C>T (p.His291Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315629]|Juvenile polyposis syndrome [RCV001369785]|not provided [RCV000481584] | Chr18:51058423 [GRCh38] Chr18:48584793 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.956-3T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317727]|Hereditary cancer-predisposing syndrome [RCV000568565]|Juvenile polyposis syndrome [RCV000198197]|not provided [RCV001618344]|not specified [RCV002228920] | Chr18:51065420 [GRCh38] Chr18:48591790 [GRCh37] Chr18:18q21.2 |
benign|likely benign|uncertain significance |
NM_005359.5(SMAD4):c.(?_-1)_(*1_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000198538] | Chr18:18q21.2 | pathogenic |
NM_005359.6(SMAD4):c.634G>A (p.Ala212Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558449]|Juvenile polyposis syndrome [RCV002229494] | Chr18:51054960 [GRCh38] Chr18:48581330 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.693C>T (p.Gly231=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315626]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000198986]|Hereditary cancer-predisposing syndrome [RCV000564853]|Juvenile polyposis syndrome [RCV001450082]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316107]|SMAD4-related disorder [RCV003955206]|not provided [RCV000756668]|not specified [RCV000423609] | Chr18:51058150 [GRCh38] Chr18:48584520 [GRCh37] Chr18:18q21.2 |
likely pathogenic|benign|likely benign |
NM_005359.6(SMAD4):c.127T>G (p.Leu43Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002381691]|Juvenile polyposis syndrome [RCV001368504] | Chr18:51047173 [GRCh38] Chr18:48573543 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.375T>C (p.Ser125=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318957]|Hereditary cancer-predisposing syndrome [RCV000771623]|Juvenile polyposis syndrome [RCV000200777]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003996964]|not provided [RCV001705151] | Chr18:51048811 [GRCh38] Chr18:48575181 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1142T>A (p.Leu381Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV001387505] | Chr18:51067021 [GRCh38] Chr18:48593391 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1301A>G (p.Tyr434Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001211678]|not provided [RCV001751387] | Chr18:51067180 [GRCh38] Chr18:48593550 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+3A>G | single nucleotide variant | Abnormal bleeding [RCV001270578] | Chr18:51058459 [GRCh38] Chr18:48584829 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.460T>G (p.Ser154Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002336554]|Juvenile polyposis syndrome [RCV000204541] | Chr18:51054786 [GRCh38] Chr18:48581156 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.454+8A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV001451987] | Chr18:51049332 [GRCh38] Chr18:48575702 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-9C>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000204818] | Chr18:51047038 [GRCh38] Chr18:48573408 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.924T>C (p.Leu308=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310797]|Hereditary cancer-predisposing syndrome [RCV000222934]|Juvenile polyposis syndrome [RCV000205432]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997622] | Chr18:51059885 [GRCh38] Chr18:48586255 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1423G>C (p.Val475Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001323692] | Chr18:51076752 [GRCh38] Chr18:48603122 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1515del (p.Phe505fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000205617]|Juvenile polyposis syndrome [RCV001388771] | Chr18:51078320 [GRCh38] Chr18:48604690 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1444A>G (p.Ile482Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002390555]|Juvenile polyposis syndrome [RCV000205846]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997667] | Chr18:51076773 [GRCh38] Chr18:48603143 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.606C>G (p.Ala202=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311320]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000205905]|Hereditary cancer-predisposing syndrome [RCV000565190]|Juvenile polyposis syndrome [RCV001450086]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316137]|not provided [RCV000589241]|not specified [RCV000437821] | Chr18:51054932 [GRCh38] Chr18:48581302 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.910G>A (p.Val304Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002372194]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000203937]|Hereditary cancer-predisposing syndrome [RCV003584565]|Juvenile polyposis syndrome [RCV001328505]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316126]|not provided [RCV001753607] | Chr18:51059871 [GRCh38] Chr18:48586241 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.955+7G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582845]|Juvenile polyposis syndrome [RCV000204004]|not provided [RCV000986033] | Chr18:51059923 [GRCh38] Chr18:48586293 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.1287C>T (p.Ile429=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002384079]|Hereditary cancer-predisposing syndrome [RCV000583380]|Juvenile polyposis syndrome [RCV001426049] | Chr18:51067166 [GRCh38] Chr18:48593536 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.449G>A (p.Ser150Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319039]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000553373]|Juvenile polyposis syndrome [RCV001328515]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316697] | Chr18:51049319 [GRCh38] Chr18:48575689 [GRCh37] Chr18:18q21.2 |
benign|uncertain significance |
NM_005359.6(SMAD4):c.192T>C (p.Asn64=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002413482]|Hereditary cancer-predisposing syndrome [RCV003584648]|Juvenile polyposis syndrome [RCV002231361] | Chr18:51047238 [GRCh38] Chr18:48573608 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.939C>T (p.Pro313=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315872]|Juvenile polyposis syndrome [RCV000635515] | Chr18:51059900 [GRCh38] Chr18:48586270 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1280A>G (p.His427Arg) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000579469] | Chr18:51067159 [GRCh38] Chr18:48593529 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.491A>G (p.His164Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311327]|Juvenile polyposis syndrome [RCV000812644]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003475027] | Chr18:51054817 [GRCh38] Chr18:48581187 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.23A>G (p.Asn8Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310804]|Juvenile polyposis syndrome [RCV002229220]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997838] | Chr18:51047069 [GRCh38] Chr18:48573439 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1647A>G (p.Gln549=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311064]|Hereditary cancer-predisposing syndrome [RCV000213128]|Juvenile polyposis syndrome [RCV001087208]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997939]|not provided [RCV000587303]|not specified [RCV000428814] | Chr18:51078455 [GRCh38] Chr18:48604825 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.565C>G (p.Arg189Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310806]|Juvenile polyposis syndrome [RCV001853519] | Chr18:51054891 [GRCh38] Chr18:48581261 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.507G>A (p.Gln169=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310811]|Juvenile polyposis syndrome [RCV001464498] | Chr18:51054833 [GRCh38] Chr18:48581203 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.297G>A (p.Trp99Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311328]|Juvenile polyposis syndrome [RCV001778811] | Chr18:51048733 [GRCh38] Chr18:48575103 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1448-6T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV001045558]|Pulmonary hypertension, primary, 1 [RCV000488790] | Chr18:51078250 [GRCh38] Chr18:48604620 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1155A>G (p.Lys385=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311934]|Hereditary cancer-predisposing syndrome [RCV000562357]|Juvenile polyposis syndrome [RCV000635522]|not specified [RCV000588020] | Chr18:51067034 [GRCh38] Chr18:48593404 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1487G>A (p.Arg496His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311326]|Hereditary cancer-predisposing syndrome [RCV000213350]|Juvenile polyposis syndrome [RCV001853605] | Chr18:51078295 [GRCh38] Chr18:48604665 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.369T>C (p.Cys123=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310802]|Hereditary cancer-predisposing syndrome [RCV000771472]|Juvenile polyposis syndrome [RCV000230819]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997810]|not provided [RCV000600299] | Chr18:51048805 [GRCh38] Chr18:48575175 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.591C>G (p.Thr197=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311921]|Juvenile polyposis syndrome [RCV001398307] | Chr18:51054917 [GRCh38] Chr18:48581287 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.930C>G (p.Phe310Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310801]|Hereditary cancer-predisposing syndrome [RCV000213480]|Juvenile polyposis syndrome [RCV001857758] | Chr18:51059891 [GRCh38] Chr18:48586261 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.344G>A (p.Cys115Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311324] | Chr18:51048780 [GRCh38] Chr18:48575150 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1642C>G (p.Pro548Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310809] | Chr18:51078450 [GRCh38] Chr18:48604820 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.931C>T (p.Gln311Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310805] | Chr18:51059892 [GRCh38] Chr18:48586262 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.736C>A (p.Pro246Thr) | single nucleotide variant | Early age onset of sporadic thoracic aortic dissections [RCV001261774]|Familial thoracic aortic aneurysm and aortic dissection [RCV002311325]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000689822]|Hereditary cancer-predisposing syndrome [RCV000220373]|Heritable Thoracic Aortic Disease [RCV000678043]|Juvenile polyposis syndrome [RCV001312210]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124420]|Myhre syndrome [RCV001123336]|not provided [RCV001762494] | Chr18:51058193 [GRCh38] Chr18:48584563 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1585_1586dup (p.Leu529fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002311329] | Chr18:51078392..51078393 [GRCh38] Chr18:48604762..48604763 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1200G>T (p.Arg400Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310803]|Juvenile polyposis syndrome [RCV000800698]|not provided [RCV003221866] | Chr18:51067079 [GRCh38] Chr18:48593449 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1554C>T (p.Ile518=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310815]|Juvenile polyposis syndrome [RCV002054991] | Chr18:51078362 [GRCh38] Chr18:48604732 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1562C>T (p.Thr521Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311323]|Juvenile polyposis syndrome [RCV002229282] | Chr18:51078370 [GRCh38] Chr18:48604740 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1218G>A (p.Ala406=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311063]|Hereditary cancer-predisposing syndrome [RCV000220772]|Juvenile polyposis syndrome [RCV001081424]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003997938]|SMAD4-related disorder [RCV003891796]|not provided [RCV000589974]|not specified [RCV000436523] | Chr18:51067097 [GRCh38] Chr18:48593467 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.250-589A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000208948] | Chr18:51048097 [GRCh38] Chr18:48574467 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-1921T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209006] | Chr18:51052860 [GRCh38] Chr18:48579230 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.90A>G (p.Gly30=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310814]|Juvenile polyposis syndrome [RCV002515717] | Chr18:51047136 [GRCh38] Chr18:48573506 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.153del (p.Asp52fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002310818] | Chr18:51047194 [GRCh38] Chr18:48573564 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.-127-3318A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000208911] | Chr18:51043602 [GRCh38] Chr18:48569972 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+54T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000208985] | Chr18:51055047 [GRCh38] Chr18:48581417 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.798C>T (p.Thr266=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310817]|Juvenile polyposis syndrome [RCV001426253]|not specified [RCV001194134] | Chr18:51058350 [GRCh38] Chr18:48584720 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1405A>G (p.Ile469Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310808]|Juvenile polyposis syndrome [RCV002229551]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004567541]|not provided [RCV001800550] | Chr18:51076734 [GRCh38] Chr18:48603104 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+623C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209025] | Chr18:51067810 [GRCh38] Chr18:48594180 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.424+165A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209030] | Chr18:51049025 [GRCh38] Chr18:48575395 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-128+540A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209119] | Chr18:51031163 [GRCh38] Chr18:48557533 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-127-135A>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209214] | Chr18:51046785 [GRCh38] Chr18:48573155 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-1111A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209225] | Chr18:51057014 [GRCh38] Chr18:48583384 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-128+759G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209288] | Chr18:51031382 [GRCh38] Chr18:48557752 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+4116C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209444] | Chr18:51071303 [GRCh38] Chr18:48597673 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+298T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209564] | Chr18:51058754 [GRCh38] Chr18:48585124 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-128+1995A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209673] | Chr18:51032618 [GRCh38] Chr18:48558988 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+299T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209718] | Chr18:51055292 [GRCh38] Chr18:48581662 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-127-4838G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209310] | Chr18:51042082 [GRCh38] Chr18:48568452 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+291T>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209350] | Chr18:51049615 [GRCh38] Chr18:48575985 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.787+15T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209390]|Juvenile polyposis syndrome [RCV002054354]|not specified [RCV000435413] | Chr18:51058259 [GRCh38] Chr18:48584629 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-127-4835G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209498] | Chr18:51042085 [GRCh38] Chr18:48568455 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-128+263G>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209543] | Chr18:51030886 [GRCh38] Chr18:48557256 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1257G>C (p.Gly419=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002420399]|Juvenile polyposis syndrome [RCV000550378]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999040] | Chr18:51067136 [GRCh38] Chr18:48593506 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-113T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209652] | Chr18:51078143 [GRCh38] Chr18:48604513 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-128+3139C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209726] | Chr18:51033762 [GRCh38] Chr18:48560132 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+2398T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000209773] | Chr18:51069585 [GRCh38] Chr18:48595955 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.886_895del (p.Pro296fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002444842]|Hereditary cancer-predisposing syndrome [RCV000210091] | Chr18:51058435..51058444 [GRCh38] Chr18:48584805..48584814 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.70A>G (p.Met24Val) | single nucleotide variant | Early age onset of sporadic thoracic aortic dissections [RCV001261773]|Familial thoracic aortic aneurysm and aortic dissection [RCV002310810]|Hereditary cancer-predisposing syndrome [RCV000214905]|Heritable Thoracic Aortic Disease [RCV000678042]|Juvenile polyposis syndrome [RCV000547868]|Myhre syndrome [RCV002494594]|not provided [RCV001589151] | Chr18:51047116 [GRCh38] Chr18:48573486 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.706G>A (p.Gly236Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310807] | Chr18:51058163 [GRCh38] Chr18:48584533 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1349_1376dup (p.Ala460fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002310819]|Juvenile polyposis syndrome [RCV001854711] | Chr18:51076668..51076669 [GRCh38] Chr18:48603038..48603039 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.5(SMAD4):c.(?_-538)_1139+?del | deletion | Hereditary cancer-predisposing syndrome [RCV000210119] | Chr18:51030213..51065606 [GRCh38] Chr18:48556583..48591976 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.921G>A (p.Glu307=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310812]|Juvenile polyposis syndrome [RCV001500567]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003998038] | Chr18:51059882 [GRCh38] Chr18:48586252 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1088G>A (p.Cys363Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310816]|Juvenile polyposis syndrome [RCV001071904] | Chr18:51065555 [GRCh38] Chr18:48591925 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.336T>A (p.Val112=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311852]|Hereditary cancer-predisposing syndrome [RCV001186216]|Juvenile polyposis syndrome [RCV000550962]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999044] | Chr18:51048772 [GRCh38] Chr18:48575142 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1039A>G (p.Ile347Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319529]|Hereditary cancer-predisposing syndrome [RCV001017112]|Juvenile polyposis syndrome [RCV000555938]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003803]|not provided [RCV001764550]|not specified [RCV002231351] | Chr18:51065506 [GRCh38] Chr18:48591876 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.787+7A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001088188]|not provided [RCV000759350] | Chr18:51058251 [GRCh38] Chr18:48584621 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1596C>T (p.Ala532=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002310813]|Juvenile polyposis syndrome [RCV001451616] | Chr18:51078404 [GRCh38] Chr18:48604774 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.342T>C (p.Tyr114=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311351]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000227775]|Hereditary cancer-predisposing syndrome [RCV000571677]|Juvenile polyposis syndrome [RCV001450080]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001126991]|Myhre syndrome [RCV001126992]|not specified [RCV000441778] | Chr18:51048778 [GRCh38] Chr18:48575148 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.825A>G (p.Pro275=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002429117]|Juvenile polyposis syndrome [RCV000230324]|not provided [RCV003477829] | Chr18:51058377 [GRCh38] Chr18:48584747 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.5(SMAD4):c.-127-?_*6575+?dup | duplication | Juvenile polyposis syndrome [RCV000231559] | likely benign | |
NM_005359.6(SMAD4):c.1215C>T (p.His405=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002313940]|Hereditary cancer-predisposing syndrome [RCV000572344]|Juvenile polyposis syndrome [RCV000229918]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003998875]|Malignant tumor of breast [RCV001354161]|not specified [RCV002479917] | Chr18:51067094 [GRCh38] Chr18:48593464 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.177A>G (p.Thr59=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311350]|Hereditary cancer-predisposing syndrome [RCV000567186]|Juvenile polyposis syndrome [RCV000230080]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003998876]|not specified [RCV003993903] | Chr18:51047223 [GRCh38] Chr18:48573593 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.183A>C (p.Ile61=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318974]|Hereditary cancer-predisposing syndrome [RCV000775639]|Juvenile polyposis syndrome [RCV000232877] | Chr18:51047229 [GRCh38] Chr18:48573599 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.639C>T (p.Asn213=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001497884] | Chr18:51054965 [GRCh38] Chr18:48581335 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1206dup (p.Ser403Ter) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002347891]|Juvenile polyposis syndrome [RCV002229359]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004020818] | Chr18:51067083..51067084 [GRCh38] Chr18:48593453..48593454 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1644A>G (p.Pro548=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311349]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000226180]|Hereditary cancer-predisposing syndrome [RCV000573053]|Juvenile polyposis syndrome [RCV001450069]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000340035]|Myhre syndrome [RCV000287385]|SMAD4-related disorder [RCV003967648]|not provided [RCV003326381]|not specified [RCV000613346] | Chr18:51078452 [GRCh38] Chr18:48604822 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.1005A>G (p.Val335=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311348]|Hereditary cancer-predisposing syndrome [RCV000566183]|Juvenile polyposis syndrome [RCV000226401]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003998874]|not provided [RCV001582783] | Chr18:51065472 [GRCh38] Chr18:48591842 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.118A>G (p.Ile40Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002338736]|Juvenile polyposis syndrome [RCV001315849] | Chr18:51047164 [GRCh38] Chr18:48573534 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668G>T (p.Ser223Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV001319465] | Chr18:51058125 [GRCh38] Chr18:48584495 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+9G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001184079]|Juvenile polyposis syndrome [RCV000232702]|not provided [RCV001284064]|not specified [RCV000423942] | Chr18:51076785 [GRCh38] Chr18:48603155 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.1006G>C (p.Gly336Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002229358] | Chr18:51065473 [GRCh38] Chr18:48591843 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.906G>A (p.Trp302Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002379005]|Juvenile polyposis syndrome [RCV002229361] | Chr18:51059867 [GRCh38] Chr18:48586237 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.884C>T (p.Pro295Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311353]|Hereditary cancer-predisposing syndrome [RCV000576051]|Juvenile polyposis syndrome [RCV000234236]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003475829]|not provided [RCV000479945] | Chr18:51058436 [GRCh38] Chr18:48584806 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.755G>T (p.Gly252Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002429116]|Hereditary cancer-predisposing syndrome [RCV003584578]|Juvenile polyposis syndrome [RCV002229360]|not provided [RCV003237793] | Chr18:51058212 [GRCh38] Chr18:48584582 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.554C>T (p.Pro185Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311352]|Hereditary cancer-predisposing syndrome [RCV000572439]|Juvenile polyposis syndrome [RCV000227385]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003475828]|not specified [RCV003479073] | Chr18:51054880 [GRCh38] Chr18:48581250 [GRCh37] Chr18:18q21.2 |
benign|uncertain significance |
NM_005359.6(SMAD4):c.904+14T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000662799]|Hereditary cancer-predisposing syndrome [RCV000776159]|Juvenile polyposis syndrome [RCV002057252]|not specified [RCV000235880] | Chr18:51058470 [GRCh38] Chr18:48584840 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.749A>G (p.Gln250Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558605]|not provided [RCV000236697] | Chr18:51058206 [GRCh38] Chr18:48584576 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1608A>G (p.Leu536=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV001798876]|Familial thoracic aortic aneurysm and aortic dissection [RCV002319035]|Hereditary cancer-predisposing syndrome [RCV000773045]|Juvenile polyposis syndrome [RCV000560320]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999042]|SMAD4-related disorder [RCV003935420]|not provided [RCV001706665]|not specified [RCV000611504] | Chr18:51078416 [GRCh38] Chr18:48604786 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.697C>A (p.His233Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317326]|Hereditary cancer-predisposing syndrome [RCV003584664]|Juvenile polyposis syndrome [RCV001853818] | Chr18:51058154 [GRCh38] Chr18:48584524 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.21G>T (p.Thr7=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311926]|Hereditary cancer-predisposing syndrome [RCV000564029]|Juvenile polyposis syndrome [RCV001468093]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001086]|not specified [RCV002268196] | Chr18:51047067 [GRCh38] Chr18:48573437 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1494A>G (p.Leu498=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311912]|Hereditary cancer-predisposing syndrome [RCV000564265]|Juvenile polyposis syndrome [RCV001088585]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001083]|not provided [RCV000864936] | Chr18:51078302 [GRCh38] Chr18:48604672 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.956-4A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311858]|Hereditary cancer-predisposing syndrome [RCV000571234]|Juvenile polyposis syndrome [RCV000535985]|not provided [RCV001811038]|not specified [RCV001201303] | Chr18:51065419 [GRCh38] Chr18:48591789 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.250-3T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311947]|Juvenile polyposis syndrome [RCV001036195] | Chr18:51048683 [GRCh38] Chr18:48575053 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1128T>C (p.Ile376=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001804318]|Juvenile polyposis syndrome [RCV002074180] | Chr18:51065595 [GRCh38] Chr18:48591965 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-43A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV003316427]|not provided [RCV001668512]|not specified [RCV000244447] | Chr18:51054738 [GRCh38] Chr18:48581108 [GRCh37] Chr18:18q21.2 |
benign |
GRCh37/hg19 18q11.1-23(chr18:18548019-77954165)x3 | copy number gain | See cases [RCV000240476] | Chr18:18548019..77954165 [GRCh37] Chr18:18q11.1-23 |
pathogenic |
NM_005359.6(SMAD4):c.1532C>T (p.Pro511Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311925]|Hereditary cancer-predisposing syndrome [RCV000566945]|Juvenile polyposis syndrome [RCV001372062] | Chr18:51078340 [GRCh38] Chr18:48604710 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*334C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000281597]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000400862]|Myhre syndrome [RCV000334332] | Chr18:51078801 [GRCh38] Chr18:48605171 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*5801T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000348841]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000300345]|Myhre syndrome [RCV000394690] | Chr18:51084268 [GRCh38] Chr18:48610638 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*1812T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000334397]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000300434]|Myhre syndrome [RCV000399674] | Chr18:51080279 [GRCh38] Chr18:48606649 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.*5080A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000384387]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000282731]|Myhre syndrome [RCV000340155] | Chr18:51083547 [GRCh38] Chr18:48609917 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*2353C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000284625]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000375647]|Myhre syndrome [RCV000318595] | Chr18:51080820 [GRCh38] Chr18:48607190 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*5631AC[3] | microsatellite | Juvenile Polyposis [RCV000353148]|Myhre syndrome [RCV000298040]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000267734] | Chr18:51084097..51084100 [GRCh38] Chr18:48610467..48610470 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.*5546_*5547insGCAC | insertion | Juvenile Polyposis [RCV000377106]|Myhre syndrome [RCV000342190]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000284992] | Chr18:51084012..51084013 [GRCh38] Chr18:48610382..48610383 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2989A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000336049]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000285715]|Myhre syndrome [RCV000376546] | Chr18:51081456 [GRCh38] Chr18:48607826 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*6513C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000322797]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000377492]|Myhre syndrome [RCV000286301] | Chr18:51084980 [GRCh38] Chr18:48611350 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*2488T>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000268508]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000358749]|Myhre syndrome [RCV000308686] | Chr18:51080955 [GRCh38] Chr18:48607325 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*1179T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000343583]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000400004]|Myhre syndrome [RCV000304965]|not specified [RCV001001405] | Chr18:51079646 [GRCh38] Chr18:48606016 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*5170C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000308011]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000269799]|Myhre syndrome [RCV000365052] | Chr18:51083637 [GRCh38] Chr18:48610007 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*4643T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000333190]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000387718]|Myhre syndrome [RCV000289021] | Chr18:51083110 [GRCh38] Chr18:48609480 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*1866A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000325417]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000272732]|Myhre syndrome [RCV000363738] | Chr18:51080333 [GRCh38] Chr18:48606703 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*1864C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000364979]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000273826]|Myhre syndrome [RCV000312590] | Chr18:51080331 [GRCh38] Chr18:48606701 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*4585GA[1] | microsatellite | Juvenile Polyposis [RCV000386483]|Myhre syndrome [RCV000318153]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000292175] | Chr18:51083051..51083054 [GRCh38] Chr18:48609421..48609424 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*5627G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000356550]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000261609]|Myhre syndrome [RCV000311079] | Chr18:51084094 [GRCh38] Chr18:48610464 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*6492A>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000316865]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000261673]|Myhre syndrome [RCV000371448] | Chr18:51084959 [GRCh38] Chr18:48611329 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.667+3G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002314055]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000635437]|Hereditary cancer-predisposing syndrome [RCV000571451]|Juvenile polyposis syndrome [RCV001328519]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000358363]|Myhre syndrome [RCV000263575]|not provided [RCV001711942] | Chr18:51054996 [GRCh38] Chr18:48581366 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.*3763C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000281497]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000395159]|Myhre syndrome [RCV000350573] | Chr18:51082230 [GRCh38] Chr18:48608600 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.*5546CA[15] | microsatellite | Juvenile Polyposis [RCV000365956]|Myhre syndrome [RCV000269996]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000294853] | Chr18:51084013..51084014 [GRCh38] Chr18:48610383..48610384 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*218A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000379874]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000322910]|Myhre syndrome [RCV000270148] | Chr18:51078685 [GRCh38] Chr18:48605055 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2962C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000325203]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000270180]|Myhre syndrome [RCV000388111] | Chr18:51081429 [GRCh38] Chr18:48607799 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4862A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000305615]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000401341]|Myhre syndrome [RCV000340606] | Chr18:51083329 [GRCh38] Chr18:48609699 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*3398A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000327288]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000272407]|Myhre syndrome [RCV000377200] | Chr18:51081865 [GRCh38] Chr18:48608235 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*202A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000271751]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000329252]|Myhre syndrome [RCV000362909]|Myhre syndrome [RCV002487441] | Chr18:51078669 [GRCh38] Chr18:48605039 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5546CA[20] | microsatellite | Juvenile Polyposis [RCV000326009]|Myhre syndrome [RCV000277960]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000370174] | Chr18:51084012..51084013 [GRCh38] Chr18:48610382..48610383 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-495C>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000380585]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000325922]|Myhre syndrome [RCV000270981] | Chr18:51030256 [GRCh38] Chr18:48556626 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5985A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000271075]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000326110]|Myhre syndrome [RCV000365756] | Chr18:51084452 [GRCh38] Chr18:48610822 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2914C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000273484]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000333540]|Myhre syndrome [RCV000368038] | Chr18:51081381 [GRCh38] Chr18:48607751 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*5691_*5693del | deletion | Juvenile Polyposis [RCV000273110]|Myhre syndrome [RCV000377390]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000322738] | Chr18:51084156..51084158 [GRCh38] Chr18:48610526..48610528 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.*5235C>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000321266]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000378218]|Myhre syndrome [RCV000273248] | Chr18:51083702 [GRCh38] Chr18:48610072 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*6423G>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000274830]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000329962]|Myhre syndrome [RCV000356786] | Chr18:51084890 [GRCh38] Chr18:48611260 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.*1820T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000399315]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000370712]|Myhre syndrome [RCV000313311]|not provided [RCV002510864] | Chr18:51080287 [GRCh38] Chr18:48606657 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*5131A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000390463]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000371363]|Lung cancer [RCV001528160]|Myhre syndrome [RCV000314262]|not specified [RCV001001404] | Chr18:51083598 [GRCh38] Chr18:48609968 [GRCh37] Chr18:18q21.2 |
benign|confers sensitivity |
NM_005359.6(SMAD4):c.*5546CA[17] | microsatellite | Juvenile Polyposis [RCV000274330]|Myhre syndrome [RCV000331723]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000357422] | Chr18:51084012..51084013 [GRCh38] Chr18:48610382..48610383 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5546_*5547insGCACAC | insertion | Juvenile Polyposis [RCV000279019]|Myhre syndrome [RCV000336417]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000397552] | Chr18:51084012..51084013 [GRCh38] Chr18:48610382..48610383 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5537GC[7] | microsatellite | Juvenile Polyposis [RCV000380973]|Myhre syndrome [RCV000333498]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000288993] | Chr18:51084002..51084003 [GRCh38] Chr18:48610372..48610373 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.87T>G (p.Gly29=) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000319108]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000260894]|Myhre syndrome [RCV000373732] | Chr18:51047133 [GRCh38] Chr18:48573503 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-333C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000282607]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000337350]|Myhre syndrome [RCV000373352] | Chr18:51030418 [GRCh38] Chr18:48556788 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1801A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000340285]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000282972]|Myhre syndrome [RCV000379812] | Chr18:51080268 [GRCh38] Chr18:48606638 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4987T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000368297]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000276001]|Myhre syndrome [RCV000333418] | Chr18:51083454 [GRCh38] Chr18:48609824 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5994A>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000362126]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000277107]|Myhre syndrome [RCV000332185] | Chr18:51084461 [GRCh38] Chr18:48610831 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.*5546CA[23] | microsatellite | Juvenile Polyposis [RCV000382958]|Myhre syndrome [RCV000329490]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000290910] | Chr18:51084012..51084013 [GRCh38] Chr18:48610382..48610383 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*241T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000282895]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000321548]|Myhre syndrome [RCV000373832] | Chr18:51078708 [GRCh38] Chr18:48605078 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5419T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000279406]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000336751]|Myhre syndrome [RCV000375143] | Chr18:51083886 [GRCh38] Chr18:48610256 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.-506ACA[1] | microsatellite | Juvenile Polyposis [RCV000328412]|Myhre syndrome [RCV000273404]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000365528] | Chr18:51030243..51030245 [GRCh38] Chr18:48556613..48556615 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5863_*5867del | deletion | Juvenile Polyposis [RCV000306020]|Myhre syndrome [RCV000336483]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000394597] | Chr18:51084328..51084332 [GRCh38] Chr18:48610698..48610702 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.*5546_*5547insGCACACACAC | insertion | Juvenile Polyposis [RCV000401769]|Myhre syndrome [RCV000362362]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000314653] | Chr18:51084012..51084013 [GRCh38] Chr18:48610382..48610383 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5546_*5547insGCACACAC | insertion | Juvenile Polyposis [RCV000311117]|Myhre syndrome [RCV000368129]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000397551] | Chr18:51084012..51084013 [GRCh38] Chr18:48610382..48610383 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*850G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000320861]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000359279]|Myhre syndrome [RCV000262370] | Chr18:51079317 [GRCh38] Chr18:48605687 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5535A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000346092]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000393370]|Myhre syndrome [RCV000282968] | Chr18:51084002 [GRCh38] Chr18:48610372 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.*5551A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000384674]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000284496]|Myhre syndrome [RCV000339481] | Chr18:51084018 [GRCh38] Chr18:48610388 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5535_*5549delinsG | indel | Juvenile Polyposis [RCV000374313]|Myhre syndrome [RCV000316169]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000263272] | Chr18:51084002..51084016 [GRCh38] Chr18:48610372..48610386 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4991dup | duplication | Juvenile Polyposis [RCV000263192]|Myhre syndrome [RCV000357052]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000330016] | Chr18:51083449..51083450 [GRCh38] Chr18:48609819..48609820 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5083G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000336450]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000397506]|Myhre syndrome [RCV000286427] | Chr18:51083550 [GRCh38] Chr18:48609920 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.-3C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000304303]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000359102]|Myhre syndrome [RCV000264016] | Chr18:51047044 [GRCh38] Chr18:48573414 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3506C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000323866]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000379356]|Myhre syndrome [RCV000264017] | Chr18:51081973 [GRCh38] Chr18:48608343 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1277G>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000263833]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000297919]|Myhre syndrome [RCV000356080] | Chr18:51079744 [GRCh38] Chr18:48606114 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5546CA[14] | microsatellite | Juvenile Polyposis [RCV000378724]|Myhre syndrome [RCV000321809]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000264233] | Chr18:51084013..51084016 [GRCh38] Chr18:48610383..48610386 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5535_*5545delinsGCGCACA | indel | Juvenile Polyposis [RCV000308996]|Myhre syndrome [RCV000264314]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000365854] | Chr18:51084002..51084012 [GRCh38] Chr18:48610372..48610382 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1512dup | duplication | Juvenile Polyposis [RCV000275178]|Myhre syndrome [RCV000328042]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000385888] | Chr18:51079965..51079966 [GRCh38] Chr18:48606335..48606336 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3286A>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000362279]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000275912]|Myhre syndrome [RCV000307694] | Chr18:51081753 [GRCh38] Chr18:48608123 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4748C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000343968]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000290139]|Myhre syndrome [RCV000393398] | Chr18:51083215 [GRCh38] Chr18:48609585 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*2968del | deletion | Juvenile Polyposis [RCV000384711]|Myhre syndrome [RCV000340534]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000290328]|not provided [RCV003221920] | Chr18:51081435 [GRCh38] Chr18:48607805 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*1169_*1173del | deletion | Juvenile Polyposis [RCV000332824]|Myhre syndrome [RCV000292335]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000389730] | Chr18:51079636..51079640 [GRCh38] Chr18:48606006..48606010 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*1457C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000333823]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000355078]|Myhre syndrome [RCV000276366] | Chr18:51079924 [GRCh38] Chr18:48606294 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*685A>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000391859]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000364755]|Myhre syndrome [RCV000312370] | Chr18:51079152 [GRCh38] Chr18:48605522 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.*2693A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000394069]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000291751]|Myhre syndrome [RCV000345454] | Chr18:51081160 [GRCh38] Chr18:48607530 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*6009G>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000292350]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000386596]|Myhre syndrome [RCV000319413] | Chr18:51084476 [GRCh38] Chr18:48610846 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*2361A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000351942]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000292396]|Myhre syndrome [RCV000402411] | Chr18:51080828 [GRCh38] Chr18:48607198 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*412A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000352291]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000401751]|Myhre syndrome [RCV000294953] | Chr18:51078879 [GRCh38] Chr18:48605249 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.249+10A>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000409679]|Hereditary cancer-predisposing syndrome [RCV000771622]|Juvenile polyposis syndrome [RCV001450078]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000295030]|Myhre syndrome [RCV000389254]|not specified [RCV000427458] | Chr18:51047305 [GRCh38] Chr18:48573675 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.*2682T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000330663]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000295091]|Myhre syndrome [RCV000389468] | Chr18:51081149 [GRCh38] Chr18:48607519 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5874C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000266111]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000360694]|Myhre syndrome [RCV000302533] | Chr18:51084341 [GRCh38] Chr18:48610711 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5578G>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000400160]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000314712]|Myhre syndrome [RCV000350989] | Chr18:51084045 [GRCh38] Chr18:48610415 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*6408C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000369458]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000401737]|Myhre syndrome [RCV000314931] | Chr18:51084875 [GRCh38] Chr18:48611245 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2630A>G | single nucleotide variant | Juvenile Polyposis [RCV000260098]|Myhre syndrome [RCV000323626]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000355129] | Chr18:51081097 [GRCh38] Chr18:48607467 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1067G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000319786]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000261227]|Myhre syndrome [RCV000372257]|not provided [RCV003422294] | Chr18:51079534 [GRCh38] Chr18:48605904 [GRCh37] Chr18:18q21.2 |
benign|likely benign|uncertain significance |
NM_005359.6(SMAD4):c.-313C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000352317]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000399867]|Myhre syndrome [RCV000278675] | Chr18:51030438 [GRCh38] Chr18:48556808 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2354G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000395388]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000336266]|Myhre syndrome [RCV000278831] | Chr18:51080821 [GRCh38] Chr18:48607191 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4378T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000317028]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000263009]|Myhre syndrome [RCV000353160] | Chr18:51082845 [GRCh38] Chr18:48609215 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*2796G>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000262799]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000299210]|Myhre syndrome [RCV000353100] | Chr18:51081263 [GRCh38] Chr18:48607633 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*30A>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000298729]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000369760]|Myhre syndrome [RCV000399233] | Chr18:51078497 [GRCh38] Chr18:48604867 [GRCh37] Chr18:18q21.2 |
benign|likely benign|uncertain significance |
NM_005359.6(SMAD4):c.*5545G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000390247]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000353106]|Myhre syndrome [RCV000300141] | Chr18:51084012 [GRCh38] Chr18:48610382 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5096C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000349160]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000301241]|Myhre syndrome [RCV000397501] | Chr18:51083563 [GRCh38] Chr18:48609933 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-128+12A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000362423]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000267847]|Myhre syndrome [RCV000307763]|not specified [RCV000613032] | Chr18:51030635 [GRCh38] Chr18:48557005 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.*5546CA[13] | microsatellite | Juvenile Polyposis [RCV000316082]|Myhre syndrome [RCV000373072]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000267928] | Chr18:51084013..51084018 [GRCh38] Chr18:48610383..48610388 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5535_*5547delinsGCG | indel | Juvenile Polyposis [RCV000268010]|Myhre syndrome [RCV000360254]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000303214] | Chr18:51084002..51084014 [GRCh38] Chr18:48610372..48610384 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*837A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000360514]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000306685]|Myhre syndrome [RCV000268169] | Chr18:51079304 [GRCh38] Chr18:48605674 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*6057G>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000334674]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000374051]|Myhre syndrome [RCV000279595] | Chr18:51084524 [GRCh38] Chr18:48610894 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2122A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000324419]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000376733]|Myhre syndrome [RCV000266790] | Chr18:51080589 [GRCh38] Chr18:48606959 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*4085C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000358429]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000303680]|Myhre syndrome [RCV000268368] | Chr18:51082552 [GRCh38] Chr18:48608922 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3638T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000335213]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000375766]|Myhre syndrome [RCV000280172] | Chr18:51082105 [GRCh38] Chr18:48608475 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5259A>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000267306]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000372327]|Myhre syndrome [RCV000324662] | Chr18:51083726 [GRCh38] Chr18:48610096 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*1187A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000343445]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000303877]|Myhre syndrome [RCV000400973] | Chr18:51079654 [GRCh38] Chr18:48606024 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.904+1_904+2insGCCTGTTCACAA | insertion | Abnormal bleeding [RCV001270577] | Chr18:51058457..51058458 [GRCh38] Chr18:48584827..48584828 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1392del (p.Val465fs) | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV001269114] | Chr18:51076720 [GRCh38] Chr18:48603090 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.777T>C (p.Thr259=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311942] | Chr18:51058234 [GRCh38] Chr18:48584604 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.715_717dup (p.Gln239_Ile240insGln) | duplication | not provided [RCV002280057] | Chr18:51058170..51058171 [GRCh38] Chr18:48584540..48584541 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.63T>C (p.His21=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003160110]|not specified [RCV000606569] | Chr18:51047109 [GRCh38] Chr18:48573479 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.50_51del (p.Leu17fs) | deletion | Myhre syndrome [RCV003314204] | Chr18:51047096..51047097 [GRCh38] Chr18:48573466..48573467 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.*1177G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000291091]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000383126]|Myhre syndrome [RCV000349572] | Chr18:51079644 [GRCh38] Chr18:48606014 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2707_*2711del | deletion | Juvenile Polyposis [RCV000346667]|Myhre syndrome [RCV000302424]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000390407] | Chr18:51081172..51081176 [GRCh38] Chr18:48607542..48607546 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5535_*5540del | deletion | Juvenile Polyposis [RCV000343735]|Myhre syndrome [RCV000314612]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000398441] | Chr18:51083998..51084003 [GRCh38] Chr18:48610368..48610373 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5530T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000395270]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000292397]|Myhre syndrome [RCV000349430] | Chr18:51083997 [GRCh38] Chr18:48610367 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3843G>A | single nucleotide variant | Juvenile Polyposis [RCV000351195]|Myhre syndrome [RCV000315531]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000399595] | Chr18:51082310 [GRCh38] Chr18:48608680 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5537GC[4] | microsatellite | Juvenile Polyposis [RCV000340335]|Myhre syndrome [RCV000305296]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000393357] | Chr18:51084003..51084004 [GRCh38] Chr18:48610373..48610374 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5791C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000388674]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000293936]|Myhre syndrome [RCV000352758] | Chr18:51084258 [GRCh38] Chr18:48610628 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2674A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000374797]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000294320]|Myhre syndrome [RCV000320213] | Chr18:51081141 [GRCh38] Chr18:48607511 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3878dup | duplication | Juvenile Polyposis [RCV000306921]|Myhre syndrome [RCV000400362]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000366283] | Chr18:51082338..51082339 [GRCh38] Chr18:48608708..48608709 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*2461C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000391785]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000307595]|Myhre syndrome [RCV000362188] | Chr18:51080928 [GRCh38] Chr18:48607298 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*6158GATT[1] | microsatellite | Juvenile Polyposis [RCV000340717]|Myhre syndrome [RCV000397546]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000285795]|not provided [RCV003221921] | Chr18:51084625..51084628 [GRCh38] Chr18:48610995..48610998 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.-476C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000322289]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000377038]|Myhre syndrome [RCV000286044] | Chr18:51030275 [GRCh38] Chr18:48556645 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4867dup | duplication | Juvenile Polyposis [RCV000297466]|Myhre syndrome [RCV000390197]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000360337] | Chr18:51083333..51083334 [GRCh38] Chr18:48609703..48609704 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*6353del | deletion | Juvenile Polyposis [RCV000397556]|Myhre syndrome [RCV000309099]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000363824] | Chr18:51084818 [GRCh38] Chr18:48611188 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*2793T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000361182]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000298169]|Myhre syndrome [RCV000390127] | Chr18:51081260 [GRCh38] Chr18:48607630 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.5(SMAD4):c.*6586C>T | single nucleotide variant | Juvenile Polyposis [RCV000271879]|Myhre syndrome [RCV000329337]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000364061] | Chr18:51085053 [GRCh38] Chr18:48611423 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.5(SMAD4):c.*6588C>G | single nucleotide variant | Juvenile Polyposis [RCV000332033]|Myhre syndrome [RCV000274645]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000386254] | Chr18:51085055 [GRCh38] Chr18:48611425 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+1G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315231]|Juvenile polyposis syndrome [RCV002233900]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004025257] | Chr18:51067188 [GRCh38] Chr18:48593558 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.*1564_*1567del | deletion | Juvenile Polyposis [RCV000384872]|Myhre syndrome [RCV000288263]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000345613] | Chr18:51080028..51080031 [GRCh38] Chr18:48606398..48606401 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5757dup | duplication | Juvenile Polyposis [RCV000288426]|Myhre syndrome [RCV000328136]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000382825] | Chr18:51084214..51084215 [GRCh38] Chr18:48610584..48610585 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5004_*5005dup | duplication | Juvenile Polyposis [RCV000288742]|Myhre syndrome [RCV000380932]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000327515] | Chr18:51083461..51083462 [GRCh38] Chr18:48609831..48609832 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3186T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000399100]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000311240]|Myhre syndrome [RCV000370535] | Chr18:51081653 [GRCh38] Chr18:48608023 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*81T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000311537]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000368742]|Myhre syndrome [RCV000407020] | Chr18:51078548 [GRCh38] Chr18:48604918 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5576C>G | single nucleotide variant | Juvenile Polyposis [RCV000345230]|Myhre syndrome [RCV000290234]|Telangiectasia, hereditary hemorrhagic, type 1 [RCV000397128] | Chr18:51084043 [GRCh38] Chr18:48610413 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3109T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000337346]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000301057]|Myhre syndrome [RCV000400607] | Chr18:51081576 [GRCh38] Chr18:48607946 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-233G>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000407675]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000348969]|Myhre syndrome [RCV000312940] | Chr18:51030518 [GRCh38] Chr18:48556888 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.45C>T (p.Ala15=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582175]|Juvenile polyposis syndrome [RCV003762808] | Chr18:51047091 [GRCh38] Chr18:48573461 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.877C>T (p.Pro293Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000583802] | Chr18:51058429 [GRCh38] Chr18:48584799 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.27A>G (p.Thr9=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559246]|Hereditary cancer-predisposing syndrome [RCV000583922]|Juvenile polyposis syndrome [RCV001486279] | Chr18:51047073 [GRCh38] Chr18:48573443 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140-17del | deletion | Hereditary cancer-predisposing syndrome [RCV000583954] | Chr18:51067000 [GRCh38] Chr18:48593370 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.470T>C (p.Met157Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319047]|Juvenile polyposis syndrome [RCV001039892]|SMAD4-related disorder [RCV003392425]|not provided [RCV000587176]|not specified [RCV003321692] | Chr18:51054796 [GRCh38] Chr18:48581166 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.752A>G (p.Asn251Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000579897]|Juvenile polyposis syndrome [RCV003596044] | Chr18:51058209 [GRCh38] Chr18:48584579 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.10:g.(?_51065417)_(51067193_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000549633]|Juvenile polyposis syndrome [RCV001382025] | Chr18:51065417..51067193 [GRCh38] Chr18:48591787..48593563 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1440A>G (p.Pro480=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311935] | Chr18:51076769 [GRCh38] Chr18:48603139 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.787+21dup | duplication | Hereditary cancer-predisposing syndrome [RCV000582405]|Juvenile polyposis syndrome [RCV002061941] | Chr18:51058259..51058260 [GRCh38] Chr18:48584629..48584630 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.956-19T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000584082]|Juvenile polyposis syndrome [RCV002061943] | Chr18:51065404 [GRCh38] Chr18:48591774 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.927A>C (p.Ala309=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002377204]|Hereditary cancer-predisposing syndrome [RCV000583989]|Juvenile polyposis syndrome [RCV003596047] | Chr18:51059888 [GRCh38] Chr18:48586258 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-6C>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000584134]|Juvenile polyposis syndrome [RCV000635413] | Chr18:51058119 [GRCh38] Chr18:48584489 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.750G>A (p.Gln250=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002395502]|Hereditary cancer-predisposing syndrome [RCV000584169]|Juvenile polyposis syndrome [RCV002232554] | Chr18:51058207 [GRCh38] Chr18:48584577 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+45dup | duplication | not provided [RCV001653936]|not specified [RCV000584195] | Chr18:51058485..51058486 [GRCh38] Chr18:48584855..48584856 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.1525T>G (p.Trp509Gly) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000584198] | Chr18:51078333 [GRCh38] Chr18:48604703 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.792C>T (p.Ser264=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002420553]|Hereditary cancer-predisposing syndrome [RCV000582438]|Juvenile polyposis syndrome [RCV002232715]|not specified [RCV000604225] | Chr18:51058344 [GRCh38] Chr18:48584714 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+45del | deletion | not provided [RCV001653935]|not specified [RCV000582477] | Chr18:51058486 [GRCh38] Chr18:48584856 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.179C>T (p.Ala60Val) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582556] | Chr18:51047225 [GRCh38] Chr18:48573595 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+14G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000584230]|Juvenile polyposis syndrome [RCV002065114] | Chr18:51047309 [GRCh38] Chr18:48573679 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.787+18A>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000584322] | Chr18:51058262 [GRCh38] Chr18:48584632 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.741A>G (p.Gly247=) | single nucleotide variant | not specified [RCV000598813] | Chr18:51058198 [GRCh38] Chr18:48584568 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.319A>G (p.Asn107Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311922] | Chr18:51048755 [GRCh38] Chr18:48575125 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.779A>C (p.Tyr260Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000580642] | Chr18:51058236 [GRCh38] Chr18:48584606 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+16dup | duplication | Hereditary cancer-predisposing syndrome [RCV000582628]|Juvenile polyposis syndrome [RCV002065117] | Chr18:51058467..51058468 [GRCh38] Chr18:48584837..48584838 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.919G>A (p.Glu307Lys) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582712]|Juvenile polyposis syndrome [RCV003596046] | Chr18:51059880 [GRCh38] Chr18:48586250 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-11T>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000663204]|Hereditary cancer-predisposing syndrome [RCV000582717]|Juvenile polyposis syndrome [RCV002061938]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316772] | Chr18:51067008 [GRCh38] Chr18:48593378 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.*1G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582646] | Chr18:51078468 [GRCh38] Chr18:48604838 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.829A>G (p.Thr277Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV001853988]|not provided [RCV000588293] | Chr18:51058381 [GRCh38] Chr18:48584751 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.298A>C (p.Arg100=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311908]|Generalized juvenile polyposis/juvenile polyposis coli [RCV001126988]|Hereditary cancer-predisposing syndrome [RCV000568563]|Juvenile polyposis syndrome [RCV001479449]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001126989]|Myhre syndrome [RCV001126990] | Chr18:51048734 [GRCh38] Chr18:48575104 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.715C>G (p.Gln239Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002413658]|Hereditary cancer-predisposing syndrome [RCV000581018]|Juvenile polyposis syndrome [RCV001215710]|SMAD4-related disorder [RCV003983132] | Chr18:51058172 [GRCh38] Chr18:48584542 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+12A>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582759]|Juvenile polyposis syndrome [RCV003767314] | Chr18:51055005 [GRCh38] Chr18:48581375 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+16A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582811]|Juvenile polyposis syndrome [RCV002529282] | Chr18:51076792 [GRCh38] Chr18:48603162 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+20C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000584555]|Juvenile polyposis syndrome [RCV002061940] | Chr18:51049344 [GRCh38] Chr18:48575714 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1299A>G (p.Ala433=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002384279]|Hereditary cancer-predisposing syndrome [RCV000584564]|Juvenile polyposis syndrome [RCV000635507] | Chr18:51067178 [GRCh38] Chr18:48593548 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1173T>C (p.Cys391=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000584488] | Chr18:51067052 [GRCh38] Chr18:48593422 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1353G>A (p.Ala451=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317332]|Hereditary cancer-predisposing syndrome [RCV000581150]|Juvenile polyposis syndrome [RCV001430013]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002376]|not provided [RCV000586918]|not specified [RCV000855565] | Chr18:51076682 [GRCh38] Chr18:48603052 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.716A>T (p.Gln239Leu) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582942] | Chr18:51058173 [GRCh38] Chr18:48584543 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668-19T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582898]|Juvenile polyposis syndrome [RCV001853942] | Chr18:51058106 [GRCh38] Chr18:48584476 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.956-7C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000663316]|Hereditary cancer-predisposing syndrome [RCV000584567]|Juvenile polyposis syndrome [RCV001495387] | Chr18:51065416 [GRCh38] Chr18:48591786 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+4A>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000584689]|Juvenile polyposis syndrome [RCV001367440]|not provided [RCV003226953] | Chr18:51067191 [GRCh38] Chr18:48593561 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1485T>G (p.Leu495=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319044]|Hereditary cancer-predisposing syndrome [RCV000581284]|Juvenile polyposis syndrome [RCV003762807] | Chr18:51078293 [GRCh38] Chr18:48604663 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-11T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000581234]|Juvenile polyposis syndrome [RCV002530805]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002380]|not provided [RCV001546100] | Chr18:51058114 [GRCh38] Chr18:48584484 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.768G>A (p.Gln256=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002431735]|Hereditary cancer-predisposing syndrome [RCV000583101]|Juvenile polyposis syndrome [RCV000936121] | Chr18:51058225 [GRCh38] Chr18:48584595 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.325C>T (p.Leu109=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002448813]|Hereditary cancer-predisposing syndrome [RCV000583193]|Juvenile polyposis syndrome [RCV000912843]|not provided [RCV003478318] | Chr18:51048761 [GRCh38] Chr18:48575131 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.788-14G>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000583194]|Juvenile polyposis syndrome [RCV002061942]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002382]|not specified [RCV000602529] | Chr18:51058326 [GRCh38] Chr18:48584696 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.49C>T (p.Leu17=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002341502]|Juvenile polyposis syndrome [RCV000635509]|not specified [RCV000589196] | Chr18:51047095 [GRCh38] Chr18:48573465 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.75C>T (p.Cys25=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311927]|Juvenile polyposis syndrome [RCV000976843] | Chr18:51047121 [GRCh38] Chr18:48573491 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1023del (p.Pro342fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002315867]|Juvenile polyposis syndrome [RCV001047958]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV002251490] | Chr18:51065489 [GRCh38] Chr18:48591859 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.904+29A>T | single nucleotide variant | not specified [RCV000581257] | Chr18:51058485 [GRCh38] Chr18:48584855 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.425-17C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000583273]|Juvenile polyposis syndrome [RCV002065116]|not provided [RCV003736830] | Chr18:51049278 [GRCh38] Chr18:48575648 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1271dup (p.Asp424fs) | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000588508]|Juvenile polyposis syndrome [RCV001376571] | Chr18:51067149..51067150 [GRCh38] Chr18:48593519..48593520 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1610A>G (p.Asp537Gly) | single nucleotide variant | Colorectal cancer [RCV000626452]|Juvenile polyposis syndrome [RCV002232772] | Chr18:51078418 [GRCh38] Chr18:48604788 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.519C>T (p.Ser173=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319045]|Hereditary cancer-predisposing syndrome [RCV000581491]|Juvenile polyposis syndrome [RCV001472123] | Chr18:51054845 [GRCh38] Chr18:48581215 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.644C>G (p.Pro215Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002367981]|Hereditary cancer-predisposing syndrome [RCV000581527]|Juvenile polyposis syndrome [RCV001860101]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004568298] | Chr18:51054970 [GRCh38] Chr18:48581340 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+11A>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000583452]|Juvenile polyposis syndrome [RCV002061939] | Chr18:51067198 [GRCh38] Chr18:48593568 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.594A>C (p.Pro198=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002358641]|Hereditary cancer-predisposing syndrome [RCV000583454]|Juvenile polyposis syndrome [RCV001396640]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002379] | Chr18:51054920 [GRCh38] Chr18:48581290 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140-3A>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002330998]|Hereditary cancer-predisposing syndrome [RCV000581597]|Juvenile polyposis syndrome [RCV000635480]|not specified [RCV000780716] | Chr18:51067016 [GRCh38] Chr18:48593386 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.955+25_955+43del | deletion | Hereditary cancer-predisposing syndrome [RCV000581616]|Juvenile polyposis syndrome [RCV003762809] | Chr18:51059933..51059951 [GRCh38] Chr18:48586303..48586321 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1263A>G (p.Ala421=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315877]|Hereditary cancer-predisposing syndrome [RCV000581665]|Juvenile polyposis syndrome [RCV001465404]|not provided [RCV003236820] | Chr18:51067142 [GRCh38] Chr18:48593512 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.700A>G (p.Ser234Gly) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000581708]|Juvenile polyposis syndrome [RCV003596045]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003471932]|not provided [RCV003478319] | Chr18:51058157 [GRCh38] Chr18:48584527 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1309-16T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000583530] | Chr18:51076622 [GRCh38] Chr18:48602992 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.249+24A>G | single nucleotide variant | not provided [RCV001552179]|not specified [RCV000583543] | Chr18:51047319 [GRCh38] Chr18:48573689 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.1407_1410dup (p.Gly471fs) | duplication | Juvenile polyposis syndrome [RCV000635477] | Chr18:51076734..51076735 [GRCh38] Chr18:48603104..48603105 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.975C>T (p.Ser325=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002438517]|Hereditary cancer-predisposing syndrome [RCV000581740]|Juvenile polyposis syndrome [RCV000935585] | Chr18:51065442 [GRCh38] Chr18:48591812 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.756A>G (p.Gly252=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002431734]|Hereditary cancer-predisposing syndrome [RCV000581784]|Juvenile polyposis syndrome [RCV000865944]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002381]|not provided [RCV001537083]|not specified [RCV002268214] | Chr18:51058213 [GRCh38] Chr18:48584583 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1473T>C (p.Gly491=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000583643]|Juvenile polyposis syndrome [RCV001460937]|not specified [RCV000780718] | Chr18:51078281 [GRCh38] Chr18:48604651 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.-15G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000583737]|not specified [RCV000601895] | Chr18:51047032 [GRCh38] Chr18:48573402 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1139+13T>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000581915]|Juvenile polyposis syndrome [RCV002061937] | Chr18:51065619 [GRCh38] Chr18:48591989 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1124C>T (p.Ala375Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002438516]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000810369]|Hereditary cancer-predisposing syndrome [RCV000583871]|Juvenile polyposis syndrome [RCV001312207]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125431]|Myhre syndrome [RCV001125430]|not provided [RCV001770536] | Chr18:51065591 [GRCh38] Chr18:48591961 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.115delinsAA (p.Ala39fs) | indel | not provided [RCV000592029] | Chr18:51047161 [GRCh38] Chr18:48573531 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.424+6T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559247]|Hereditary cancer-predisposing syndrome [RCV000582033]|Juvenile polyposis syndrome [RCV000806604]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002378]|not specified [RCV000608629] | Chr18:51048866 [GRCh38] Chr18:48575236 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.250-14G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000581913]|Juvenile polyposis syndrome [RCV002065115]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002377] | Chr18:51048672 [GRCh38] Chr18:48575042 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1403A>G (p.Asn468Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315873]|Hereditary cancer-predisposing syndrome [RCV000569973]|Juvenile polyposis syndrome [RCV001069022] | Chr18:51076732 [GRCh38] Chr18:48603102 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.119T>C (p.Ile40Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002345873]|Juvenile polyposis syndrome [RCV000816851]|not provided [RCV003141839] | Chr18:51047165 [GRCh38] Chr18:48573535 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.503G>A (p.Gly168Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311949]|Juvenile polyposis syndrome [RCV003767205] | Chr18:51054829 [GRCh38] Chr18:48581199 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-3C>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315866]|Hereditary cancer-predisposing syndrome [RCV000571774]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001131]|not provided [RCV003480702]|not specified [RCV000781853] | Chr18:51047044 [GRCh38] Chr18:48573414 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.463A>G (p.Ser155Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318371]|Hereditary cancer-predisposing syndrome [RCV000563891]|Juvenile polyposis syndrome [RCV002524680]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV000415677] | Chr18:51054789 [GRCh38] Chr18:48581159 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.39T>C (p.Asn13=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317320]|Hereditary cancer-predisposing syndrome [RCV000573839]|Juvenile polyposis syndrome [RCV000936361]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001203] | Chr18:51047085 [GRCh38] Chr18:48573455 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.471G>A (p.Met157Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311943]|Hereditary cancer-predisposing syndrome [RCV000573873]|Juvenile polyposis syndrome [RCV000705291]|not provided [RCV002259353]|not specified [RCV000780719] | Chr18:51054797 [GRCh38] Chr18:48581167 [GRCh37] Chr18:18q21.2 |
benign|likely benign|uncertain significance |
NM_005359.6(SMAD4):c.556C>G (p.Pro186Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311933]|Juvenile polyposis syndrome [RCV002232142]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001088] | Chr18:51054882 [GRCh38] Chr18:48581252 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.651T>A (p.Ile217=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002367807]|Juvenile polyposis syndrome [RCV002231365] | Chr18:51054977 [GRCh38] Chr18:48581347 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1545A>G (p.Arg515=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002314972]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000530327]|Hereditary cancer-predisposing syndrome [RCV000581754]|Juvenile polyposis syndrome [RCV001391329]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123419]|Myhre syndrome [RCV001123418]|not specified [RCV000604219] | Chr18:51078353 [GRCh38] Chr18:48604723 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.945C>T (p.Ser315=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311941]|Hereditary cancer-predisposing syndrome [RCV000573532]|Juvenile polyposis syndrome [RCV001078555] | Chr18:51059906 [GRCh38] Chr18:48586276 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1058A>G (p.Tyr353Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001370335]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001262035]|not provided [RCV000734063] | Chr18:51065525 [GRCh38] Chr18:48591895 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.1140-10T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002231354] | Chr18:51067009 [GRCh38] Chr18:48593379 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1201dup (p.Cys401fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002317324]|Juvenile polyposis syndrome [RCV002526926] | Chr18:51067079..51067080 [GRCh38] Chr18:48593449..48593450 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1239_1241del (p.Tyr413_Leu414delinsTer) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002317328] | Chr18:51067118..51067120 [GRCh38] Chr18:48593488..48593490 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.62A>G (p.His21Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311919]|Juvenile polyposis syndrome [RCV002528944] | Chr18:51047108 [GRCh38] Chr18:48573478 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.390A>G (p.Pro130=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319037]|Hereditary cancer-predisposing syndrome [RCV001021412]|Juvenile polyposis syndrome [RCV000539395]|not provided [RCV001800741]|not specified [RCV000590505] | Chr18:51048826 [GRCh38] Chr18:48575196 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.147G>A (p.Glu49=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311915] | Chr18:51047193 [GRCh38] Chr18:48573563 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.789C>T (p.Asn263=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311920]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000635500]|Hereditary cancer-predisposing syndrome [RCV000571444]|Juvenile polyposis syndrome [RCV001420983]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124421]|Myhre syndrome [RCV001124422] | Chr18:51058341 [GRCh38] Chr18:48584711 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.650T>G (p.Ile217Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315871] | Chr18:51054976 [GRCh38] Chr18:48581346 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.885G>A (p.Pro295=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311909]|Hereditary cancer-predisposing syndrome [RCV000574603]|Juvenile polyposis syndrome [RCV000635495]|not provided [RCV003478265]|not specified [RCV000603480] | Chr18:51058437 [GRCh38] Chr18:48584807 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1501C>A (p.Leu501Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311937] | Chr18:51078309 [GRCh38] Chr18:48604679 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.573G>A (p.Ser191=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311940]|Hereditary cancer-predisposing syndrome [RCV000568265]|Juvenile polyposis syndrome [RCV000635508]|not provided [RCV000759348] | Chr18:51054899 [GRCh38] Chr18:48581269 [GRCh37] Chr18:18q21.2 |
likely benign |
GRCh37/hg19 18p11.32-q23(chr18:136226-78014123)x3 | copy number gain | See cases [RCV000446047] | Chr18:136226..78014123 [GRCh37] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.1492T>C (p.Leu498=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318979]|Generalized juvenile polyposis/juvenile polyposis coli [RCV001084748]|Hereditary cancer-predisposing syndrome [RCV000579788]|Juvenile polyposis syndrome [RCV001391325]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123417]|Myhre syndrome [RCV001123416]|not provided [RCV000679586]|not specified [RCV000427335] | Chr18:51078300 [GRCh38] Chr18:48604670 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.1533G>A (p.Pro511=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311505]|Hereditary cancer-predisposing syndrome [RCV000568997]|Juvenile polyposis syndrome [RCV000635527]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000555]|not specified [RCV000437684] | Chr18:51078341 [GRCh38] Chr18:48604711 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.582A>G (p.Thr194=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311458]|Hereditary cancer-predisposing syndrome [RCV000566093]|Juvenile polyposis syndrome [RCV001086982]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003996043]|not provided [RCV000587852]|not specified [RCV000437773] | Chr18:51054908 [GRCh38] Chr18:48581278 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.144G>A (p.Lys48=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318980]|Hereditary cancer-predisposing syndrome [RCV001011646]|Juvenile polyposis syndrome [RCV001394956]|not specified [RCV000437825] | Chr18:51047190 [GRCh38] Chr18:48573560 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.510A>G (p.Pro170=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002339054]|Hereditary cancer-predisposing syndrome [RCV000579498]|Juvenile polyposis syndrome [RCV001476545]|not specified [RCV000441419] | Chr18:51054836 [GRCh38] Chr18:48581206 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1051G>A (p.Asp351Asn) | single nucleotide variant | Neoplasm of the large intestine [RCV000444906] | Chr18:51065518 [GRCh38] Chr18:48591888 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1609G>T (p.Asp537Tyr) | single nucleotide variant | Neoplasm of the large intestine [RCV000444970] | Chr18:51078417 [GRCh38] Chr18:48604787 [GRCh37] Chr18:18q21.2 |
pathogenic |
GRCh37/hg19 18p11.32-q23(chr18:163323-78005185)x3 | copy number gain | See cases [RCV000445851] | Chr18:163323..78005185 [GRCh37] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.411A>G (p.Val137=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002323591]|Hereditary cancer-predisposing syndrome [RCV001188669]|Juvenile polyposis syndrome [RCV000635501]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003995987]|not provided [RCV001703498] | Chr18:51048847 [GRCh38] Chr18:48575217 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.989A>C (p.Glu330Ala) | single nucleotide variant | Neoplasm of the large intestine [RCV000434490] | Chr18:51065456 [GRCh38] Chr18:48591826 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.956-5T>C | single nucleotide variant | not specified [RCV000441647] | Chr18:51065418 [GRCh38] Chr18:48591788 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.954T>C (p.Pro318=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002429418]|Hereditary cancer-predisposing syndrome [RCV001019481]|Juvenile polyposis syndrome [RCV001087625]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000472]|not provided [RCV000417972] | Chr18:51059915 [GRCh38] Chr18:48586285 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.486T>C (p.Tyr162=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318981]|Hereditary cancer-predisposing syndrome [RCV001023178]|Juvenile polyposis syndrome [RCV000530921]|SMAD4-related disorder [RCV003925293]|not specified [RCV000434922] | Chr18:51054812 [GRCh38] Chr18:48581182 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-127-3T>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002257674]|not provided [RCV001703717] | Chr18:51046917 [GRCh38] Chr18:48573287 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.366A>G (p.Lys122=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002451053]|Hereditary cancer-predisposing syndrome [RCV000579520]|Juvenile polyposis syndrome [RCV000696232]|not provided [RCV001721482] | Chr18:51048802 [GRCh38] Chr18:48575172 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1308+9C>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582278]|Juvenile polyposis syndrome [RCV000871265]|not specified [RCV000438629] | Chr18:51067196 [GRCh38] Chr18:48593566 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1611C>T (p.Asp537=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318398]|Hereditary cancer-predisposing syndrome [RCV000569140]|Juvenile polyposis syndrome [RCV000465694]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003996010]|not provided [RCV001703530] | Chr18:51078419 [GRCh38] Chr18:48604789 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1156G>T (p.Gly386Cys) | single nucleotide variant | Carcinoma of esophagus [RCV000421325]|Gastric adenocarcinoma [RCV000421536]|Lung adenocarcinoma [RCV000444559]|Neoplasm of the large intestine [RCV000439155]|Pancreatic adenocarcinoma [RCV000431585]|Prostate adenocarcinoma [RCV000434360] | Chr18:51067035 [GRCh38] Chr18:48593405 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.-133G>A | single nucleotide variant | not specified [RCV000428480] | Chr18:51030618 [GRCh38] Chr18:48556988 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.876G>A (p.Pro292=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002374637]|Generalized juvenile polyposis/juvenile polyposis coli [RCV001125427]|Hereditary cancer-predisposing syndrome [RCV000579563]|Juvenile polyposis syndrome [RCV001477273]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125429]|Myhre syndrome [RCV001125428]|not specified [RCV000435398] | Chr18:51058428 [GRCh38] Chr18:48584798 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.132A>G (p.Val44=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318418]|Hereditary cancer-predisposing syndrome [RCV001011069]|Juvenile polyposis syndrome [RCV000475068]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000374]|not provided [RCV001720151] | Chr18:51047178 [GRCh38] Chr18:48573548 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.1014A>G (p.Thr338=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002521547]|not specified [RCV000442432] | Chr18:51065481 [GRCh38] Chr18:48591851 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.787+15T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000579600]|Juvenile polyposis syndrome [RCV002061521]|not provided [RCV003736760]|not specified [RCV000428677] | Chr18:51058259 [GRCh38] Chr18:48584629 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1065C>A (p.Asp355Glu) | single nucleotide variant | Neoplasm of the large intestine [RCV000435575] | Chr18:51065532 [GRCh38] Chr18:48591902 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.60G>A (p.Val20=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002356533]|Juvenile polyposis syndrome [RCV001447520]|not specified [RCV000425164] | Chr18:51047106 [GRCh38] Chr18:48573476 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.955+15A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000580374]|Juvenile polyposis syndrome [RCV001851083]|not specified [RCV000439205] | Chr18:51059931 [GRCh38] Chr18:48586301 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.155A>T (p.Asp52Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311755]|Hereditary cancer-predisposing syndrome [RCV000568719]|Juvenile polyposis syndrome [RCV000545492]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000594]|Myhre syndrome [RCV002506083]|SMAD4-related disorder [RCV003401439]|not provided [RCV000419383] | Chr18:51047201 [GRCh38] Chr18:48573571 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1641C>T (p.Asp547=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001501827]|SMAD4-related disorder [RCV003897918]|not specified [RCV000435895] | Chr18:51078449 [GRCh38] Chr18:48604819 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140-4T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002450983]|Juvenile polyposis syndrome [RCV001484798]|not specified [RCV000419460] | Chr18:51067015 [GRCh38] Chr18:48593385 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1236C>T (p.Tyr412=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002365528]|Hereditary cancer-predisposing syndrome [RCV001177837]|Juvenile polyposis syndrome [RCV001497656]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000431]|not specified [RCV000432565] | Chr18:51067115 [GRCh38] Chr18:48593485 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.250-15C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000771442]|Juvenile polyposis syndrome [RCV002061520]|not provided [RCV000679588] | Chr18:51048671 [GRCh38] Chr18:48575041 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-28T>C | single nucleotide variant | not specified [RCV000432908] | Chr18:51047019 [GRCh38] Chr18:48573389 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*12G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001127626]|Hereditary cancer-predisposing syndrome [RCV000579871]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127625]|Myhre syndrome [RCV001127627]|not specified [RCV000443565] | Chr18:51078479 [GRCh38] Chr18:48604849 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.-11A>C | single nucleotide variant | not specified [RCV000443696] | Chr18:51047036 [GRCh38] Chr18:48573406 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.387T>C (p.Asn129=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311498]|Hereditary cancer-predisposing syndrome [RCV000572770]|Juvenile polyposis syndrome [RCV001443929]|not specified [RCV000443721] | Chr18:51048823 [GRCh38] Chr18:48575193 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+20G>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001188670]|Juvenile polyposis syndrome [RCV002063601]|not specified [RCV000422661] | Chr18:51055013 [GRCh38] Chr18:48581383 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-8C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001185750]|Juvenile polyposis syndrome [RCV000874678]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003996003]|not specified [RCV000429769] | Chr18:51054773 [GRCh38] Chr18:48581143 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.963G>A (p.Glu321=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002374698]|Hereditary cancer-predisposing syndrome [RCV001525403]|Juvenile polyposis syndrome [RCV001440114]|not specified [RCV000436629] | Chr18:51065430 [GRCh38] Chr18:48591800 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1157G>C (p.Gly386Ala) | single nucleotide variant | Carcinoma of esophagus [RCV000434611]|Gastric adenocarcinoma [RCV000426807]|Lung adenocarcinoma [RCV000418499]|Neoplasm of the large intestine [RCV000444422]|Pancreatic adenocarcinoma [RCV000437033]|Prostate adenocarcinoma [RCV000427832] | Chr18:51067036 [GRCh38] Chr18:48593406 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1082G>C (p.Arg361Pro) | single nucleotide variant | Breast neoplasm [RCV000432335]|Carcinoma of esophagus [RCV000422756]|Gastric adenocarcinoma [RCV000426902]|Lung adenocarcinoma [RCV000445044]|Neoplasm of the large intestine [RCV000434531]|Neoplasm of uterine cervix [RCV000423850]|Pancreatic adenocarcinoma [RCV000441763]|Squamous cell carcinoma of the head and neck [RCV000433435] | Chr18:51065549 [GRCh38] Chr18:48591919 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.667+17G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000579818]|Juvenile polyposis syndrome [RCV002062318]|not specified [RCV000426286] | Chr18:51055010 [GRCh38] Chr18:48581380 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-39T>A | single nucleotide variant | not provided [RCV000767314]|not specified [RCV000440329] | Chr18:51047008 [GRCh38] Chr18:48573378 [GRCh37] Chr18:18q21.2 |
likely benign|not provided |
NM_005359.6(SMAD4):c.1156G>A (p.Gly386Ser) | single nucleotide variant | Carcinoma of esophagus [RCV000419978]|Gastric adenocarcinoma [RCV000439617]|Lung adenocarcinoma [RCV000421895]|Neoplasm of the large intestine [RCV000430240]|Pancreatic adenocarcinoma [RCV000429536]|Prostate adenocarcinoma [RCV000439753] | Chr18:51067035 [GRCh38] Chr18:48593405 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.667+9T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000462300]|Hereditary cancer-predisposing syndrome [RCV000581062]|Juvenile polyposis syndrome [RCV001420992]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316528]|SMAD4-related disorder [RCV003922716]|not specified [RCV000420161] | Chr18:51055002 [GRCh38] Chr18:48581372 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.1140-16C>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003595972]|not specified [RCV000430468] | Chr18:51067003 [GRCh38] Chr18:48593373 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.126T>C (p.Ser42=) | single nucleotide variant | Juvenile polyposis syndrome [RCV000528521]|not specified [RCV000420387] | Chr18:51047172 [GRCh38] Chr18:48573542 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1157G>T (p.Gly386Val) | single nucleotide variant | Carcinoma of esophagus [RCV000430022]|Gastric adenocarcinoma [RCV000436766]|Lung adenocarcinoma [RCV000438138]|Neoplasm of the large intestine [RCV000427058]|Pancreatic adenocarcinoma [RCV000443924]|Prostate adenocarcinoma [RCV000420512] | Chr18:51067036 [GRCh38] Chr18:48593406 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.424+14G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001183961]|not specified [RCV000423539] | Chr18:51048874 [GRCh38] Chr18:48575244 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.261G>A (p.Arg87=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311461]|Hereditary cancer-predisposing syndrome [RCV000575456]|Juvenile polyposis syndrome [RCV002230244]|SMAD4-related disorder [RCV003972593]|not provided [RCV001720058] | Chr18:51048697 [GRCh38] Chr18:48575067 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1051G>C (p.Asp351His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002402119]|Neoplasm of the large intestine [RCV000427066] | Chr18:51065518 [GRCh38] Chr18:48591888 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1395G>A (p.Val465=) | single nucleotide variant | not specified [RCV000434001] | Chr18:51076724 [GRCh38] Chr18:48603094 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-135G>A | single nucleotide variant | not specified [RCV000437409] | Chr18:51030616 [GRCh38] Chr18:48556986 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-20A>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000581395]|not specified [RCV000444837] | Chr18:51047027 [GRCh38] Chr18:48573397 [GRCh37] Chr18:18q21.2 |
likely benign |
GRCh37/hg19 18q21.1-23(chr18:47656799-78014123)x1 | copy number loss | See cases [RCV000447931] | Chr18:47656799..78014123 [GRCh37] Chr18:18q21.1-23 |
pathogenic |
NM_005359.6(SMAD4):c.1516G>A (p.Val506Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV002230767]|not provided [RCV002223843] | Chr18:51078324 [GRCh38] Chr18:48604694 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.5(SMAD4):c.669_691delTCAGCCTGCCAGTATACTGGGGG | deletion | not provided [RCV000481001] | Chr18:51058124..51058146 [GRCh38] Chr18:48584494..48584516 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.788-12del | deletion | Juvenile polyposis syndrome [RCV002063718]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003321]|not specified [RCV000479367] | Chr18:51058327 [GRCh38] Chr18:48584697 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1140-36_1140-19del | deletion | Juvenile polyposis syndrome [RCV002056799]|not specified [RCV000483281] | Chr18:51066982..51066999 [GRCh38] Chr18:48593352..48593369 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-128+16_-128+18delinsTT | indel | not specified [RCV000483480] | Chr18:51030639..51030641 [GRCh38] Chr18:48557009..48557011 [GRCh37] Chr18:18q21.2 |
likely benign |
GRCh37/hg19 18q12.2-23(chr18:33417216-78014123)x3 | copy number gain | See cases [RCV000512081] | Chr18:33417216..78014123 [GRCh37] Chr18:18q12.2-23 |
pathogenic |
NM_005359.6(SMAD4):c.641T>A (p.Phe214Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002230329] | Chr18:51054967 [GRCh38] Chr18:48581337 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.260G>C (p.Arg87Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV002230764] | Chr18:51048696 [GRCh38] Chr18:48575066 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.890A>G (p.His297Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002230330] | Chr18:51058442 [GRCh38] Chr18:48584812 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.909T>C (p.Pro303=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311782]|Hereditary cancer-predisposing syndrome [RCV000561608]|Juvenile polyposis syndrome [RCV000459407]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002044]|SMAD4-related disorder [RCV003899949]|not provided [RCV001721510] | Chr18:51059870 [GRCh38] Chr18:48586240 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.692G>C (p.Gly231Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003168958]|Juvenile polyposis syndrome [RCV002230936]|not provided [RCV000479880] | Chr18:51058149 [GRCh38] Chr18:48584519 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1140-10del | deletion | Hereditary cancer-predisposing syndrome [RCV001176888]|Juvenile polyposis syndrome [RCV002063734]|not specified [RCV000479901] | Chr18:51067004 [GRCh38] Chr18:48593374 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.905-19_905-17del | deletion | Hereditary cancer-predisposing syndrome [RCV000579726]|Juvenile polyposis syndrome [RCV002056739]|not specified [RCV000483910] | Chr18:51059845..51059847 [GRCh38] Chr18:48586215..48586217 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.394C>T (p.His132Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002356652]|Juvenile polyposis syndrome [RCV000456145] | Chr18:51048830 [GRCh38] Chr18:48575200 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1125C>T (p.Ala375=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318547]|Juvenile polyposis syndrome [RCV000463436]|Myhre syndrome [RCV002489099] | Chr18:51065592 [GRCh38] Chr18:48591962 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.633T>C (p.Thr211=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311781]|Hereditary cancer-predisposing syndrome [RCV000563457]|Juvenile polyposis syndrome [RCV000467293]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002043]|SMAD4-related disorder [RCV003960050]|not provided [RCV001560498] | Chr18:51054959 [GRCh38] Chr18:48581329 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.554C>A (p.Pro185Gln) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319501]|Hereditary cancer-predisposing syndrome [RCV000775764]|Juvenile polyposis syndrome [RCV000474688]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000672]|not provided [RCV000986026] | Chr18:51054880 [GRCh38] Chr18:48581250 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.560G>A (p.Ser187Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002348279]|Hereditary cancer-predisposing syndrome [RCV000580920]|Juvenile polyposis syndrome [RCV002230325]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003476025] | Chr18:51054886 [GRCh38] Chr18:48581256 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.424+12_424+13del | deletion | Juvenile polyposis syndrome [RCV002056807]|not specified [RCV000484347] | Chr18:51048871..51048872 [GRCh38] Chr18:48575241..48575242 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140G>A (p.Arg380=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002329096]|Hereditary cancer-predisposing syndrome [RCV001017437]|Juvenile polyposis syndrome [RCV000456222]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002041] | Chr18:51067019 [GRCh38] Chr18:48593389 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1597C>T (p.Leu533Phe) | single nucleotide variant | Juvenile polyposis syndrome [RCV002230326] | Chr18:51078405 [GRCh38] Chr18:48604775 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-53_-48del | deletion | not specified [RCV000480335] | Chr18:51046994..51046999 [GRCh38] Chr18:48573364..48573369 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.399C>T (p.Tyr133=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002313197]|Hereditary cancer-predisposing syndrome [RCV000567081]|Juvenile polyposis syndrome [RCV000463836]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002039]|not provided [RCV001547518]|not specified [RCV001192753] | Chr18:51048835 [GRCh38] Chr18:48575205 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.899A>G (p.His300Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002374754]|Juvenile polyposis syndrome [RCV002230762]|not provided [RCV001538748] | Chr18:51058451 [GRCh38] Chr18:48584821 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1052A>T (p.Asp351Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002402237]|Juvenile polyposis syndrome [RCV002230332]|SMAD4-related disorder [RCV003899904]|not specified [RCV000781852] | Chr18:51065519 [GRCh38] Chr18:48591889 [GRCh37] Chr18:18q21.2 |
pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.263_267del (p.Lys88fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV004559073]|Juvenile polyposis syndrome [RCV000467655]|not provided [RCV000581213] | Chr18:51048696..51048700 [GRCh38] Chr18:48575066..48575070 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.-128+6C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002257764]|not provided [RCV000480676] | Chr18:51030629 [GRCh38] Chr18:48556999 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1217C>T (p.Ala406Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311806]|Juvenile polyposis syndrome [RCV001205567]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003392]|not provided [RCV000480708] | Chr18:51067096 [GRCh38] Chr18:48593466 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.181A>G (p.Ile61Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002413323]|Hereditary cancer-predisposing syndrome [RCV000581125]|Juvenile polyposis syndrome [RCV000635474]|Myhre syndrome [RCV000764160]|not provided [RCV000480772]|not specified [RCV003235240] | Chr18:51047227 [GRCh38] Chr18:48573597 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.905-9T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001187835]|Juvenile polyposis syndrome [RCV001427850]|not provided [RCV000484702] | Chr18:51059857 [GRCh38] Chr18:48586227 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NC_000018.9:g.(?_48603008)_(48611412_?)dup | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000456740] | Chr18:51076638..51085042 [GRCh38] Chr18:48603008..48611412 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1632G>A (p.Pro544=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311780]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000460479]|Hereditary cancer-predisposing syndrome [RCV000564724]|Juvenile polyposis syndrome [RCV001420984]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124520]|Myhre syndrome [RCV001124521]|not provided [RCV001284065]|not specified [RCV000615584] | Chr18:51078440 [GRCh38] Chr18:48604810 [GRCh37] Chr18:18q21.2 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NC_000018.10:g.(?_51067019)_(51085042_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000464090] | Chr18:51067019..51085042 [GRCh38] Chr18:48593389..48611412 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1308+10A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000582195]|Juvenile polyposis syndrome [RCV000471749] | Chr18:51067197 [GRCh38] Chr18:48593567 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1259G>A (p.Arg420His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002313244]|Juvenile polyposis syndrome [RCV002231095]|not provided [RCV000480803] | Chr18:51067138 [GRCh38] Chr18:48593508 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1002G>T (p.Gln334His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002395147]|Juvenile polyposis syndrome [RCV000701948]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002283]|not provided [RCV000481014] | Chr18:51065469 [GRCh38] Chr18:48591839 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1A>G (p.Met1Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001865469]|not provided [RCV000481044] | Chr18:51047047 [GRCh38] Chr18:48573417 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1651T>G (p.Leu551Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002402389]|Hereditary cancer-predisposing syndrome [RCV001187836]|Juvenile polyposis syndrome [RCV000694076]|Myhre syndrome [RCV002506165]|not provided [RCV000485032] | Chr18:51078459 [GRCh38] Chr18:48604829 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1198del (p.Arg400fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002318519]|Juvenile polyposis syndrome [RCV002230328] | Chr18:51067077 [GRCh38] Chr18:48593447 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1206T>A (p.Leu402=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318546]|Hereditary cancer-predisposing syndrome [RCV000775646]|Juvenile polyposis syndrome [RCV000475622]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002038] | Chr18:51067085 [GRCh38] Chr18:48593455 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.903C>G (p.Tyr301Ter) | single nucleotide variant | not provided [RCV000484282] | Chr18:51058455 [GRCh38] Chr18:48584825 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1495T>C (p.Cys499Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319001]|Juvenile polyposis syndrome [RCV002230331]|not provided [RCV000489838] | Chr18:51078303 [GRCh38] Chr18:48604673 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.1447+3A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV000464565] | Chr18:51076779 [GRCh38] Chr18:48603149 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668-7C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002258918]|Juvenile polyposis syndrome [RCV001079105]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002045]|not provided [RCV000842150] | Chr18:51058118 [GRCh38] Chr18:48584488 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1295G>A (p.Ser432Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV002230765]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000671] | Chr18:51067174 [GRCh38] Chr18:48593544 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.728_735del (p.Gly243fs) | deletion | Juvenile polyposis syndrome [RCV002230766]|not provided [RCV000481914] | Chr18:51058181..51058188 [GRCh38] Chr18:48584551..48584558 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.888C>G (p.Pro296=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311779]|Hereditary cancer-predisposing syndrome [RCV000563420]|Juvenile polyposis syndrome [RCV000473685]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002042]|not specified [RCV000485346] | Chr18:51058440 [GRCh38] Chr18:48584810 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.668-6C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001176558]|Juvenile polyposis syndrome [RCV001441222] | Chr18:51058119 [GRCh38] Chr18:48584489 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.466A>T (p.Met156Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311769]|Hereditary cancer-predisposing syndrome [RCV000570776]|Juvenile polyposis syndrome [RCV000464936]|not provided [RCV001566748]|not specified [RCV000781854] | Chr18:51054792 [GRCh38] Chr18:48581162 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NC_000018.10:g.(?_51078256)_(51085042_?)dup | duplication | Juvenile polyposis syndrome [RCV000476291] | Chr18:51078256..51085042 [GRCh38] Chr18:48604626..48611412 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-128+19C>T | single nucleotide variant | not provided [RCV000486021] | Chr18:51030642 [GRCh38] Chr18:48557012 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1096C>T (p.Gln366Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318518]|Juvenile polyposis syndrome [RCV002230327] | Chr18:51065563 [GRCh38] Chr18:48591933 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1371A>G (p.Ala457=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311783]|Hereditary cancer-predisposing syndrome [RCV000570305]|Juvenile polyposis syndrome [RCV000468882]|not provided [RCV001591112] | Chr18:51076700 [GRCh38] Chr18:48603070 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.10_11del (p.Met4fs) | microsatellite | Familial thoracic aortic aneurysm and aortic dissection [RCV004559126]|not provided [RCV000478172] | Chr18:51047054..51047055 [GRCh38] Chr18:48573424..48573425 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.332A>C (p.His111Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002446926]|Hereditary cancer-predisposing syndrome [RCV000776540]|Juvenile polyposis syndrome [RCV000635412]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004568175]|not provided [RCV000482083] | Chr18:51048768 [GRCh38] Chr18:48575138 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1529del (p.Gly510fs) | deletion | Juvenile polyposis syndrome [RCV002230333] | Chr18:51078334 [GRCh38] Chr18:48604704 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.870C>T (p.His290=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311784]|Hereditary cancer-predisposing syndrome [RCV000566853]|Juvenile polyposis syndrome [RCV001394874]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002046] | Chr18:51058422 [GRCh38] Chr18:48584792 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity |
NM_005359.6(SMAD4):c.643C>T (p.Pro215Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002356766]|Hereditary cancer-predisposing syndrome [RCV000775794]|Juvenile polyposis syndrome [RCV000807328]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003476154]|not provided [RCV000486636] | Chr18:51054969 [GRCh38] Chr18:48581339 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1489C>T (p.Arg497Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002393090]|Juvenile polyposis syndrome [RCV000465532]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000670] | Chr18:51078297 [GRCh38] Chr18:48604667 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+2T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV000469223]|not provided [RCV002221235] | Chr18:51076778 [GRCh38] Chr18:48603148 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic|not provided |
NM_005359.6(SMAD4):c.799A>C (p.Thr267Pro) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002257760]|Juvenile polyposis syndrome [RCV001851158]|not provided [RCV000482532] | Chr18:51058351 [GRCh38] Chr18:48584721 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+6T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000580296]|Juvenile polyposis syndrome [RCV000458313]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003463858] | Chr18:51054999 [GRCh38] Chr18:48581369 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1311C>G (p.Val437=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002383862]|Hereditary cancer-predisposing syndrome [RCV000775647]|Juvenile polyposis syndrome [RCV000458676]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004002040]|not provided [RCV003418210]|not specified [RCV000614902] | Chr18:51076640 [GRCh38] Chr18:48603010 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1007G>A (p.Gly336Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV002230763] | Chr18:51065474 [GRCh38] Chr18:48591844 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18q21.1-23(chr18:47454437-78014123)x3 | copy number gain | See cases [RCV000510655] | Chr18:47454437..78014123 [GRCh37] Chr18:18q21.1-23 |
pathogenic |
NM_005359.6(SMAD4):c.388C>T (p.Pro130Ser) | single nucleotide variant | not specified [RCV000499605] | Chr18:51048824 [GRCh38] Chr18:48575194 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18q21.1-23(chr18:43776770-78014123)x3 | copy number gain | See cases [RCV000511394] | Chr18:43776770..78014123 [GRCh37] Chr18:18q21.1-23 |
pathogenic |
NM_005359.6(SMAD4):c.209A>G (p.Lys70Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003159637]|Juvenile polyposis syndrome [RCV001857243]|Myhre syndrome [RCV000505822] | Chr18:51047255 [GRCh38] Chr18:48573625 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18q11.1-22.1(chr18:18521285-64495798)x3 | copy number gain | See cases [RCV000511734] | Chr18:18521285..64495798 [GRCh37] Chr18:18q11.1-22.1 |
pathogenic |
NM_005359.6(SMAD4):c.800C>T (p.Thr267Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002420280]|Hereditary cancer-predisposing syndrome [RCV003584638]|Juvenile polyposis syndrome [RCV001341290]|not specified [RCV000506198] | Chr18:51058352 [GRCh38] Chr18:48584722 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18p11.21-q23(chr18:14869204-78014123)x3 | copy number gain | See cases [RCV000512030] | Chr18:14869204..78014123 [GRCh37] Chr18:18p11.21-q23 |
pathogenic |
GRCh37/hg19 18q21.1-23(chr18:46177798-78014123)x1 | copy number loss | See cases [RCV000511759] | Chr18:46177798..78014123 [GRCh37] Chr18:18q21.1-23 |
pathogenic |
GRCh37/hg19 18q12.3-23(chr18:42930373-78014123)x3 | copy number gain | See cases [RCV000511203] | Chr18:42930373..78014123 [GRCh37] Chr18:18q12.3-23 |
pathogenic |
NM_005359.6(SMAD4):c.*4C>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317325] | Chr18:51078471 [GRCh38] Chr18:48604841 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-2A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002529046]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004024594]|not provided [RCV000578818] | Chr18:51048684 [GRCh38] Chr18:48575054 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
GRCh37/hg19 18p11.32-q23(chr18:136227-78014123) | copy number gain | See cases [RCV000511189] | Chr18:136227..78014123 [GRCh37] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.150A>G (p.Lys50=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311905]|Hereditary cancer-predisposing syndrome [RCV000575196]|Juvenile polyposis syndrome [RCV000942155]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001079] | Chr18:51047196 [GRCh38] Chr18:48573566 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1452G>C (p.Leu484=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311932]|Juvenile polyposis syndrome [RCV001496855] | Chr18:51078260 [GRCh38] Chr18:48604630 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1418del (p.Gly473fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002315874]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004024571] | Chr18:51076746 [GRCh38] Chr18:48603116 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.424+19C>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000775309]|Juvenile polyposis syndrome [RCV002066795]|not specified [RCV000606730] | Chr18:51048879 [GRCh38] Chr18:48575249 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.16A>G (p.Ile6Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311914]|Hereditary cancer-predisposing syndrome [RCV000569854]|Juvenile polyposis syndrome [RCV001243344]|not provided [RCV001764673] | Chr18:51047062 [GRCh38] Chr18:48573432 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.745C>G (p.Gln249Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559168]|Juvenile polyposis syndrome [RCV002231367]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004568771] | Chr18:51058202 [GRCh38] Chr18:48584572 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.547C>G (p.Gln183Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311938]|Juvenile polyposis syndrome [RCV002530319] | Chr18:51054873 [GRCh38] Chr18:48581243 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1448-3T>A | single nucleotide variant | not specified [RCV000603516] | Chr18:51078253 [GRCh38] Chr18:48604623 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.927A>G (p.Ala309=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002413483]|Hereditary cancer-predisposing syndrome [RCV003584651]|Juvenile polyposis syndrome [RCV000553936] | Chr18:51059888 [GRCh38] Chr18:48586258 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.264A>G (p.Lys88=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311917]|Hereditary cancer-predisposing syndrome [RCV000575821]|Juvenile polyposis syndrome [RCV000975642]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001084] | Chr18:51048700 [GRCh38] Chr18:48575070 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.160T>C (p.Leu54=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319036]|Hereditary cancer-predisposing syndrome [RCV001012411]|Juvenile polyposis syndrome [RCV000529396]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999043] | Chr18:51047206 [GRCh38] Chr18:48573576 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.570A>C (p.Ala190=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311946]|Juvenile polyposis syndrome [RCV001493764] | Chr18:51054896 [GRCh38] Chr18:48581266 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1438C>T (p.Pro480Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000579655]|Juvenile polyposis syndrome [RCV003762805] | Chr18:51076767 [GRCh38] Chr18:48603137 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1075G>C (p.Gly359Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002420398]|Juvenile polyposis syndrome [RCV002231710] | Chr18:51065542 [GRCh38] Chr18:48591912 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6:c.1309_1447del | deletion | not provided [RCV001284067] | pathogenic | |
NM_005359.6(SMAD4):c.168T>A (p.Ser56=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311936]|Juvenile polyposis syndrome [RCV001441146]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001089] | Chr18:51047214 [GRCh38] Chr18:48573584 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1126A>G (p.Ile376Val) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001185976]|Juvenile polyposis syndrome [RCV000533488]|not provided [RCV001770420] | Chr18:51065593 [GRCh38] Chr18:48591963 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+7T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000777167]|Juvenile polyposis syndrome [RCV000533558] | Chr18:51058463 [GRCh38] Chr18:48584833 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.627C>T (p.Thr209=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002367806]|Juvenile polyposis syndrome [RCV000533872] | Chr18:51054953 [GRCh38] Chr18:48581323 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.327A>G (p.Leu109=) | single nucleotide variant | not specified [RCV000600255] | Chr18:51048763 [GRCh38] Chr18:48575133 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.788-3T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002406360]|Juvenile polyposis syndrome [RCV002234484] | Chr18:51058337 [GRCh38] Chr18:48584707 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.535A>T (p.Ile179Phe) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234489] | Chr18:51054861 [GRCh38] Chr18:48581231 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1645C>T (p.Gln549Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002388034]|Juvenile polyposis syndrome [RCV002233988] | Chr18:51078453 [GRCh38] Chr18:48604823 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1449T>G (p.Ser483Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002388035]|Juvenile polyposis syndrome [RCV002234495] | Chr18:51078257 [GRCh38] Chr18:48604627 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1287C>G (p.Ile429Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234496] | Chr18:51067166 [GRCh38] Chr18:48593536 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249_249+6dup | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV004559273]|Hereditary cancer-predisposing syndrome [RCV001187571]|Juvenile polyposis syndrome [RCV002234497] | Chr18:51047294..51047295 [GRCh38] Chr18:48573664..48573665 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.812G>A (p.Ser271Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002420704]|Hereditary cancer-predisposing syndrome [RCV001181983]|Juvenile polyposis syndrome [RCV002234499]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003471993] | Chr18:51058364 [GRCh38] Chr18:48584734 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.615G>T (p.Glu205Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234501] | Chr18:51054941 [GRCh38] Chr18:48581311 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.47G>C (p.Cys16Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV000635467]|not specified [RCV002265830] | Chr18:51047093 [GRCh38] Chr18:48573463 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.586A>G (p.Ser196Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002358785]|Hereditary cancer-predisposing syndrome [RCV001175700]|Juvenile polyposis syndrome [RCV000635473] | Chr18:51054912 [GRCh38] Chr18:48581282 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.856G>A (p.Gly286Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002448964]|Juvenile polyposis syndrome [RCV000635482]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003471995] | Chr18:51058408 [GRCh38] Chr18:48584778 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1139+10G>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002233995] | Chr18:51065616 [GRCh38] Chr18:48591986 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.159A>G (p.Glu53=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234510] | Chr18:51047205 [GRCh38] Chr18:48573575 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.255T>G (p.Ala85=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002438679]|Juvenile polyposis syndrome [RCV001458647] | Chr18:51048691 [GRCh38] Chr18:48575061 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1533G>T (p.Pro511=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002404767]|Juvenile polyposis syndrome [RCV000635526] | Chr18:51078341 [GRCh38] Chr18:48604711 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.684A>C (p.Ile228=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002367808]|Juvenile polyposis syndrome [RCV002231366]|not provided [RCV001800742]|not specified [RCV003330763] | Chr18:51058141 [GRCh38] Chr18:48584511 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.752del (p.Asn251fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002317319]|Juvenile polyposis syndrome [RCV001859991]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004024577]|not provided [RCV000584098] | Chr18:51058208 [GRCh38] Chr18:48584578 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.461C>G (p.Ser154Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319038]|Juvenile polyposis syndrome [RCV002231363]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004023833] | Chr18:51054787 [GRCh38] Chr18:48581157 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.845A>C (p.His282Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002350217]|Hereditary cancer-predisposing syndrome [RCV000580067]|Juvenile polyposis syndrome [RCV000539961]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999049]|not provided [RCV001591212] | Chr18:51058397 [GRCh38] Chr18:48584767 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.664A>G (p.Thr222Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311911]|Hereditary cancer-predisposing syndrome [RCV003584663]|Juvenile polyposis syndrome [RCV001370742]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001082]|not provided [RCV000986027] | Chr18:51054990 [GRCh38] Chr18:48581360 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.584A>G (p.Tyr195Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311948]|Juvenile polyposis syndrome [RCV003762802] | Chr18:51054910 [GRCh38] Chr18:48581280 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.294C>T (p.Leu98=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311930]|Hereditary cancer-predisposing syndrome [RCV000574905]|Juvenile polyposis syndrome [RCV000866229]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001087]|not provided [RCV003992331]|not specified [RCV000616931] | Chr18:51048730 [GRCh38] Chr18:48575100 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1392C>A (p.Ala464=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311931]|Hereditary cancer-predisposing syndrome [RCV000570072]|Juvenile polyposis syndrome [RCV001504243] | Chr18:51076721 [GRCh38] Chr18:48603091 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1166_1167del (p.Gln388_Leu389insTer) | deletion | Juvenile polyposis syndrome [RCV002231355] | Chr18:51067045..51067046 [GRCh38] Chr18:48593415..48593416 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.566G>A (p.Arg189His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319530]|Hereditary cancer-predisposing syndrome [RCV000579689]|Juvenile polyposis syndrome [RCV002231713]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999046]|Myhre syndrome [RCV000764162]|not provided [RCV001584257]|not specified [RCV002268143] | Chr18:51054892 [GRCh38] Chr18:48581262 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1009G>C (p.Glu337Gln) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315230] | Chr18:51065476 [GRCh38] Chr18:48591846 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-1G>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315232]|Juvenile polyposis syndrome [RCV001039561] | Chr18:51048685 [GRCh38] Chr18:48575055 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.699T>C (p.His233=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002368045]|Juvenile polyposis syndrome [RCV000928598]|not specified [RCV000615071] | Chr18:51058156 [GRCh38] Chr18:48584526 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1276G>A (p.Val426Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002316530]|Juvenile polyposis syndrome [RCV002231711] | Chr18:51067155 [GRCh38] Chr18:48593525 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.4G>A (p.Asp2Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317321] | Chr18:51047050 [GRCh38] Chr18:48573420 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.289C>T (p.Arg97Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315229]|Juvenile polyposis syndrome [RCV001342499] | Chr18:51048725 [GRCh38] Chr18:48575095 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.787+8C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV001416602]|not specified [RCV000612808] | Chr18:51058252 [GRCh38] Chr18:48584622 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-148C>T | single nucleotide variant | not specified [RCV000613144] | Chr18:51030603 [GRCh38] Chr18:48556973 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.384G>A (p.Val128=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001176363]|not specified [RCV000616320] | Chr18:51048820 [GRCh38] Chr18:48575190 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.905-1G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002317323] | Chr18:51059865 [GRCh38] Chr18:48586235 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.181A>C (p.Ile61Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311928]|Juvenile polyposis syndrome [RCV002232645] | Chr18:51047227 [GRCh38] Chr18:48573597 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.378C>T (p.Val126=) | single nucleotide variant | not specified [RCV000610505] | Chr18:51048814 [GRCh38] Chr18:48575184 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-128+19del | deletion | not specified [RCV000616397] | Chr18:51030639 [GRCh38] Chr18:48557009 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.138G>A (p.Lys46=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002315868]|Juvenile polyposis syndrome [RCV002060529] | Chr18:51047184 [GRCh38] Chr18:48573554 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.788-9A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV000525377]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999048] | Chr18:51058331 [GRCh38] Chr18:48584701 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.26C>T (p.Thr9Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559166]|Hereditary cancer-predisposing syndrome [RCV003584649]|Juvenile polyposis syndrome [RCV002231712] | Chr18:51047072 [GRCh38] Chr18:48573442 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-109C>G | single nucleotide variant | not specified [RCV000613815] | Chr18:51046938 [GRCh38] Chr18:48573308 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1566T>G (p.Pro522=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559253]|Juvenile polyposis syndrome [RCV001462323]|not specified [RCV000608371] | Chr18:51078374 [GRCh38] Chr18:48604744 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.837T>C (p.Asn279=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559251]|not specified [RCV000611152] | Chr18:51058389 [GRCh38] Chr18:48584759 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1464T>C (p.Ala488=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002395336]|Juvenile polyposis syndrome [RCV000531515] | Chr18:51078272 [GRCh38] Chr18:48604642 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.372T>C (p.Asp124=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002311923]|Hereditary cancer-predisposing syndrome [RCV000573667]|Juvenile polyposis syndrome [RCV002232644] | Chr18:51048808 [GRCh38] Chr18:48575178 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.935C>G (p.Pro312Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002231715] | Chr18:51059896 [GRCh38] Chr18:48586266 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.955+15_955+17del | deletion | not specified [RCV000612079] | Chr18:51059930..51059932 [GRCh38] Chr18:48586300..48586302 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1226T>C (p.Val409Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV002231356] | Chr18:51067105 [GRCh38] Chr18:48593475 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1585T>C (p.Leu529=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002529546]|not specified [RCV000599669] | Chr18:51078393 [GRCh38] Chr18:48604763 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1324C>T (p.Gln442Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV002233982] | Chr18:51076653 [GRCh38] Chr18:48603023 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.698A>G (p.His233Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002360541]|Juvenile polyposis syndrome [RCV000635433]|not provided [RCV000756670]|not specified [RCV000780717] | Chr18:51058155 [GRCh38] Chr18:48584525 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1309-1G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002386010]|Juvenile polyposis syndrome [RCV002234485] | Chr18:51076637 [GRCh38] Chr18:48603007 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.593C>G (p.Pro198Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003162837]|Juvenile polyposis syndrome [RCV000635435]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003836]|not provided [RCV003319387] | Chr18:51054919 [GRCh38] Chr18:48581289 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.454+2T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002233983] | Chr18:51049326 [GRCh38] Chr18:48575696 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.955+1del | deletion | Juvenile polyposis syndrome [RCV002233984] | Chr18:51059916 [GRCh38] Chr18:48586286 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.565C>A (p.Arg189Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234500] | Chr18:51054891 [GRCh38] Chr18:48581261 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.340T>A (p.Tyr114Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234505] | Chr18:51048776 [GRCh38] Chr18:48575146 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1409del (p.Pro470fs) | deletion | Juvenile polyposis syndrome [RCV002233994]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004568396] | Chr18:51076736 [GRCh38] Chr18:48603106 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.918T>G (p.Asn306Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234507] | Chr18:51059879 [GRCh38] Chr18:48586249 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1035C>T (p.Cys345=) | single nucleotide variant | Juvenile polyposis syndrome [RCV000635492] | Chr18:51065502 [GRCh38] Chr18:48591872 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.816G>A (p.Arg272=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002448965]|Hereditary cancer-predisposing syndrome [RCV001027241]|Juvenile polyposis syndrome [RCV000635496]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003837]|not provided [RCV001712772] | Chr18:51058368 [GRCh38] Chr18:48584738 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.351T>C (p.Tyr117=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319072]|Juvenile polyposis syndrome [RCV002233996] | Chr18:51048787 [GRCh38] Chr18:48575157 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.615G>A (p.Glu205=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559274]|Juvenile polyposis syndrome [RCV000635513] | Chr18:51054941 [GRCh38] Chr18:48581311 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.705A>G (p.Glu235=) | single nucleotide variant | Juvenile polyposis syndrome [RCV000635525] | Chr18:51058162 [GRCh38] Chr18:48584532 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-16C>A | single nucleotide variant | Juvenile polyposis syndrome [RCV001860290]|not specified [RCV000604877] | Chr18:51058109 [GRCh38] Chr18:48584479 [GRCh37] Chr18:18q21.2 |
likely benign |
GRCh37/hg19 18q12.1-23(chr18:31879854-78014123)x3 | copy number gain | See cases [RCV000512425] | Chr18:31879854..78014123 [GRCh37] Chr18:18q12.1-23 |
pathogenic |
NM_005359.6(SMAD4):c.628A>G (p.Ser210Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV002233145] | Chr18:51054954 [GRCh38] Chr18:48581324 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.427C>T (p.Leu143Phe) | single nucleotide variant | Juvenile polyposis syndrome [RCV002232852] | Chr18:51049297 [GRCh38] Chr18:48575667 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1523G>A (p.Gly508Asp) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000664319] | Chr18:51078331 [GRCh38] Chr18:48604701 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1647del (p.Gln549fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002397344]|Generalized juvenile polyposis/juvenile polyposis coli [RCV000662977]|Juvenile polyposis syndrome [RCV002530601]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004004207] | Chr18:51078454 [GRCh38] Chr18:48604824 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904T>C (p.Trp302Arg) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000662458]|Juvenile polyposis syndrome [RCV003596488]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003316782] | Chr18:51058456 [GRCh38] Chr18:48584826 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.290G>T (p.Arg97Leu) | single nucleotide variant | Heritable Thoracic Aortic Disease [RCV000678041]|Heritable thoracic aortic disease without juvenile polyposis and hereditary hemorrhagic telangiectasia [RCV001261772]|Juvenile polyposis syndrome [RCV001304441] | Chr18:51048726 [GRCh38] Chr18:48575096 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.580A>G (p.Thr194Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002352192]|Juvenile polyposis syndrome [RCV000700989] | Chr18:51054906 [GRCh38] Chr18:48581276 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+20T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002060852]|not provided [RCV000679587] | Chr18:51047315 [GRCh38] Chr18:48573685 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455C>A (p.Ala152Asp) | single nucleotide variant | not provided [RCV000679590] | Chr18:51054781 [GRCh38] Chr18:48581151 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18q21.1-23(chr18:46942427-78014123)x1 | copy number loss | not provided [RCV000684060] | Chr18:46942427..78014123 [GRCh37] Chr18:18q21.1-23 |
pathogenic |
GRCh37/hg19 18q12.2-21.31(chr18:35866313-55082983)x3 | copy number gain | not provided [RCV000684057] | Chr18:35866313..55082983 [GRCh37] Chr18:18q12.2-21.31 |
pathogenic |
NM_005359.6(SMAD4):c.667+10A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001189630]|Juvenile polyposis syndrome [RCV001454204]|not provided [RCV000679591] | Chr18:51055003 [GRCh38] Chr18:48581373 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.367T>C (p.Cys123Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002232855] | Chr18:51048803 [GRCh38] Chr18:48575173 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.939dup (p.Ile314fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002406615]|Juvenile polyposis syndrome [RCV002234107] | Chr18:51059897..51059898 [GRCh38] Chr18:48586267..48586268 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.760A>G (p.Thr254Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV002233152] | Chr18:51058217 [GRCh38] Chr18:48584587 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-2A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002233558] | Chr18:51067017 [GRCh38] Chr18:48593387 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.661T>A (p.Ser221Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002232857] | Chr18:51054987 [GRCh38] Chr18:48581357 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.585C>G (p.Tyr195Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002352125]|Juvenile polyposis syndrome [RCV002233154] | Chr18:51054911 [GRCh38] Chr18:48581281 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1138A>T (p.Arg380Trp) | single nucleotide variant | Juvenile polyposis syndrome [RCV002233708] | Chr18:51065605 [GRCh38] Chr18:48591975 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.290G>A (p.Arg97His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002440531]|Juvenile polyposis syndrome [RCV000704710] | Chr18:51048726 [GRCh38] Chr18:48575096 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1572G>A (p.Trp524Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV000691045] | Chr18:51078380 [GRCh38] Chr18:48604750 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.5(SMAD4):c.1616_1631del16insCA (p.Val539Alafs) | indel | Juvenile polyposis syndrome [RCV002544821] | Chr18:51078424..51078439 [GRCh38] Chr18:48604794..48604809 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1591C>T (p.Arg531Trp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002397382]|Juvenile polyposis syndrome [RCV002232881]|not specified [RCV001174759] | Chr18:51078399 [GRCh38] Chr18:48604769 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668-3T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002232883] | Chr18:51058122 [GRCh38] Chr18:48584492 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.10:g.(?_51076628)_(51078477_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000708206] | Chr18:51076628..51078477 [GRCh38] Chr18:48602998..48604847 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.787A>G (p.Asn263Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV002233584] | Chr18:51058244 [GRCh38] Chr18:48584614 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667A>G (p.Ser223Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002352140]|Hereditary cancer-predisposing syndrome [RCV001025524]|Juvenile polyposis syndrome [RCV002233540] | Chr18:51054993 [GRCh38] Chr18:48581363 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.688G>C (p.Gly230Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002233330]|Myhre syndrome [RCV002507216] | Chr18:51058145 [GRCh38] Chr18:48584515 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.512C>T (p.Ser171Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002334262]|Hereditary cancer-predisposing syndrome [RCV002257927]|Juvenile polyposis syndrome [RCV000687533] | Chr18:51054838 [GRCh38] Chr18:48581208 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.707G>A (p.Gly236Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV000692896] | Chr18:51058164 [GRCh38] Chr18:48584534 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.8A>G (p.Asn3Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002369953]|Juvenile polyposis syndrome [RCV002233409]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003999754]|not provided [RCV002274093] | Chr18:51047054 [GRCh38] Chr18:48573424 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.969G>T (p.Trp323Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV002233606] | Chr18:51065436 [GRCh38] Chr18:48591806 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.10:g.(?_51030213)_(51078477_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000707986] | Chr18:51030213..51078477 [GRCh38] Chr18:48556583..48604847 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1343_1367del (p.Gln448fs) | deletion | Juvenile polyposis syndrome [RCV002233260] | Chr18:51076670..51076694 [GRCh38] Chr18:48603040..48603064 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1612G>T (p.Glu538Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV002233690] | Chr18:51078420 [GRCh38] Chr18:48604790 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.842C>T (p.Pro281Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002442533]|Juvenile polyposis syndrome [RCV000706245]|not provided [RCV001772009] | Chr18:51058394 [GRCh38] Chr18:48584764 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+4A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002233691] | Chr18:51076780 [GRCh38] Chr18:48603150 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.399C>A (p.Tyr133Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV002235041] | Chr18:51048835 [GRCh38] Chr18:48575205 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.11T>C (p.Met4Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001907861] | Chr18:51047057 [GRCh38] Chr18:48573427 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1352C>A (p.Ala451Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234878] | Chr18:51076681 [GRCh38] Chr18:48603051 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+44_904+45dup | duplication | not provided [RCV001609157] | Chr18:51058485..51058486 [GRCh38] Chr18:48584855..48584856 [GRCh37] Chr18:18q21.2 |
benign |
GRCh37/hg19 18q11.1-21.2(chr18:18539806-49926444)x2 | copy number gain | not provided [RCV000739776] | Chr18:18539806..49926444 [GRCh37] Chr18:18q11.1-21.2 |
pathogenic |
NM_005359.6(SMAD4):c.956-178A>G | single nucleotide variant | not provided [RCV001535068] | Chr18:51065245 [GRCh38] Chr18:48591615 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1050T>G (p.Val350=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559807]|Juvenile polyposis syndrome [RCV001427879] | Chr18:51065517 [GRCh38] Chr18:48591887 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.903C>T (p.Tyr301=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003584814]|Juvenile polyposis syndrome [RCV001065119] | Chr18:51058455 [GRCh38] Chr18:48584825 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NC_000018.10:g.(?_51029921)_(51078477_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV001032209] | Chr18:48556291..48604847 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.922C>G (p.Leu308Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002400189]|Hereditary cancer-predisposing syndrome [RCV001019037]|Juvenile polyposis syndrome [RCV001223232] | Chr18:51059883 [GRCh38] Chr18:48586253 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18p11.32-q23(chr18:12842-78015180)x3 | copy number gain | not provided [RCV000752245] | Chr18:12842..78015180 [GRCh37] Chr18:18p11.32-q23 |
pathogenic |
GRCh37/hg19 18p11.32-q23(chr18:13034-78015180)x3 | copy number gain | not provided [RCV000752246] | Chr18:13034..78015180 [GRCh37] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.1514_1515del (p.Phe505fs) | deletion | not provided [RCV000996688] | Chr18:51078320..51078321 [GRCh38] Chr18:48604690..48604691 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.*17G>A | single nucleotide variant | not provided [RCV001581885] | Chr18:51078484 [GRCh38] Chr18:48604854 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1045dup (p.Thr349fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002400160]|not provided [RCV000986024] | Chr18:51065511..51065512 [GRCh38] Chr18:48591881..48591882 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1269A>C (p.Gly423=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002067571]|not provided [RCV000986025] | Chr18:51067148 [GRCh38] Chr18:48593518 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1200G>A (p.Arg400=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001432794] | Chr18:51067079 [GRCh38] Chr18:48593449 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.360C>T (p.Asp120=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001452136] | Chr18:51048796 [GRCh38] Chr18:48575166 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1512T>C (p.Ser504=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002390994]|Juvenile polyposis syndrome [RCV001489288]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004004340] | Chr18:51078320 [GRCh38] Chr18:48604690 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.788-7T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001178654]|Juvenile polyposis syndrome [RCV000921977] | Chr18:51058333 [GRCh38] Chr18:48584703 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.435A>G (p.Gly145=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001430594] | Chr18:51049305 [GRCh38] Chr18:48575675 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+7T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV000982996] | Chr18:51055000 [GRCh38] Chr18:48581370 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.390A>T (p.Pro130=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002354777]|Juvenile polyposis syndrome [RCV001473297] | Chr18:51048826 [GRCh38] Chr18:48575196 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.108A>G (p.Ala36=) | single nucleotide variant | Juvenile polyposis syndrome [RCV000983553] | Chr18:51047154 [GRCh38] Chr18:48573524 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.576A>G (p.Thr192=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002332877]|Juvenile polyposis syndrome [RCV001466704]|not provided [RCV003478575] | Chr18:51054902 [GRCh38] Chr18:48581272 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.843T>C (p.Pro281=) | single nucleotide variant | Juvenile polyposis syndrome [RCV000983510] | Chr18:51058395 [GRCh38] Chr18:48584765 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.642T>C (p.Phe214=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002363444]|Juvenile polyposis syndrome [RCV001391853] | Chr18:51054968 [GRCh38] Chr18:48581338 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.249+7C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV000925496]|not specified [RCV002271597] | Chr18:51047302 [GRCh38] Chr18:48573672 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.817A>G (p.Thr273Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV001038784] | Chr18:51058369 [GRCh38] Chr18:48584739 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.952C>G (p.Pro318Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV001061911]|not provided [RCV001508830] | Chr18:51059913 [GRCh38] Chr18:48586283 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.321_330dup (p.His111Ter) | duplication | Juvenile polyposis syndrome [RCV001056295] | Chr18:51048752..51048753 [GRCh38] Chr18:48575122..48575123 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.680G>T (p.Ser227Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002365694]|Juvenile polyposis syndrome [RCV001049674]|not provided [RCV001284066] | Chr18:51058137 [GRCh38] Chr18:48584507 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.476A>G (p.Lys159Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002337107]|Juvenile polyposis syndrome [RCV001039027] | Chr18:51054802 [GRCh38] Chr18:48581172 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.47G>A (p.Cys16Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559871]|Juvenile polyposis syndrome [RCV001051762] | Chr18:51047093 [GRCh38] Chr18:48573463 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+35T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003316910] | Chr18:51058491 [GRCh38] Chr18:48584861 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.955+4A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003160246]|Juvenile polyposis syndrome [RCV001038622] | Chr18:51059920 [GRCh38] Chr18:48586290 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*14T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000772398] | Chr18:51078481 [GRCh38] Chr18:48604851 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.780C>T (p.Tyr260=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002440610]|Hereditary cancer-predisposing syndrome [RCV000774799]|Juvenile polyposis syndrome [RCV001428360] | Chr18:51058237 [GRCh38] Chr18:48584607 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1139+17C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000772699]|Juvenile polyposis syndrome [RCV002534029] | Chr18:51065623 [GRCh38] Chr18:48591993 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1339A>C (p.Met447Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002386335]|Hereditary cancer-predisposing syndrome [RCV000772782]|Juvenile polyposis syndrome [RCV001850965]|Myhre syndrome [RCV002500999] | Chr18:51076668 [GRCh38] Chr18:48603038 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.442C>G (p.Leu148Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319099]|Hereditary cancer-predisposing syndrome [RCV000772807] | Chr18:51049312 [GRCh38] Chr18:48575682 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.860A>G (p.His287Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002442578]|Hereditary cancer-predisposing syndrome [RCV000772845]|Juvenile polyposis syndrome [RCV001043624] | Chr18:51058412 [GRCh38] Chr18:48584782 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1479T>C (p.Asp493=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559646]|Hereditary cancer-predisposing syndrome [RCV000772866]|Juvenile polyposis syndrome [RCV001454731] | Chr18:51078287 [GRCh38] Chr18:48604657 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.333T>A (p.His111Gln) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000772878] | Chr18:51048769 [GRCh38] Chr18:48575139 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+21dup | duplication | Hereditary cancer-predisposing syndrome [RCV000772920]|Juvenile polyposis syndrome [RCV002536639] | Chr18:51047311..51047312 [GRCh38] Chr18:48573681..48573682 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.55A>G (p.Ile19Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002343631]|Hereditary cancer-predisposing syndrome [RCV000774816]|Juvenile polyposis syndrome [RCV001873150] | Chr18:51047101 [GRCh38] Chr18:48573471 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*7_*8del | deletion | Hereditary cancer-predisposing syndrome [RCV000772442] | Chr18:51078472..51078473 [GRCh38] Chr18:48604842..48604843 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1326G>A (p.Gln442=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000773393]|Juvenile polyposis syndrome [RCV003768339] | Chr18:51076655 [GRCh38] Chr18:48603025 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.568G>T (p.Ala190Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000773452] | Chr18:51054894 [GRCh38] Chr18:48581264 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1448-18C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000773518]|Juvenile polyposis syndrome [RCV002534073] | Chr18:51078238 [GRCh38] Chr18:48604608 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1131G>C (p.Glu377Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV000770699] | Chr18:51065598 [GRCh38] Chr18:48591968 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.304C>G (p.Pro102Ala) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000773552] | Chr18:51048740 [GRCh38] Chr18:48575110 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.651T>G (p.Ile217Met) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002360881]|Hereditary cancer-predisposing syndrome [RCV000773555]|Juvenile polyposis syndrome [RCV000821627] | Chr18:51054977 [GRCh38] Chr18:48581347 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1326G>C (p.Gln442His) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000774850]|Juvenile polyposis syndrome [RCV002534159] | Chr18:51076655 [GRCh38] Chr18:48603025 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.787+15T>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000774885]|Juvenile polyposis syndrome [RCV002534164] | Chr18:51058259 [GRCh38] Chr18:48584629 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.907C>G (p.Pro303Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002386341]|Hereditary cancer-predisposing syndrome [RCV000773779]|Juvenile polyposis syndrome [RCV001208046]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001327] | Chr18:51059868 [GRCh38] Chr18:48586238 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.787+1G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002406694]|Hereditary cancer-predisposing syndrome [RCV000773814]|Juvenile polyposis syndrome [RCV002534098] | Chr18:51058245 [GRCh38] Chr18:48584615 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.1148T>C (p.Ile383Thr) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000773815]|Juvenile polyposis syndrome [RCV001856069]|not provided [RCV001357376] | Chr18:51067027 [GRCh38] Chr18:48593397 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.652C>G (p.Pro218Ala) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000774967]|Juvenile polyposis syndrome [RCV003762875]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001423]|not provided [RCV003313146] | Chr18:51054978 [GRCh38] Chr18:48581348 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.*14T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000775310] | Chr18:51078481 [GRCh38] Chr18:48604851 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1008A>G (p.Gly336=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000774116]|Juvenile polyposis syndrome [RCV000934166] | Chr18:51065475 [GRCh38] Chr18:48591845 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+7A>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000775640]|Juvenile polyposis syndrome [RCV001404195] | Chr18:51049331 [GRCh38] Chr18:48575701 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.614A>C (p.Glu205Ala) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000775641]|Juvenile polyposis syndrome [RCV001210687] | Chr18:51054940 [GRCh38] Chr18:48581310 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.700A>C (p.Ser234Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002397549]|Hereditary cancer-predisposing syndrome [RCV000775642]|Juvenile polyposis syndrome [RCV001052363] | Chr18:51058157 [GRCh38] Chr18:48584527 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.788-14G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000775643]|Juvenile polyposis syndrome [RCV002067322] | Chr18:51058326 [GRCh38] Chr18:48584696 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.955+19T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000775644] | Chr18:51059935 [GRCh38] Chr18:48586305 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.620A>G (p.Asn207Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000775847] | Chr18:51054946 [GRCh38] Chr18:48581316 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.954T>A (p.Pro318=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002370051]|Hereditary cancer-predisposing syndrome [RCV000775866] | Chr18:51059915 [GRCh38] Chr18:48586285 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*13T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000776132] | Chr18:51078480 [GRCh38] Chr18:48604850 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*1G>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000776603]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001477] | Chr18:51078468 [GRCh38] Chr18:48604838 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.585C>T (p.Tyr195=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002334451]|Hereditary cancer-predisposing syndrome [RCV000776640] | Chr18:51054911 [GRCh38] Chr18:48581281 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1090T>C (p.Leu364=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002442580]|Hereditary cancer-predisposing syndrome [RCV000773330]|Juvenile polyposis syndrome [RCV001421698] | Chr18:51065557 [GRCh38] Chr18:48591927 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.279G>C (p.Val93=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559649]|Juvenile polyposis syndrome [RCV002067385]|not specified [RCV000781855] | Chr18:51048715 [GRCh38] Chr18:48575085 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.198T>C (p.Ala66=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002422663]|Hereditary cancer-predisposing syndrome [RCV000776680]|Juvenile polyposis syndrome [RCV003762877] | Chr18:51047244 [GRCh38] Chr18:48573614 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1258C>T (p.Arg420Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002424775]|Hereditary cancer-predisposing syndrome [RCV000776700]|Juvenile polyposis syndrome [RCV001206717]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003472304] | Chr18:51067137 [GRCh38] Chr18:48593507 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.530A>C (p.His177Pro) | single nucleotide variant | Carcinoma of pancreas [RCV001196539]|Hereditary cancer-predisposing syndrome [RCV000776746]|Juvenile polyposis syndrome [RCV001050665] | Chr18:51054856 [GRCh38] Chr18:48581226 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1309G>A (p.Val437Ile) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000776864]|Juvenile polyposis syndrome [RCV001856136]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001262036] | Chr18:51076638 [GRCh38] Chr18:48603008 [GRCh37] Chr18:18q21.2 |
likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.795T>C (p.Thr265=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002422664]|Hereditary cancer-predisposing syndrome [RCV000776957] | Chr18:51058347 [GRCh38] Chr18:48584717 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.432A>C (p.Ser144=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000777028]|Juvenile polyposis syndrome [RCV001475675] | Chr18:51049302 [GRCh38] Chr18:48575672 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.5(SMAD4):c.675_676delTGinsCC (p.Ala226Pro) | indel | Hereditary cancer-predisposing syndrome [RCV000771349] | Chr18:51058132..51058133 [GRCh38] Chr18:48584502..48584503 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+17T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000777137]|Juvenile polyposis syndrome [RCV003768415] | Chr18:51076793 [GRCh38] Chr18:48603163 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.58G>T (p.Val20Leu) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000777148] | Chr18:51047104 [GRCh38] Chr18:48573474 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.580A>T (p.Thr194Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000777357]|Juvenile polyposis syndrome [RCV003762878] | Chr18:51054906 [GRCh38] Chr18:48581276 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+22_667+24del | deletion | Hereditary cancer-predisposing syndrome [RCV000771624]|Juvenile polyposis syndrome [RCV002067229] | Chr18:51055013..51055015 [GRCh38] Chr18:48581383..48581385 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1530A>G (p.Gly510=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559647]|Hereditary cancer-predisposing syndrome [RCV000777437]|Juvenile polyposis syndrome [RCV001505361] | Chr18:51078338 [GRCh38] Chr18:48604708 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1309-5A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318891]|Hereditary cancer-predisposing syndrome [RCV000777455]|Juvenile polyposis syndrome [RCV003596555] | Chr18:51076633 [GRCh38] Chr18:48603003 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.679A>G (p.Ser227Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002360895]|Hereditary cancer-predisposing syndrome [RCV000777492]|Juvenile polyposis syndrome [RCV001221876]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001501] | Chr18:51058136 [GRCh38] Chr18:48584506 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.887C>A (p.Pro296His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559648]|Hereditary cancer-predisposing syndrome [RCV000777515]|Juvenile polyposis syndrome [RCV001869126] | Chr18:51058439 [GRCh38] Chr18:48584809 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1067dup (p.Ser357fs) | duplication | Juvenile polyposis syndrome [RCV000814633] | Chr18:51065531..51065532 [GRCh38] Chr18:48591901..48591902 [GRCh37] Chr18:18q21.2 |
pathogenic |
NC_000018.9:g.(?_48556583)_(48604847_?)dup | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000816619]|Juvenile polyposis syndrome [RCV001856255] | Chr18:51030213..51078477 [GRCh38] Chr18:48556583..48604847 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.209A>C (p.Lys70Thr) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV000772363]|Juvenile polyposis syndrome [RCV001035151] | Chr18:51047255 [GRCh38] Chr18:48573625 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.723A>T (p.Ala241=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002372687]|Juvenile polyposis syndrome [RCV001453866] | Chr18:51058180 [GRCh38] Chr18:48584550 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.186T>A (p.Thr62=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001463142] | Chr18:51047232 [GRCh38] Chr18:48573602 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-4A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319125]|Juvenile polyposis syndrome [RCV001485165]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003164]|SMAD4-related disorder [RCV003958272] | Chr18:51054777 [GRCh38] Chr18:48581147 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.956-4A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV000940362] | Chr18:51065419 [GRCh38] Chr18:48591789 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.408T>C (p.Val136=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319121]|Juvenile polyposis syndrome [RCV001446116]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003120] | Chr18:51048844 [GRCh38] Chr18:48575214 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+10T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV000981401] | Chr18:51058466 [GRCh38] Chr18:48584836 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1464T>G (p.Ala488=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002390791]|Hereditary cancer-predisposing syndrome [RCV003584772]|Juvenile polyposis syndrome [RCV001484588] | Chr18:51078272 [GRCh38] Chr18:48604642 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.402A>G (p.Glu134=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001498090] | Chr18:51048838 [GRCh38] Chr18:48575208 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.285T>C (p.Tyr95=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002434236]|Hereditary cancer-predisposing syndrome [RCV001179746]|Juvenile polyposis syndrome [RCV001435450] | Chr18:51048721 [GRCh38] Chr18:48575091 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1449T>C (p.Ser483=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559742]|Juvenile polyposis syndrome [RCV001433138] | Chr18:51078257 [GRCh38] Chr18:48604627 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1146C>T (p.His382=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559762]|Juvenile polyposis syndrome [RCV001481360] | Chr18:51067025 [GRCh38] Chr18:48593395 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.810A>C (p.Gly270=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001478546] | Chr18:51058362 [GRCh38] Chr18:48584732 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.339A>G (p.Lys113=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002458397]|Juvenile polyposis syndrome [RCV002067371]|not specified [RCV000780720] | Chr18:51048775 [GRCh38] Chr18:48575145 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.682A>G (p.Ile228Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002386320]|Hereditary cancer-predisposing syndrome [RCV003584738]|Juvenile polyposis syndrome [RCV001066745]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003472281]|not provided [RCV000759349] | Chr18:51058139 [GRCh38] Chr18:48584509 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+137T>G | single nucleotide variant | not provided [RCV000835610] | Chr18:51058593 [GRCh38] Chr18:48584963 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1321C>T (p.Arg441Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318892]|Juvenile polyposis syndrome [RCV002234208]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004569516] | Chr18:51076650 [GRCh38] Chr18:48603020 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1194G>A (p.Trp398Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318896]|Juvenile polyposis syndrome [RCV002235420]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004029096] | Chr18:51067073 [GRCh38] Chr18:48593443 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.691G>C (p.Gly231Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002235569] | Chr18:51058148 [GRCh38] Chr18:48584518 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+6T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002235583] | Chr18:51047301 [GRCh38] Chr18:48573671 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.10:g.(?_51030213)_(51030623_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV000798828]|Juvenile polyposis syndrome [RCV001873239] | Chr18:51030213..51030623 [GRCh38] Chr18:48556583..48556993 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.652C>A (p.Pro218Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002363136]|Hereditary cancer-predisposing syndrome [RCV001190536]|Juvenile polyposis syndrome [RCV002235089]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004569723] | Chr18:51054978 [GRCh38] Chr18:48581348 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.451A>G (p.Asn151Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002336621]|Juvenile polyposis syndrome [RCV000803190]|not provided [RCV003141801] | Chr18:51049321 [GRCh38] Chr18:48575691 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1148T>G (p.Ile383Arg) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV000807488] | Chr18:51067027 [GRCh38] Chr18:48593397 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.1213C>T (p.His405Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002352393]|Hereditary cancer-predisposing syndrome [RCV001187709]|Juvenile polyposis syndrome [RCV002235785]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003472399]|not provided [RCV001788356] | Chr18:51067092 [GRCh38] Chr18:48593462 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+238C>A | single nucleotide variant | not provided [RCV000836562] | Chr18:51055231 [GRCh38] Chr18:48581601 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.822_823delinsCG (p.Pro275Ala) | indel | not provided [RCV000986030] | Chr18:51058374..51058375 [GRCh38] Chr18:48584744..48584745 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1322G>A (p.Arg441His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318894]|Juvenile polyposis syndrome [RCV002234349]|not provided [RCV003329343] | Chr18:51076651 [GRCh38] Chr18:48603021 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+300del | deletion | not provided [RCV000840784] | Chr18:51047595 [GRCh38] Chr18:48573965 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.1119A>T (p.Thr373=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318897]|Hereditary cancer-predisposing syndrome [RCV001009909]|Juvenile polyposis syndrome [RCV001088288]|not provided [RCV000831512] | Chr18:51065586 [GRCh38] Chr18:48591956 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1249_1250del (p.Glu417fs) | microsatellite | Juvenile polyposis syndrome [RCV002234770] | Chr18:51067125..51067126 [GRCh38] Chr18:48593495..48593496 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.546C>G (p.Ile182Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV000817707] | Chr18:51054872 [GRCh38] Chr18:48581242 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1309-67G>C | single nucleotide variant | not provided [RCV000835104] | Chr18:51076571 [GRCh38] Chr18:48602941 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.196G>A (p.Ala66Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002235386] | Chr18:51047242 [GRCh38] Chr18:48573612 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.443del (p.Leu148fs) | deletion | Juvenile polyposis syndrome [RCV002234304] | Chr18:51049313 [GRCh38] Chr18:48575683 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.923T>C (p.Leu308Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV000800233] | Chr18:51059884 [GRCh38] Chr18:48586254 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.478G>A (p.Asp160Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234899] | Chr18:51054804 [GRCh38] Chr18:48581174 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-256G>A | single nucleotide variant | not provided [RCV000840586] | Chr18:51066763 [GRCh38] Chr18:48593133 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.1447+257T>C | single nucleotide variant | not provided [RCV000840587] | Chr18:51077033 [GRCh38] Chr18:48603403 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.1363C>T (p.Gln455Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234724] | Chr18:51076692 [GRCh38] Chr18:48603062 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.249+135T>C | single nucleotide variant | not provided [RCV000837486] | Chr18:51047430 [GRCh38] Chr18:48573800 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.775A>G (p.Thr259Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV000804629] | Chr18:51058232 [GRCh38] Chr18:48584602 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.422T>C (p.Ile141Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002235290] | Chr18:51048858 [GRCh38] Chr18:48575228 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1063_1064insGACCCTTCTGGAGGAGATCGCTTTTGTTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGGTATTGATTG (p.Asp355delinsGlyProPheTrpArgArgSerLeuLeuPheGlySerThrLeuGlnCysProGlnAspArgSerHisTer) | insertion | Juvenile polyposis syndrome [RCV002235534] | Chr18:51065529..51065530 [GRCh38] Chr18:48591899..48591900 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.629G>A (p.Ser210Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV002235553] | Chr18:51054955 [GRCh38] Chr18:48581325 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(?_48556583)_(48603156_?)dup | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000809303] | Chr18:51030213..51076786 [GRCh38] Chr18:48556583..48603156 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18q21.1-21.33(chr18:45621155-61416536)x3 | copy number gain | not provided [RCV000847118] | Chr18:45621155..61416536 [GRCh37] Chr18:18q21.1-21.33 |
pathogenic |
NC_000018.10:g.(?_51030213)_(51078467_?)del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV001032117]|Juvenile polyposis syndrome [RCV004579566] | Chr18:48556583..48604837 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.991A>G (p.Met331Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002445163]|Hereditary cancer-predisposing syndrome [RCV003584795] | Chr18:51065458 [GRCh38] Chr18:48591828 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1342C>G (p.Gln448Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318895]|Juvenile polyposis syndrome [RCV002235130] | Chr18:51076671 [GRCh38] Chr18:48603041 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.3G>C (p.Met1Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002370069]|Hereditary cancer-predisposing syndrome [RCV003584747]|Juvenile polyposis syndrome [RCV002233848] | Chr18:51047049 [GRCh38] Chr18:48573419 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1018A>G (p.Lys340Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234854] | Chr18:51065485 [GRCh38] Chr18:48591855 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1138A>G (p.Arg380Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318912] | Chr18:51065605 [GRCh38] Chr18:48591975 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.505C>T (p.Gln169Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319394]|Hereditary cancer-predisposing syndrome [RCV003584798]|Juvenile polyposis syndrome [RCV001387868]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004030837] | Chr18:51054831 [GRCh38] Chr18:48581201 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.203C>T (p.Pro68Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234700] | Chr18:51047249 [GRCh38] Chr18:48573619 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1177G>A (p.Gly393Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318915] | Chr18:51067056 [GRCh38] Chr18:48593426 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.267A>T (p.Gly89=) | single nucleotide variant | Juvenile polyposis syndrome [RCV000822613] | Chr18:51048703 [GRCh38] Chr18:48575073 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+215A>G | single nucleotide variant | not provided [RCV000836600] | Chr18:51047510 [GRCh38] Chr18:48573880 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.1352C>T (p.Ala451Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559655]|Juvenile polyposis syndrome [RCV002233842]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004001566] | Chr18:51076681 [GRCh38] Chr18:48603051 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-127-306G>A | single nucleotide variant | not provided [RCV000840585] | Chr18:51046614 [GRCh38] Chr18:48572984 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.685C>T (p.Leu229=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002363302]|Juvenile polyposis syndrome [RCV000875772] | Chr18:51058142 [GRCh38] Chr18:48584512 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.686T>G (p.Leu229Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002360919]|Hereditary cancer-predisposing syndrome [RCV002257956]|Juvenile polyposis syndrome [RCV002233865] | Chr18:51058143 [GRCh38] Chr18:48584513 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.997G>A (p.Val333Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002442655]|Juvenile polyposis syndrome [RCV000800540] | Chr18:51065464 [GRCh38] Chr18:48591834 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.69del (p.Met24fs) | deletion | Juvenile polyposis syndrome [RCV002234901] | Chr18:51047115 [GRCh38] Chr18:48573485 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.420A>C (p.Gly140=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002327203]|Juvenile polyposis syndrome [RCV000980402] | Chr18:51048856 [GRCh38] Chr18:48575226 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1604_1605delinsAA (p.Leu535Gln) | indel | Juvenile polyposis syndrome [RCV002234910] | Chr18:51078412..51078413 [GRCh38] Chr18:48604782..48604783 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.247C>T (p.Gln83Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV002234940] | Chr18:51047293 [GRCh38] Chr18:48573663 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1588C>A (p.His530Asn) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003584754]|Juvenile polyposis syndrome [RCV002234949]|not provided [RCV003235404] | Chr18:51078396 [GRCh38] Chr18:48604766 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.457C>T (p.Pro153Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319109]|Juvenile polyposis syndrome [RCV000803964]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003472376]|not specified [RCV003323726] | Chr18:51054783 [GRCh38] Chr18:48581153 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.885G>T (p.Pro295=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002444956]|Juvenile polyposis syndrome [RCV001462565] | Chr18:51058437 [GRCh38] Chr18:48584807 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.731C>T (p.Pro244Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV002235297] | Chr18:51058188 [GRCh38] Chr18:48584558 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.10:g.51058118C>T | single nucleotide variant | not provided [RCV000842150] | Chr18:48584488 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.905-3T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002370164]|Hereditary cancer-predisposing syndrome [RCV003584758]|Juvenile polyposis syndrome [RCV002235789] | Chr18:51059863 [GRCh38] Chr18:48586233 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.433G>A (p.Gly145Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319342] | Chr18:51049303 [GRCh38] Chr18:48575673 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.415_416del (p.Pro139fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002319324] | Chr18:51048851..51048852 [GRCh38] Chr18:48575221..48575222 [GRCh37] Chr18:18q21.2 |
pathogenic |
Single allele | translocation | Hereditary cancer-predisposing syndrome [RCV000850067] | Chr18:18q21.2 | uncertain significance |
NM_005359.6(SMAD4):c.445C>A (p.Gln149Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319352]|Juvenile polyposis syndrome [RCV001873359] | Chr18:51049315 [GRCh38] Chr18:48575685 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.838T>G (p.Leu280Val) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001181456] | Chr18:51058390 [GRCh38] Chr18:48584760 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1629G>C (p.Met543Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002402540]|Hereditary cancer-predisposing syndrome [RCV001182676]|Myhre syndrome [RCV002483994] | Chr18:51078437 [GRCh38] Chr18:48604807 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1347G>A (p.Gln449=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002379708]|Hereditary cancer-predisposing syndrome [RCV001183274]|Juvenile polyposis syndrome [RCV002068353] | Chr18:51076676 [GRCh38] Chr18:48603046 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447A>G (p.Ser483Gly) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001184626]|Juvenile polyposis syndrome [RCV001876147]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004008473] | Chr18:51076776 [GRCh38] Chr18:48603146 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.399C>G (p.Tyr133Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319302] | Chr18:51048835 [GRCh38] Chr18:48575205 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.*6T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001177747] | Chr18:51078473 [GRCh38] Chr18:48604843 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.178G>A (p.Ala60Thr) | single nucleotide variant | not provided [RCV001200415] | Chr18:51047224 [GRCh38] Chr18:48573594 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1610A>T (p.Asp537Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001204595] | Chr18:51078418 [GRCh38] Chr18:48604788 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+1704_1565del | deletion | Generalized juvenile polyposis/juvenile polyposis coli [RCV001212673] | Chr18:51068889..51078371 [GRCh38] Chr18:48595259..48604741 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1041T>G (p.Ile347Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV001226855] | Chr18:51065508 [GRCh38] Chr18:48591878 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.793A>G (p.Thr265Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV001225851] | Chr18:51058345 [GRCh38] Chr18:48584715 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+10A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001216090] | Chr18:51047305 [GRCh38] Chr18:48573675 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.425-5T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001234611] | Chr18:51049290 [GRCh38] Chr18:48575660 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.805A>C (p.Thr269Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003163725]|Juvenile polyposis syndrome [RCV001222767] | Chr18:51058357 [GRCh38] Chr18:48584727 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.29C>T (p.Pro10Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001224928]|not provided [RCV001760217] | Chr18:51047075 [GRCh38] Chr18:48573445 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1160T>G (p.Val387Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV001203577] | Chr18:51067039 [GRCh38] Chr18:48593409 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.20C>G (p.Thr7Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001237501] | Chr18:51047066 [GRCh38] Chr18:48573436 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1627A>G (p.Met543Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002402672]|Hereditary cancer-predisposing syndrome [RCV003584854]|Juvenile polyposis syndrome [RCV001220975] | Chr18:51078435 [GRCh38] Chr18:48604805 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.191A>G (p.Asn64Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002411773]|Juvenile polyposis syndrome [RCV001210006] | Chr18:51047237 [GRCh38] Chr18:48573607 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1037C>G (p.Pro346Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001214571] | Chr18:51065504 [GRCh38] Chr18:48591874 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.828C>G (p.Tyr276Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV001204122] | Chr18:51058380 [GRCh38] Chr18:48584750 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.722C>T (p.Ala241Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001226154]|not provided [RCV001773511] | Chr18:51058179 [GRCh38] Chr18:48584549 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1574T>C (p.Ile525Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557473]|Juvenile polyposis syndrome [RCV001235994]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004570596] | Chr18:51078382 [GRCh38] Chr18:48604752 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.477G>C (p.Lys159Asn) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001232707] | Chr18:51054803 [GRCh38] Chr18:48581173 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.887C>T (p.Pro296Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557487]|Juvenile polyposis syndrome [RCV001246555] | Chr18:51058439 [GRCh38] Chr18:48584809 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1476TGA[1] (p.Asp494del) | microsatellite | Familial thoracic aortic aneurysm and aortic dissection [RCV002393505]|Juvenile polyposis syndrome [RCV001215527] | Chr18:51078284..51078286 [GRCh38] Chr18:48604654..48604656 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.721G>A (p.Ala241Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002372707]|Hereditary cancer-predisposing syndrome [RCV001185840]|not provided [RCV000986029] | Chr18:51058178 [GRCh38] Chr18:48584548 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.823C>G (p.Pro275Ala) | single nucleotide variant | not provided [RCV000986032] | Chr18:51058375 [GRCh38] Chr18:48584745 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*704G>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124697]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124698]|Myhre syndrome [RCV001124696] | Chr18:51079171 [GRCh38] Chr18:48605541 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1661C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124908]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125878]|Myhre syndrome [RCV001125879] | Chr18:51080128 [GRCh38] Chr18:48606498 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*363C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001127707]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127708]|Myhre syndrome [RCV001127709] | Chr18:51078830 [GRCh38] Chr18:48605200 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2215C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125001]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125003]|Myhre syndrome [RCV001125002] | Chr18:51080682 [GRCh38] Chr18:48607052 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2099G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125000]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124999]|Myhre syndrome [RCV001122228] | Chr18:51080566 [GRCh38] Chr18:48606936 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3679A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122541]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122539]|Myhre syndrome [RCV001122540] | Chr18:51082146 [GRCh38] Chr18:48608516 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*332A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125622]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125621]|Myhre syndrome [RCV001125620] | Chr18:51078799 [GRCh38] Chr18:48605169 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5282T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122739]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122740]|Myhre syndrome [RCV001122738] | Chr18:51083749 [GRCh38] Chr18:48610119 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*720G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125700]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125701]|Myhre syndrome [RCV001125699] | Chr18:51079187 [GRCh38] Chr18:48605557 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4066C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001126299]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001126297]|Myhre syndrome [RCV001126298] | Chr18:51082533 [GRCh38] Chr18:48608903 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*605A>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124695]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124694]|Myhre syndrome [RCV001123625] | Chr18:51079072 [GRCh38] Chr18:48605442 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5710T>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001126587]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001128639]|Myhre syndrome [RCV001126588] | Chr18:51084177 [GRCh38] Chr18:48610547 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.626C>T (p.Thr209Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002365902]|Juvenile polyposis syndrome [RCV001201619] | Chr18:51054952 [GRCh38] Chr18:48581322 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.238G>A (p.Gly80Arg) | single nucleotide variant | not provided [RCV001200416] | Chr18:51047284 [GRCh38] Chr18:48573654 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.955+58C>T | single nucleotide variant | not provided [RCV001663025] | Chr18:51059974 [GRCh38] Chr18:48586344 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.-127-650C>T | single nucleotide variant | not provided [RCV001685796] | Chr18:51046270 [GRCh38] Chr18:48572640 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.1308+33_1308+34del | deletion | not provided [RCV001550653]|not specified [RCV002268513] | Chr18:51067220..51067221 [GRCh38] Chr18:48593590..48593591 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.692G>A (p.Gly231Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002370240]|Juvenile polyposis syndrome [RCV003771792]|not provided [RCV001589928] | Chr18:51058149 [GRCh38] Chr18:48584519 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1069T>C (p.Ser357Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763071]|not provided [RCV002284803] | Chr18:51065536 [GRCh38] Chr18:48591906 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.758T>A (p.Phe253Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002001715]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004011080] | Chr18:51058215 [GRCh38] Chr18:48584585 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.956-96T>C | single nucleotide variant | not provided [RCV001590347] | Chr18:51065327 [GRCh38] Chr18:48591697 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+5_667+6insCCTGCCAGTATACTGGGGGGCAGCCATAGTGAAGGACTGTTGCAGATAGCATCAGGGCC | insertion | not provided [RCV001575267] | Chr18:51054998..51054999 [GRCh38] Chr18:48581368..48581369 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.232T>C (p.Leu78=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001413059] | Chr18:51047278 [GRCh38] Chr18:48573648 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-7C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV001464017] | Chr18:51078249 [GRCh38] Chr18:48604619 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.746A>C (p.Gln249Pro) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002258060]|Juvenile polyposis syndrome [RCV000939632]|SMAD4-related disorder [RCV003933205] | Chr18:51058203 [GRCh38] Chr18:48584573 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.747G>C (p.Gln249His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003169417]|Hereditary cancer-predisposing syndrome [RCV002258061]|Juvenile polyposis syndrome [RCV000939633]|SMAD4-related disorder [RCV003933206] | Chr18:51058204 [GRCh38] Chr18:48584574 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1389A>T (p.Ala463=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002390915]|Hereditary cancer-predisposing syndrome [RCV001180090]|Juvenile polyposis syndrome [RCV000919144] | Chr18:51076718 [GRCh38] Chr18:48603088 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.345T>C (p.Cys115=) | single nucleotide variant | Juvenile polyposis syndrome [RCV000932607] | Chr18:51048781 [GRCh38] Chr18:48575151 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.960T>C (p.Pro320=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002382198]|Juvenile polyposis syndrome [RCV000975838]|not provided [RCV003156301]|not specified [RCV001192754] | Chr18:51065427 [GRCh38] Chr18:48591797 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.648C>T (p.Asn216=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002363487]|Juvenile polyposis syndrome [RCV001439119] | Chr18:51054974 [GRCh38] Chr18:48581344 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.619A>G (p.Asn207Asp) | single nucleotide variant | not provided [RCV001760457] | Chr18:51054945 [GRCh38] Chr18:48581315 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.403C>A (p.Arg135=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001406968] | Chr18:51048839 [GRCh38] Chr18:48575209 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140-6C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001176331]|Juvenile polyposis syndrome [RCV001394479]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003188] | Chr18:51067013 [GRCh38] Chr18:48593383 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.282C>T (p.Ile94=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002434270]|Juvenile polyposis syndrome [RCV001505015] | Chr18:51048718 [GRCh38] Chr18:48575088 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1590C>T (p.His530=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002068671] | Chr18:51078398 [GRCh38] Chr18:48604768 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*2217G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125985]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125983]|Myhre syndrome [RCV001125984] | Chr18:51080684 [GRCh38] Chr18:48607054 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4262T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001126300]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001126301]|Myhre syndrome [RCV001128352] | Chr18:51082729 [GRCh38] Chr18:48609099 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1061T>A (p.Val354Glu) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001187242] | Chr18:51065528 [GRCh38] Chr18:48591898 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.740G>A (p.Gly247Glu) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001183187]|Juvenile polyposis syndrome [RCV001876091]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004008356] | Chr18:51058197 [GRCh38] Chr18:48584567 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.825A>C (p.Pro275=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001187787] | Chr18:51058377 [GRCh38] Chr18:48584747 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.520A>T (p.Thr174Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001187950] | Chr18:51054846 [GRCh38] Chr18:48581216 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1599_1607del (p.Gln534_Leu536del) | deletion | Juvenile polyposis syndrome [RCV001236530] | Chr18:51078404..51078412 [GRCh38] Chr18:48604774..48604782 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1309-8C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001188758] | Chr18:51076630 [GRCh38] Chr18:48603000 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1233T>C (p.Ser411=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003163464]|Hereditary cancer-predisposing syndrome [RCV001188829] | Chr18:51067112 [GRCh38] Chr18:48593482 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+6C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001214723] | Chr18:51058462 [GRCh38] Chr18:48584832 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.844C>T (p.His282Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001227398]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003469399] | Chr18:51058396 [GRCh38] Chr18:48584766 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.569C>T (p.Ala190Val) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001189304] | Chr18:51054895 [GRCh38] Chr18:48581265 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-504A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123129]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123131]|Myhre syndrome [RCV001123130] | Chr18:51030247 [GRCh38] Chr18:48556617 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2941A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001128178]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001128180]|Myhre syndrome [RCV001128179] | Chr18:51081408 [GRCh38] Chr18:48607778 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1448-1G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557423]|Juvenile polyposis syndrome [RCV001213379] | Chr18:51078255 [GRCh38] Chr18:48604625 [GRCh37] Chr18:18q21.2 |
likely pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.788-10T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001189352]|Juvenile polyposis syndrome [RCV001400790] | Chr18:51058330 [GRCh38] Chr18:48584700 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.*5745T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001128640]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001128642]|Myhre syndrome [RCV001128641] | Chr18:51084212 [GRCh38] Chr18:48610582 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.806C>G (p.Thr269Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001205766] | Chr18:51058358 [GRCh38] Chr18:48584728 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.125G>A (p.Ser42Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV001216773] | Chr18:51047171 [GRCh38] Chr18:48573541 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.787+1_788-1del | deletion | Hereditary cancer-predisposing syndrome [RCV001177592]|not provided [RCV001597249] | Chr18:51058245..51058339 [GRCh38] Chr18:48584615..48584709 [GRCh37] Chr18:18q21.2 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_005359.6(SMAD4):c.667+17G>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001189631]|Juvenile polyposis syndrome [RCV002069079] | Chr18:51055010 [GRCh38] Chr18:48581380 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+11G>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001189632] | Chr18:51058467 [GRCh38] Chr18:48584837 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-10del | deletion | Hereditary cancer-predisposing syndrome [RCV001189747] | Chr18:51047033 [GRCh38] Chr18:48573403 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5541G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001126474]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123829]|Myhre syndrome [RCV001126475] | Chr18:51084008 [GRCh38] Chr18:48610378 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.530A>T (p.His177Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001205987] | Chr18:51054856 [GRCh38] Chr18:48581226 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.976A>G (p.Ile326Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557485]|Juvenile polyposis syndrome [RCV001243893]|not provided [RCV001751489] | Chr18:51065443 [GRCh38] Chr18:48591813 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1103C>T (p.Ser368Phe) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559889]|Juvenile polyposis syndrome [RCV001066183] | Chr18:51065570 [GRCh38] Chr18:48591940 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.956-7C>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001190005]|Juvenile polyposis syndrome [RCV001859139] | Chr18:51065416 [GRCh38] Chr18:48591786 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.533C>A (p.Ser178Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV001037387]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004031028] | Chr18:51054859 [GRCh38] Chr18:48581229 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.147G>C (p.Glu49Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV001224309] | Chr18:51047193 [GRCh38] Chr18:48573563 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.330A>G (p.Lys110=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002320412]|Hereditary cancer-predisposing syndrome [RCV001185626]|Juvenile polyposis syndrome [RCV001473073]|SMAD4-related disorder [RCV003945908] | Chr18:51048766 [GRCh38] Chr18:48575136 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.469A>G (p.Met157Val) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001185664] | Chr18:51054795 [GRCh38] Chr18:48581165 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1550G>A (p.Ser517Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002402510]|Generalized juvenile polyposis/juvenile polyposis coli [RCV001124517]|Juvenile polyposis syndrome [RCV002556698]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124518]|Myhre syndrome [RCV001124519] | Chr18:51078358 [GRCh38] Chr18:48604728 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*245T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124613]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125616]|Myhre syndrome [RCV001125615] | Chr18:51078712 [GRCh38] Chr18:48605082 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668-18G>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001190750] | Chr18:51058107 [GRCh38] Chr18:48584477 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.538C>G (p.Gln180Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002348755]|Juvenile polyposis syndrome [RCV001224907] | Chr18:51054864 [GRCh38] Chr18:48581234 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.718A>G (p.Ile240Val) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001180641] | Chr18:51058175 [GRCh38] Chr18:48584545 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3223A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001126204]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125228]|Myhre syndrome [RCV001126205] | Chr18:51081690 [GRCh38] Chr18:48608060 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-11T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001191515] | Chr18:51048675 [GRCh38] Chr18:48575045 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-18T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001179449]|Juvenile polyposis syndrome [RCV002068243] | Chr18:51067001 [GRCh38] Chr18:48593371 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.905-13G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001186861]|Juvenile polyposis syndrome [RCV002067976] | Chr18:51059853 [GRCh38] Chr18:48586223 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.250-10A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV000934527]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004003264]|not provided [RCV001796316] | Chr18:51048676 [GRCh38] Chr18:48575046 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1353G>T (p.Ala451=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559792]|Juvenile polyposis syndrome [RCV001428313] | Chr18:51076682 [GRCh38] Chr18:48603052 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.250-4C>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002235664]|not provided [RCV003478573] | Chr18:51048682 [GRCh38] Chr18:48575052 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.822A>C (p.Ala274=) | single nucleotide variant | not provided [RCV000986031] | Chr18:51058374 [GRCh38] Chr18:48584744 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.370G>C (p.Asp124His) | single nucleotide variant | not provided [RCV003231699] | Chr18:51048806 [GRCh38] Chr18:48575176 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.606C>T (p.Ala202=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002072332]|not provided [RCV001593841] | Chr18:51054932 [GRCh38] Chr18:48581302 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.585C>A (p.Tyr195Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV002468905] | Chr18:51054911 [GRCh38] Chr18:48581281 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.781C>T (p.His261Tyr) | single nucleotide variant | not provided [RCV003235824] | Chr18:51058238 [GRCh38] Chr18:48584608 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.293T>G (p.Leu98Arg) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV002472029] | Chr18:51048729 [GRCh38] Chr18:48575099 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.413C>G (p.Ser138Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319320] | Chr18:51048849 [GRCh38] Chr18:48575219 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.425-3A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319338]|Juvenile polyposis syndrome [RCV003595655] | Chr18:51049292 [GRCh38] Chr18:48575662 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.358G>C (p.Asp120His) | single nucleotide variant | Juvenile polyposis syndrome [RCV001065742] | Chr18:51048794 [GRCh38] Chr18:48575164 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1139+44T>C | single nucleotide variant | not provided [RCV001655569]|not specified [RCV002268549] | Chr18:51065650 [GRCh38] Chr18:48592020 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.956-31G>A | single nucleotide variant | not provided [RCV001676179]|not specified [RCV002268556] | Chr18:51065392 [GRCh38] Chr18:48591762 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.-127-46C>T | single nucleotide variant | not provided [RCV001715210] | Chr18:51046874 [GRCh38] Chr18:48573244 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.926C>T (p.Ala309Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002409336]|Juvenile polyposis syndrome [RCV002549497]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003473585]|not specified [RCV001800928] | Chr18:51059887 [GRCh38] Chr18:48586257 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.424+159T>C | single nucleotide variant | not provided [RCV001620404] | Chr18:51049019 [GRCh38] Chr18:48575389 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.-128+89CGG[8] | microsatellite | not provided [RCV001718173] | Chr18:51030711..51030712 [GRCh38] Chr18:48557081..48557082 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.712T>C (p.Leu238=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002400205]|Juvenile polyposis syndrome [RCV001477238] | Chr18:51058169 [GRCh38] Chr18:48584539 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.469A>T (p.Met157Leu) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001187676]|Juvenile polyposis syndrome [RCV003117826] | Chr18:51054795 [GRCh38] Chr18:48581165 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+15C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001127539]|Juvenile polyposis syndrome [RCV002558220]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123415]|Myhre syndrome [RCV001123414] | Chr18:51076791 [GRCh38] Chr18:48603161 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1140-20A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001188020]|Juvenile polyposis syndrome [RCV002068488] | Chr18:51066999 [GRCh38] Chr18:48593369 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-400C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124213]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124214]|Myhre syndrome [RCV001126897] | Chr18:51030351 [GRCh38] Chr18:48556721 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2675A>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125118]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125117]|Myhre syndrome [RCV001125119] | Chr18:51081142 [GRCh38] Chr18:48607512 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.761C>G (p.Thr254Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002427462] | Chr18:51058218 [GRCh38] Chr18:48584588 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.616T>G (p.Ser206Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002356849]|Hereditary cancer-predisposing syndrome [RCV001185173]|Juvenile polyposis syndrome [RCV003763827] | Chr18:51054942 [GRCh38] Chr18:48581312 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.454+12G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001185415] | Chr18:51049336 [GRCh38] Chr18:48575706 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*5534C>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123827]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123826]|Myhre syndrome [RCV001123828] | Chr18:51084001 [GRCh38] Chr18:48610371 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5609T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123926]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123925]|Myhre syndrome [RCV001123924] | Chr18:51084076 [GRCh38] Chr18:48610446 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.31A>T (p.Thr11Ser) | single nucleotide variant | not specified [RCV001192752] | Chr18:51047077 [GRCh38] Chr18:48573447 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+16G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001185474]|not specified [RCV003493812] | Chr18:51047311 [GRCh38] Chr18:48573681 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.51G>C (p.Leu17=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319408] | Chr18:51047097 [GRCh38] Chr18:48573467 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-401C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124212]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124210]|Myhre syndrome [RCV001124211] | Chr18:51030350 [GRCh38] Chr18:48556720 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.*259T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125617]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125618]|Myhre syndrome [RCV001125619] | Chr18:51078726 [GRCh38] Chr18:48605096 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.91G>A (p.Glu31Lys) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001185676] | Chr18:51047137 [GRCh38] Chr18:48573507 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.480T>C (p.Asp160=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001189093]|Juvenile polyposis syndrome [RCV003763828] | Chr18:51054806 [GRCh38] Chr18:48581176 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1594G>T (p.Ala532Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001189244] | Chr18:51078402 [GRCh38] Chr18:48604772 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1786A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125881]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125882]|Myhre syndrome [RCV001125880] | Chr18:51080253 [GRCh38] Chr18:48606623 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2897G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001128176]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001126087]|Myhre syndrome [RCV001128177] | Chr18:51081364 [GRCh38] Chr18:48607734 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1608T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124904]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124902]|Myhre syndrome [RCV001124903] | Chr18:51080075 [GRCh38] Chr18:48606445 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1659C>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124907]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124906]|Myhre syndrome [RCV001124905] | Chr18:51080126 [GRCh38] Chr18:48606496 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.250-4C>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559914]|Hereditary cancer-predisposing syndrome [RCV001178716]|Juvenile polyposis syndrome [RCV002559750] | Chr18:51048682 [GRCh38] Chr18:48575052 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1101C>A (p.Leu367=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002429834]|Hereditary cancer-predisposing syndrome [RCV001189633]|Juvenile polyposis syndrome [RCV001471860]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010375]|SMAD4-related disorder [RCV003898187] | Chr18:51065568 [GRCh38] Chr18:48591938 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*5631A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001126584]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001126585]|Myhre syndrome [RCV001126586] | Chr18:51084098 [GRCh38] Chr18:48610468 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+11T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001185473]|Juvenile polyposis syndrome [RCV002067966] | Chr18:51047306 [GRCh38] Chr18:48573676 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1198A>G (p.Arg400Gly) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001190113]|Juvenile polyposis syndrome [RCV001876220] | Chr18:51067077 [GRCh38] Chr18:48593447 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.498del (p.Phe166fs) | deletion | Juvenile polyposis syndrome [RCV001044219] | Chr18:51054822 [GRCh38] Chr18:48581192 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.54C>T (p.Ser18=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319639] | Chr18:51047100 [GRCh38] Chr18:48573470 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.425-16C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001186275]|Juvenile polyposis syndrome [RCV002068432] | Chr18:51049279 [GRCh38] Chr18:48575649 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-9T>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001182828]|Juvenile polyposis syndrome [RCV001415620]|not provided [RCV001548606] | Chr18:51078247 [GRCh38] Chr18:48604617 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1448-14A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001182916] | Chr18:51078242 [GRCh38] Chr18:48604612 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*5542C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001126476]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001126477]|Myhre syndrome [RCV001126478] | Chr18:51084009 [GRCh38] Chr18:48610379 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.464G>C (p.Ser155Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001068509] | Chr18:51054790 [GRCh38] Chr18:48581160 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-127G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001127300]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127301]|Myhre syndrome [RCV001127299] | Chr18:51046920 [GRCh38] Chr18:48573290 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.796A>G (p.Thr266Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002409407]|Hereditary cancer-predisposing syndrome [RCV001184136]|Juvenile polyposis syndrome [RCV001044709] | Chr18:51058348 [GRCh38] Chr18:48584718 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-1G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319239] | Chr18:51048685 [GRCh38] Chr18:48575055 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.*19C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001186409] | Chr18:51078486 [GRCh38] Chr18:48604856 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.690G>A (p.Gly230=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003163407]|Hereditary cancer-predisposing syndrome [RCV001179406]|Juvenile polyposis syndrome [RCV002555503] | Chr18:51058147 [GRCh38] Chr18:48584517 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*5833G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122954]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122955]|Myhre syndrome [RCV001122953] | Chr18:51084300 [GRCh38] Chr18:48610670 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.572C>T (p.Ser191Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002327231]|Hereditary cancer-predisposing syndrome [RCV001024458]|Juvenile polyposis syndrome [RCV001040401]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004004650]|not provided [RCV003442150] | Chr18:51054898 [GRCh38] Chr18:48581268 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.574A>G (p.Thr192Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002327234]|Juvenile polyposis syndrome [RCV001070800]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004004651] | Chr18:51054900 [GRCh38] Chr18:48581270 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1381C>T (p.Gln461Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319144]|Juvenile polyposis syndrome [RCV003762959] | Chr18:51076710 [GRCh38] Chr18:48603080 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.282C>A (p.Ile94=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319616] | Chr18:51048718 [GRCh38] Chr18:48575088 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.282C>G (p.Ile94Met) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001179473] | Chr18:51048718 [GRCh38] Chr18:48575088 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1513A>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122136]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124901]|Myhre syndrome [RCV001122137] | Chr18:51079980 [GRCh38] Chr18:48606350 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1409C>T (p.Pro470Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319148] | Chr18:51076738 [GRCh38] Chr18:48603108 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.602T>C (p.Leu201Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002346227] | Chr18:51054928 [GRCh38] Chr18:48581298 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.608C>T (p.Pro203Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002354927]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003473600] | Chr18:51054934 [GRCh38] Chr18:48581304 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1465G>A (p.Gly489Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319150] | Chr18:51078273 [GRCh38] Chr18:48604643 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668-17_668-16insTAA | insertion | Hereditary cancer-predisposing syndrome [RCV001182595] | Chr18:51058108..51058109 [GRCh38] Chr18:48584478..48584479 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.294C>G (p.Leu98=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559916]|Hereditary cancer-predisposing syndrome [RCV001192210] | Chr18:51048730 [GRCh38] Chr18:48575100 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1078G>C (p.Asp360His) | single nucleotide variant | Juvenile polyposis syndrome [RCV001046338] | Chr18:51065545 [GRCh38] Chr18:48591915 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.10:g.(?_51030213)_(51078467_?)dup | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV001032219] | Chr18:48556583..48604837 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.83A>G (p.Gln28Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002337071] | Chr18:51047129 [GRCh38] Chr18:48573499 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1427G>A (p.Gly476Asp) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001187018] | Chr18:51076756 [GRCh38] Chr18:48603126 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5553A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122833]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122834]|Myhre syndrome [RCV001122835] | Chr18:51084020 [GRCh38] Chr18:48610390 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1036C>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122027]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122026]|Myhre syndrome [RCV001122025] | Chr18:51079503 [GRCh38] Chr18:48605873 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1874C>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122227]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122225]|Myhre syndrome [RCV001122226]|not provided [RCV002511046] | Chr18:51080341 [GRCh38] Chr18:48606711 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.672G>A (p.Gln224=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002375054]|Juvenile polyposis syndrome [RCV001485662]|not specified [RCV001174745] | Chr18:51058129 [GRCh38] Chr18:48584499 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+17G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001182378]|Juvenile polyposis syndrome [RCV002068315] | Chr18:51058473 [GRCh38] Chr18:48584843 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.645C>T (p.Pro215=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002354948]|Hereditary cancer-predisposing syndrome [RCV001025290]|Juvenile polyposis syndrome [RCV001447260]|not provided [RCV001759915] | Chr18:51054971 [GRCh38] Chr18:48581341 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1586T>C (p.Leu529Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319163] | Chr18:51078394 [GRCh38] Chr18:48604764 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.863_864insGAT (p.Leu288_Gln289insIle) | insertion | Familial thoracic aortic aneurysm and aortic dissection [RCV002354920] | Chr18:51058414..51058415 [GRCh38] Chr18:48584784..48584785 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3109T>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122445]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122446]|Myhre syndrome [RCV001125227] | Chr18:51081576 [GRCh38] Chr18:48607946 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3746A>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125332]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122542]|Myhre syndrome [RCV001125333] | Chr18:51082213 [GRCh38] Chr18:48608583 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-531G>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123128]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127195]|Myhre syndrome [RCV001123127] | Chr18:51030220 [GRCh38] Chr18:48556590 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-69G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123228]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123227]|Myhre syndrome [RCV001123229]|Myhre syndrome [RCV002482232] | Chr18:51046978 [GRCh38] Chr18:48573348 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5547A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001128535]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001128537]|Myhre syndrome [RCV001128536] | Chr18:51084014 [GRCh38] Chr18:48610384 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5549A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001128538]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001128539]|Myhre syndrome [RCV001128540] | Chr18:51084016 [GRCh38] Chr18:48610386 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*2561G>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122330]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122329]|Myhre syndrome [RCV001122328] | Chr18:51081028 [GRCh38] Chr18:48607398 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1386G>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001127889]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127888]|Myhre syndrome [RCV001127890] | Chr18:51079853 [GRCh38] Chr18:48606223 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.788-19T>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001182887]|Juvenile polyposis syndrome [RCV002068339] | Chr18:51058321 [GRCh38] Chr18:48584691 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1630C>A (p.Pro544Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319168] | Chr18:51078438 [GRCh38] Chr18:48604808 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.284A>G (p.Tyr95Cys) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001187479] | Chr18:51048720 [GRCh38] Chr18:48575090 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.746A>G (p.Gln249Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002393430]|Hereditary cancer-predisposing syndrome [RCV001187496] | Chr18:51058203 [GRCh38] Chr18:48584573 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.915C>A (p.His305Gln) | single nucleotide variant | Juvenile polyposis syndrome [RCV001049795] | Chr18:51059876 [GRCh38] Chr18:48586246 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.797C>T (p.Thr266Ile) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001181751]|Juvenile polyposis syndrome [RCV003769992] | Chr18:51058349 [GRCh38] Chr18:48584719 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.515T>C (p.Leu172Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319405] | Chr18:51054841 [GRCh38] Chr18:48581211 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1239C>G (p.Tyr413Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318929]|Juvenile polyposis syndrome [RCV002549319] | Chr18:51067118 [GRCh38] Chr18:48593488 [GRCh37] Chr18:18q21.2 |
pathogenic |
GRCh37/hg19 18q11.2-23(chr18:23626739-78014976)x3 | copy number gain | not provided [RCV001537911] | Chr18:23626739..78014976 [GRCh37] Chr18:18q11.2-23 |
pathogenic |
NM_005359.6(SMAD4):c.560G>C (p.Ser187Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001048011] | Chr18:51054886 [GRCh38] Chr18:48581256 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+96_1308+102del | deletion | not provided [RCV001652143] | Chr18:51067280..51067286 [GRCh38] Chr18:48593650..48593656 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.541A>G (p.Thr181Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV001048745]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004004790] | Chr18:51054867 [GRCh38] Chr18:48581237 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+214TTTA[7] | microsatellite | not provided [RCV001583911] | Chr18:51067400..51067401 [GRCh38] Chr18:48593770..48593771 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1490G>A (p.Arg497His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002393579]|Juvenile polyposis syndrome [RCV001232926] | Chr18:51078298 [GRCh38] Chr18:48604668 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.787+2T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002409459]|Generalized juvenile polyposis/juvenile polyposis coli [RCV001056035]|Juvenile polyposis syndrome [RCV001376554] | Chr18:51058246 [GRCh38] Chr18:48584616 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.557C>T (p.Pro186Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001068532] | Chr18:51054883 [GRCh38] Chr18:48581253 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.789C>G (p.Asn263Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002434417]|Hereditary cancer-predisposing syndrome [RCV003584799]|Juvenile polyposis syndrome [RCV001372187] | Chr18:51058341 [GRCh38] Chr18:48584711 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.791G>A (p.Ser264Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002434419] | Chr18:51058343 [GRCh38] Chr18:48584713 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.794C>G (p.Thr265Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002434422] | Chr18:51058346 [GRCh38] Chr18:48584716 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.37A>G (p.Asn13Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV001236702] | Chr18:51047083 [GRCh38] Chr18:48573453 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1072G>A (p.Gly358Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001038580] | Chr18:51065539 [GRCh38] Chr18:48591909 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.574A>T (p.Thr192Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001214828] | Chr18:51054900 [GRCh38] Chr18:48581270 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.513G>C (p.Ser171=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319404]|Juvenile polyposis syndrome [RCV002551878] | Chr18:51054839 [GRCh38] Chr18:48581209 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.502G>T (p.Gly168Ter) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001201291] | Chr18:51054828 [GRCh38] Chr18:48581198 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1060G>A (p.Val354Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV001213759]|Vascular dementia [RCV002051727] | Chr18:51065527 [GRCh38] Chr18:48591897 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1297G>A (p.Ala433Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318935] | Chr18:51067176 [GRCh38] Chr18:48593546 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.925G>A (p.Ala309Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001231542] | Chr18:51059886 [GRCh38] Chr18:48586256 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1311del (p.Phe438fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002318937] | Chr18:51076640 [GRCh38] Chr18:48603010 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1320G>A (p.Leu440=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318940]|Juvenile polyposis syndrome [RCV001424459]|not specified [RCV002268402] | Chr18:51076649 [GRCh38] Chr18:48603019 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1565C>T (p.Pro522Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557429]|Juvenile polyposis syndrome [RCV001217189] | Chr18:51078373 [GRCh38] Chr18:48604743 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.652C>T (p.Pro218Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002354957]|Hereditary cancer-predisposing syndrome [RCV001025373] | Chr18:51054978 [GRCh38] Chr18:48581348 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1563A>G (p.Thr521=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319161]|Juvenile polyposis syndrome [RCV001403391] | Chr18:51078371 [GRCh38] Chr18:48604741 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1558G>C (p.Glu520Gln) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319162]|Juvenile polyposis syndrome [RCV002551756] | Chr18:51078366 [GRCh38] Chr18:48604736 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.659C>T (p.Ala220Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002365968]|Juvenile polyposis syndrome [RCV001215358] | Chr18:51054985 [GRCh38] Chr18:48581355 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.529C>T (p.His177Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001059374] | Chr18:51054855 [GRCh38] Chr18:48581225 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.635C>T (p.Ala212Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002365909]|Juvenile polyposis syndrome [RCV001202355]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004570418] | Chr18:51054961 [GRCh38] Chr18:48581331 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.690G>C (p.Gly230=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002391077] | Chr18:51058147 [GRCh38] Chr18:48584517 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*1315G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125784]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127886]|Myhre syndrome [RCV001127887] | Chr18:51079782 [GRCh38] Chr18:48606152 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.631A>G (p.Thr211Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV001232852] | Chr18:51054957 [GRCh38] Chr18:48581327 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1283A>G (p.Lys428Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001205774] | Chr18:51067162 [GRCh38] Chr18:48593532 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.745_746delinsAG (p.Gln249Arg) | indel | Familial thoracic aortic aneurysm and aortic dissection [RCV002416307]|Juvenile polyposis syndrome [RCV001059602]|not provided [RCV003478658] | Chr18:51058202..51058203 [GRCh38] Chr18:48584572..48584573 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.17T>C (p.Ile6Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319177]|Hereditary cancer-predisposing syndrome [RCV001013227]|Juvenile polyposis syndrome [RCV002549386]|not provided [RCV003225139] | Chr18:51047063 [GRCh38] Chr18:48573433 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3226G>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001126207]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001126208]|Myhre syndrome [RCV001126206] | Chr18:51081693 [GRCh38] Chr18:48608063 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.653C>T (p.Pro218Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001228993] | Chr18:51054979 [GRCh38] Chr18:48581349 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1348C>T (p.Gln450Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV001039715] | Chr18:51076677 [GRCh38] Chr18:48603047 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.186T>C (p.Thr62=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319180] | Chr18:51047232 [GRCh38] Chr18:48573602 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1136C>T (p.Ala379Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318910] | Chr18:51065603 [GRCh38] Chr18:48591973 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1131G>A (p.Glu377=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318911] | Chr18:51065598 [GRCh38] Chr18:48591968 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.544A>G (p.Ile182Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559874]|Hereditary cancer-predisposing syndrome [RCV002258110]|Juvenile polyposis syndrome [RCV001054094]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004000066] | Chr18:51054870 [GRCh38] Chr18:48581240 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1196T>A (p.Val399Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV001064161] | Chr18:51067075 [GRCh38] Chr18:48593445 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*6522C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123051]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123053]|Myhre syndrome [RCV001123052]|not provided [RCV002275295] | Chr18:51084989 [GRCh38] Chr18:48611359 [GRCh37] Chr18:18q21.2 |
benign|uncertain significance |
NM_005359.6(SMAD4):c.820G>A (p.Ala274Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002445190]|Hereditary cancer-predisposing syndrome [RCV001027287] | Chr18:51058372 [GRCh38] Chr18:48584742 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*170A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123530]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123528]|Myhre syndrome [RCV001123529] | Chr18:51078637 [GRCh38] Chr18:48605007 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18q11.2-21.2(chr18:20689919-49455212)x3 | copy number gain | not provided [RCV001006980] | Chr18:20689919..49455212 [GRCh37] Chr18:18q11.2-21.2 |
pathogenic |
NM_005359.6(SMAD4):c.802T>C (p.Trp268Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003163389]|Hereditary cancer-predisposing syndrome [RCV001175729]|Juvenile polyposis syndrome [RCV001229275] | Chr18:51058354 [GRCh38] Chr18:48584724 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*579G>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123621]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123620]|Myhre syndrome [RCV001123619] | Chr18:51079046 [GRCh38] Chr18:48605416 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1230G>A (p.Gln410=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318927]|Juvenile polyposis syndrome [RCV001441568] | Chr18:51067109 [GRCh38] Chr18:48593479 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*969A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001127802]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122023]|Myhre syndrome [RCV001122024] | Chr18:51079436 [GRCh38] Chr18:48605806 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*1502T>C | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122135]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122133]|Myhre syndrome [RCV001122134] | Chr18:51079969 [GRCh38] Chr18:48606339 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*936A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001127800]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001127799]|Myhre syndrome [RCV001127801] | Chr18:51079403 [GRCh38] Chr18:48605773 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.547C>T (p.Gln183Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002348352]|Juvenile polyposis syndrome [RCV001040938] | Chr18:51054873 [GRCh38] Chr18:48581243 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.584A>C (p.Tyr195Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001183947] | Chr18:51054910 [GRCh38] Chr18:48581280 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.424+3A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001230618] | Chr18:51048863 [GRCh38] Chr18:48575233 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1206T>C (p.Leu402=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318919]|Juvenile polyposis syndrome [RCV001466806] | Chr18:51067085 [GRCh38] Chr18:48593455 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*3662C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122536]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122537]|Myhre syndrome [RCV001122538] | Chr18:51082129 [GRCh38] Chr18:48608499 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.1201T>C (p.Cys401Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001051227] | Chr18:51067080 [GRCh38] Chr18:48593450 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1380C>T (p.Ala460=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002379684]|Hereditary cancer-predisposing syndrome [RCV001177128]|Juvenile polyposis syndrome [RCV003769897] | Chr18:51076709 [GRCh38] Chr18:48603079 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1269A>G (p.Gly423=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002318933]|Juvenile polyposis syndrome [RCV001414248] | Chr18:51067148 [GRCh38] Chr18:48593518 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*5555A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122838]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122836]|Myhre syndrome [RCV001122837] | Chr18:51084022 [GRCh38] Chr18:48610392 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*5557A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123922]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123923]|Myhre syndrome [RCV001122839] | Chr18:51084024 [GRCh38] Chr18:48610394 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1067del (p.Pro356fs) | deletion | Juvenile polyposis syndrome [RCV001051494]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004031602] | Chr18:51065532 [GRCh38] Chr18:48591902 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.27A>T (p.Thr9=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319255] | Chr18:51047073 [GRCh38] Chr18:48573443 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1540_1541delinsTT (p.Pro514Leu) | indel | Familial thoracic aortic aneurysm and aortic dissection [RCV002400294]|Juvenile polyposis syndrome [RCV001051545]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003473644] | Chr18:51078348..51078349 [GRCh38] Chr18:48604718..48604719 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.3G>A (p.Met1Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV001204996] | Chr18:51047049 [GRCh38] Chr18:48573419 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1028C>G (p.Ser343Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319625]|Juvenile polyposis syndrome [RCV002549446] | Chr18:51065495 [GRCh38] Chr18:48591865 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.*580A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001123622]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001123624]|Myhre syndrome [RCV001123623] | Chr18:51079047 [GRCh38] Chr18:48605417 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-5C>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002327229]|Hereditary cancer-predisposing syndrome [RCV001017434]|Juvenile polyposis syndrome [RCV001071656] | Chr18:51067014 [GRCh38] Chr18:48593384 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1144C>T (p.His382Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002327230] | Chr18:51067023 [GRCh38] Chr18:48593393 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1456G>C (p.Ala486Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319152] | Chr18:51078264 [GRCh38] Chr18:48604634 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1304_1305dup (p.Lys436Ter) | microsatellite | Juvenile polyposis syndrome [RCV001042217] | Chr18:51067177..51067178 [GRCh38] Chr18:48593547..48593548 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1521A>G (p.Lys507=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319158]|Juvenile polyposis syndrome [RCV002068847] | Chr18:51078329 [GRCh38] Chr18:48604699 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*1141A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001124793]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001124792]|Myhre syndrome [RCV001124791] | Chr18:51079608 [GRCh38] Chr18:48605978 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1595C>A (p.Ala532Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002319165]|Juvenile polyposis syndrome [RCV001860701]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV002225124]|SMAD4-related disorder [RCV003396597] | Chr18:51078403 [GRCh38] Chr18:48604773 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.907C>T (p.Pro303Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002382249]|Juvenile polyposis syndrome [RCV001299657] | Chr18:51059868 [GRCh38] Chr18:48586238 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.217dup (p.Thr73fs) | duplication | Juvenile polyposis syndrome [RCV001057019] | Chr18:51047262..51047263 [GRCh38] Chr18:48573632..48573633 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.*1499T>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122132]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001122130]|Myhre syndrome [RCV001122131] | Chr18:51079966 [GRCh38] Chr18:48606336 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.687G>C (p.Leu229=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002382257]|Juvenile polyposis syndrome [RCV002067691] | Chr18:51058144 [GRCh38] Chr18:48584514 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.689G>C (p.Gly230Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002391076]|Juvenile polyposis syndrome [RCV001873400] | Chr18:51058146 [GRCh38] Chr18:48584516 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.*3950A>G | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125336]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125334]|Myhre syndrome [RCV001125335] | Chr18:51082417 [GRCh38] Chr18:48608787 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1648C>T (p.Pro550Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002393504]|Juvenile polyposis syndrome [RCV001215522] | Chr18:51078456 [GRCh38] Chr18:48604826 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.717G>C (p.Gln239His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002409347]|Hereditary cancer-predisposing syndrome [RCV001026123]|Juvenile polyposis syndrome [RCV001237884] | Chr18:51058174 [GRCh38] Chr18:48584544 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.723A>G (p.Ala241=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002416294]|Hereditary cancer-predisposing syndrome [RCV001026186]|Juvenile polyposis syndrome [RCV001463248] | Chr18:51058180 [GRCh38] Chr18:48584550 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*745C>T | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001125703]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001125704]|Myhre syndrome [RCV001125702] | Chr18:51079212 [GRCh38] Chr18:48605582 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*4707G>A | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001122634]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001128353]|Myhre syndrome [RCV001122635] | Chr18:51083174 [GRCh38] Chr18:48609544 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.788-6T>C | single nucleotide variant | not specified [RCV001255601] | Chr18:51058334 [GRCh38] Chr18:48584704 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18p11.32-q23(chr18:1-78077248) | copy number gain | Trisomy 18 [RCV002280660] | Chr18:1..78077248 [GRCh37] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.804G>C (p.Trp268Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001294493] | Chr18:51058356 [GRCh38] Chr18:48584726 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.303G>A (p.Trp101Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002447241]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001262037] | Chr18:51048739 [GRCh38] Chr18:48575109 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.750G>C (p.Gln250His) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002258197]|Juvenile polyposis syndrome [RCV001319529] | Chr18:51058207 [GRCh38] Chr18:48584577 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1375G>A (p.Ala459Thr) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003584905]|Juvenile polyposis syndrome [RCV001350506] | Chr18:51076704 [GRCh38] Chr18:48603074 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.734A>G (p.Gln245Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001339176] | Chr18:51058191 [GRCh38] Chr18:48584561 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.827A>C (p.Tyr276Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001342610] | Chr18:51058379 [GRCh38] Chr18:48584749 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.841C>T (p.Pro281Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001302163] | Chr18:51058393 [GRCh38] Chr18:48584763 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.377T>C (p.Val126Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV001299451] | Chr18:51048813 [GRCh38] Chr18:48575183 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.827A>T (p.Tyr276Phe) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003166685]|Juvenile polyposis syndrome [RCV001299738]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004004990]|Myhre syndrome [RCV002499555]|not provided [RCV003120542] | Chr18:51058379 [GRCh38] Chr18:48584749 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1570T>C (p.Trp524Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001327640] | Chr18:51078378 [GRCh38] Chr18:48604748 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1241del (p.Tyr413_Leu414insTer) | deletion | Colorectal cancer [RCV001293846] | Chr18:51067119 [GRCh38] Chr18:48593489 [GRCh37] Chr18:18q21.2 |
pathogenic |
NC_000018.10:g.(?_51030213)_(51078467_?)dup | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV001032219]|Juvenile polyposis syndrome [RCV001308944] | Chr18:48556583..48604837 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.604G>A (p.Ala202Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001348936] | Chr18:51054930 [GRCh38] Chr18:48581300 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1637C>T (p.Ala546Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001319058] | Chr18:51078445 [GRCh38] Chr18:48604815 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.955+5G>A | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001524017]|Juvenile polyposis syndrome [RCV001300042]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003462862] | Chr18:51059921 [GRCh38] Chr18:48586291 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1628T>G (p.Met543Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001326474] | Chr18:51078436 [GRCh38] Chr18:48604806 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.609A>C (p.Pro203=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002357314]|Juvenile polyposis syndrome [RCV001397149] | Chr18:51054935 [GRCh38] Chr18:48581305 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.993G>A (p.Met331Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV001295295] | Chr18:51065460 [GRCh38] Chr18:48591830 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+11G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003761391]|not provided [RCV001529183] | Chr18:51058467 [GRCh38] Chr18:48584837 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-5T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV001397378] | Chr18:51054776 [GRCh38] Chr18:48581146 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.540A>C (p.Gln180His) | single nucleotide variant | Juvenile polyposis syndrome [RCV001350975] | Chr18:51054866 [GRCh38] Chr18:48581236 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1183G>C (p.Gly395Arg) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001356366] | Chr18:51067062 [GRCh38] Chr18:48593432 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-10A>T | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV001799323]|Familial thoracic aortic aneurysm and aortic dissection [RCV004558654] | Chr18:51048676 [GRCh38] Chr18:48575046 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1154A>G (p.Lys385Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001305739] | Chr18:51067033 [GRCh38] Chr18:48593403 [GRCh37] Chr18:18q21.2 |
uncertain significance |
Single allele | deletion | Intellectual disability [RCV001787257] | Chr18:1262336..53254747 [GRCh37] Chr18:18p11.32-q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.827A>G (p.Tyr276Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001360917] | Chr18:51058379 [GRCh38] Chr18:48584749 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1237T>G (p.Tyr413Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV001294924] | Chr18:51067116 [GRCh38] Chr18:48593486 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1590C>G (p.His530Gln) | single nucleotide variant | Juvenile polyposis syndrome [RCV001362798]|not provided [RCV001762624] | Chr18:51078398 [GRCh38] Chr18:48604768 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.462A>G (p.Ser154=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001392477] | Chr18:51054788 [GRCh38] Chr18:48581158 [GRCh37] Chr18:18q21.2 |
likely benign |
NC_000018.9:g.(?_48556583)_(48603156_?)dup | duplication | Generalized juvenile polyposis/juvenile polyposis coli [RCV000809303]|Juvenile polyposis syndrome [RCV001319823] | Chr18:48556583..48603156 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.874C>G (p.Pro292Ala) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001806105]|Juvenile polyposis syndrome [RCV001303153] | Chr18:51058426 [GRCh38] Chr18:48584796 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.409G>A (p.Val137Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002322252]|Juvenile polyposis syndrome [RCV001325274] | Chr18:51048845 [GRCh38] Chr18:48575215 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.332A>G (p.His111Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002322192]|Juvenile polyposis syndrome [RCV001297845] | Chr18:51048768 [GRCh38] Chr18:48575138 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1413C>A (p.Gly471=) | single nucleotide variant | not provided [RCV001310388] | Chr18:51076742 [GRCh38] Chr18:48603112 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+4G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV001324144] | Chr18:51049328 [GRCh38] Chr18:48575698 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.553C>T (p.Pro185Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001372234]|not provided [RCV003738056] | Chr18:51054879 [GRCh38] Chr18:48581249 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.360C>G (p.Asp120Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001326786] | Chr18:51048796 [GRCh38] Chr18:48575166 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.643C>G (p.Pro215Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002368139]|Juvenile polyposis syndrome [RCV001346162] | Chr18:51054969 [GRCh38] Chr18:48581339 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.937C>A (p.Pro313Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002447458]|Juvenile polyposis syndrome [RCV001361586] | Chr18:51059898 [GRCh38] Chr18:48586268 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1505G>A (p.Arg502Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001317835] | Chr18:51078313 [GRCh38] Chr18:48604683 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.240G>T (p.Gly80=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557517]|Juvenile polyposis syndrome [RCV001300662] | Chr18:51047286 [GRCh38] Chr18:48573656 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.932A>G (p.Gln311Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002377466]|Hereditary cancer-predisposing syndrome [RCV002258212]|Juvenile polyposis syndrome [RCV001345423]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004005197] | Chr18:51059893 [GRCh38] Chr18:48586263 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1529G>A (p.Gly510Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001299559] | Chr18:51078337 [GRCh38] Chr18:48604707 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.909T>A (p.Pro303=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002377461]|Juvenile polyposis syndrome [RCV001344463] | Chr18:51059870 [GRCh38] Chr18:48586240 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1232G>A (p.Ser411Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002368176]|Juvenile polyposis syndrome [RCV001363849] | Chr18:51067111 [GRCh38] Chr18:48593481 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1207A>G (p.Ser403Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV001364554] | Chr18:51067086 [GRCh38] Chr18:48593456 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.542C>A (p.Thr181Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV001341807] | Chr18:51054868 [GRCh38] Chr18:48581238 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1070C>T (p.Ser357Phe) | single nucleotide variant | Juvenile polyposis syndrome [RCV001366203] | Chr18:51065537 [GRCh38] Chr18:48591907 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.934C>T (p.Pro312Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001366233] | Chr18:51059895 [GRCh38] Chr18:48586265 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.642T>G (p.Phe214Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001366234] | Chr18:51054968 [GRCh38] Chr18:48581338 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.803_804insCTAAGTGGTAGTA (p.Trp268delinsCysTer) | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV001335262] | Chr18:51058355..51058356 [GRCh38] Chr18:48584725..48584726 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1042G>A (p.Val348Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV001299537] | Chr18:51065509 [GRCh38] Chr18:48591879 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1448-33T>A | single nucleotide variant | not provided [RCV001813163]|not specified [RCV002268464] | Chr18:51078223 [GRCh38] Chr18:48604593 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1112A>G (p.His371Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001314680] | Chr18:51065579 [GRCh38] Chr18:48591949 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.43G>A (p.Ala15Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001360486] | Chr18:51047089 [GRCh38] Chr18:48573459 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.473T>A (p.Val158Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001300167] | Chr18:51054799 [GRCh38] Chr18:48581169 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1592G>A (p.Arg531Gln) | single nucleotide variant | Juvenile polyposis syndrome [RCV001303248] | Chr18:51078400 [GRCh38] Chr18:48604770 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.444G>T (p.Leu148=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001421364]|SMAD4-related disorder [RCV003973269] | Chr18:51049314 [GRCh38] Chr18:48575684 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.787+10T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV001395398] | Chr18:51058254 [GRCh38] Chr18:48584624 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.680G>A (p.Ser227Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557530]|Juvenile polyposis syndrome [RCV001315123] | Chr18:51058137 [GRCh38] Chr18:48584507 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.425-4T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001369277] | Chr18:51049291 [GRCh38] Chr18:48575661 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.733C>T (p.Gln245Ter) | single nucleotide variant | Carcinoma of colon [RCV001358302] | Chr18:51058190 [GRCh38] Chr18:48584560 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1139+12A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002547614]|Malignant tumor of breast [RCV001355637] | Chr18:51065618 [GRCh38] Chr18:48591988 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.564T>G (p.Asn188Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003169583]|Juvenile polyposis syndrome [RCV001337502]|not provided [RCV002307730] | Chr18:51054890 [GRCh38] Chr18:48581260 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1309-10T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV001482581] | Chr18:51076628 [GRCh38] Chr18:48602998 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1656C>T (p.Asp552=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001487684] | Chr18:51078464 [GRCh38] Chr18:48604834 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.102A>T (p.Thr34=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001451831] | Chr18:51047148 [GRCh38] Chr18:48573518 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.897A>C (p.Gly299=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001452309] | Chr18:51058449 [GRCh38] Chr18:48584819 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1455A>C (p.Ser485=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001439608] | Chr18:51078263 [GRCh38] Chr18:48604633 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1380C>A (p.Ala460=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557691]|Juvenile polyposis syndrome [RCV001469519] | Chr18:51076709 [GRCh38] Chr18:48603079 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.968G>A (p.Trp323Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV001390654] | Chr18:51065435 [GRCh38] Chr18:48591805 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.513G>T (p.Ser171=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002351007]|Juvenile polyposis syndrome [RCV001486941] | Chr18:51054839 [GRCh38] Chr18:48581209 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1122A>G (p.Glu374=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002439033]|Juvenile polyposis syndrome [RCV001439788] | Chr18:51065589 [GRCh38] Chr18:48591959 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.956-9T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV001474508] | Chr18:51065414 [GRCh38] Chr18:48591784 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.132A>T (p.Val44=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001467373] | Chr18:51047178 [GRCh38] Chr18:48573548 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1139+446del | deletion | not provided [RCV001538895] | Chr18:51066050 [GRCh38] Chr18:48592420 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.455-4A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV001448560] | Chr18:51054777 [GRCh38] Chr18:48581147 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.945C>G (p.Ser315=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557642]|Juvenile polyposis syndrome [RCV001435747] | Chr18:51059906 [GRCh38] Chr18:48586276 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.779dup (p.Tyr260Ter) | duplication | Juvenile polyposis syndrome [RCV001387448] | Chr18:51058235..51058236 [GRCh38] Chr18:48584605..48584606 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.546C>T (p.Ile182=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001407063] | Chr18:51054872 [GRCh38] Chr18:48581242 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-8T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001399940] | Chr18:51058117 [GRCh38] Chr18:48584487 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+10C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001409989] | Chr18:51076786 [GRCh38] Chr18:48603156 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.223del (p.Gln75fs) | deletion | Juvenile polyposis syndrome [RCV001388316] | Chr18:51047269 [GRCh38] Chr18:48573639 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1447+7A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001441229] | Chr18:51076783 [GRCh38] Chr18:48603153 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.441A>G (p.Thr147=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002329469]|Juvenile polyposis syndrome [RCV001425937] | Chr18:51049311 [GRCh38] Chr18:48575681 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1398A>G (p.Ala466=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001440061] | Chr18:51076727 [GRCh38] Chr18:48603097 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1137A>G (p.Ala379=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557661]|Juvenile polyposis syndrome [RCV001447501] | Chr18:51065604 [GRCh38] Chr18:48591974 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1494dup (p.Cys499fs) | duplication | Juvenile polyposis syndrome [RCV001388514] | Chr18:51078301..51078302 [GRCh38] Chr18:48604671..48604672 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.455-6A>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003584922]|Juvenile polyposis syndrome [RCV001401342] | Chr18:51054775 [GRCh38] Chr18:48581145 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1224T>C (p.Phe408=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001445190] | Chr18:51067103 [GRCh38] Chr18:48593473 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.563del (p.Asn188fs) | deletion | Juvenile polyposis syndrome [RCV001391007] | Chr18:51054888 [GRCh38] Chr18:48581258 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1140-8T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV001401752] | Chr18:51067011 [GRCh38] Chr18:48593381 [GRCh37] Chr18:18q21.2 |
likely benign |
NC_000018.9:g.(?_48604616)_(48604837_?)del | deletion | Juvenile polyposis syndrome [RCV001382023] | Chr18:48604616..48604837 [GRCh37] Chr18:18q21.2 |
pathogenic |
NC_000018.9:g.(?_48593383)_(48604842_?)del | deletion | Juvenile polyposis syndrome [RCV001382024] | Chr18:48593383..48604842 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.905-7_905-3del | microsatellite | Juvenile polyposis syndrome [RCV001432319] | Chr18:51059854..51059858 [GRCh38] Chr18:48586224..48586228 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.828C>T (p.Tyr276=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001524745]|Juvenile polyposis syndrome [RCV002568076] | Chr18:51058380 [GRCh38] Chr18:48584750 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.568G>C (p.Ala190Pro) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001525030] | Chr18:51054894 [GRCh38] Chr18:48581264 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1434A>C (p.Ile478=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001450370] | Chr18:51076763 [GRCh38] Chr18:48603133 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.891T>C (p.His297=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001494649] | Chr18:51058443 [GRCh38] Chr18:48584813 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+242del | deletion | not provided [RCV001692921] | Chr18:51049560 [GRCh38] Chr18:48575930 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.1266T>C (p.Pro422=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001457573] | Chr18:51067145 [GRCh38] Chr18:48593515 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.-127-14T>C | single nucleotide variant | not provided [RCV001691086] | Chr18:51046906 [GRCh38] Chr18:48573276 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.195A>C (p.Gly65=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001496373] | Chr18:51047241 [GRCh38] Chr18:48573611 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.6C>T (p.Asp2=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001452135] | Chr18:51047052 [GRCh38] Chr18:48573422 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1227A>G (p.Val409=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001480327] | Chr18:51067106 [GRCh38] Chr18:48593476 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1452G>A (p.Leu484=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557705]|Juvenile polyposis syndrome [RCV001477103] | Chr18:51078260 [GRCh38] Chr18:48604630 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+9T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV001466887] | Chr18:51049333 [GRCh38] Chr18:48575703 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1658G>A (p.Ter553=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001466990] | Chr18:51078466 [GRCh38] Chr18:48604836 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.956-9T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001488280] | Chr18:51065414 [GRCh38] Chr18:48591784 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.933G>A (p.Gln311=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001501210] | Chr18:51059894 [GRCh38] Chr18:48586264 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.258T>G (p.Gly86=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001490402] | Chr18:51048694 [GRCh38] Chr18:48575064 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.915C>T (p.His305=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002377786]|Juvenile polyposis syndrome [RCV001464146]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007093] | Chr18:51059876 [GRCh38] Chr18:48586246 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.609A>G (p.Pro203=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002359049]|Juvenile polyposis syndrome [RCV001469976]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007117] | Chr18:51054935 [GRCh38] Chr18:48581305 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.630C>T (p.Ser210=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001403421] | Chr18:51054956 [GRCh38] Chr18:48581326 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1482C>T (p.Asp494=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001460573] | Chr18:51078290 [GRCh38] Chr18:48604660 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1197C>T (p.Val399=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001464647] | Chr18:51067076 [GRCh38] Chr18:48593446 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.333T>C (p.His111=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002322434]|Juvenile polyposis syndrome [RCV001419604] | Chr18:51048769 [GRCh38] Chr18:48575139 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1056A>C (p.Gly352=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001398167] | Chr18:51065523 [GRCh38] Chr18:48591893 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.528A>C (p.Gly176=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002343706]|Hereditary cancer-predisposing syndrome [RCV001524049] | Chr18:51054854 [GRCh38] Chr18:48581224 [GRCh37] Chr18:18q21.2 |
likely benign |
NC_000018.9:g.(?_48573411)_(48604842_?)dup | duplication | Juvenile polyposis syndrome [RCV001404510] | Chr18:48573411..48604842 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.738A>G (p.Pro246=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004557684]|Juvenile polyposis syndrome [RCV001466403] | Chr18:51058195 [GRCh38] Chr18:48584565 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1149A>G (p.Ile383Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV001377145] | Chr18:51067028 [GRCh38] Chr18:48593398 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.620del (p.Asn207fs) | deletion | Juvenile polyposis syndrome [RCV001386065] | Chr18:51054945 [GRCh38] Chr18:48581315 [GRCh37] Chr18:18q21.2 |
pathogenic |
NC_000018.9:g.(?_48573407)_(48573675_?)dup | duplication | Juvenile polyposis syndrome [RCV001430402] | Chr18:48573407..48573675 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.905-8T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003584938]|Juvenile polyposis syndrome [RCV001424226] | Chr18:51059858 [GRCh38] Chr18:48586228 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1308+2T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001379228]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004037636] | Chr18:51067189 [GRCh38] Chr18:48593559 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.905-8T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV001504037]|not provided [RCV001751778] | Chr18:51059858 [GRCh38] Chr18:48586228 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.429C>G (p.Leu143=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001489037] | Chr18:51049299 [GRCh38] Chr18:48575669 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.510A>T (p.Pro170=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001438784] | Chr18:51054836 [GRCh38] Chr18:48581206 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1409C>G (p.Pro470Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV003094001]|not specified [RCV002248859] | Chr18:51076738 [GRCh38] Chr18:48603108 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.930C>T (p.Phe310=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003109201] | Chr18:51059891 [GRCh38] Chr18:48586261 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+1G>C | single nucleotide variant | not provided [RCV002227419] | Chr18:51076777 [GRCh38] Chr18:48603147 [GRCh37] Chr18:18q21.2 |
not provided |
NM_005359.6(SMAD4):c.562A>C (p.Asn188His) | single nucleotide variant | Juvenile polyposis syndrome [RCV002001458] | Chr18:51054888 [GRCh38] Chr18:48581258 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1443T>C (p.Ala481=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002259279]|Juvenile polyposis syndrome [RCV003095853] | Chr18:51076772 [GRCh38] Chr18:48603142 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.97G>A (p.Glu33Lys) | single nucleotide variant | not provided [RCV001764015] | Chr18:51047143 [GRCh38] Chr18:48573513 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1414C>G (p.Pro472Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV003761428]|not provided [RCV001774746] | Chr18:51076743 [GRCh38] Chr18:48603113 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1273G>A (p.Ala425Thr) | single nucleotide variant | not provided [RCV001763709] | Chr18:51067152 [GRCh38] Chr18:48593522 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.533C>T (p.Ser178Leu) | single nucleotide variant | not provided [RCV001771468] | Chr18:51054859 [GRCh38] Chr18:48581229 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1052A>G (p.Asp351Gly) | single nucleotide variant | not specified [RCV001801138] | Chr18:51065519 [GRCh38] Chr18:48591889 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+3G>C | single nucleotide variant | not provided [RCV003238117] | Chr18:51054996 [GRCh38] Chr18:48581366 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-12T>G | single nucleotide variant | not provided [RCV003238118] | Chr18:51048674 [GRCh38] Chr18:48575044 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1639G>A (p.Asp547Asn) | single nucleotide variant | not provided [RCV001774605] | Chr18:51078447 [GRCh38] Chr18:48604817 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1105A>G (p.Asn369Asp) | single nucleotide variant | not provided [RCV001761426] | Chr18:51065572 [GRCh38] Chr18:48591942 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.5:c.-496_*1311dup | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV001799324] | uncertain significance | |
NM_005359.6(SMAD4):c.692G>T (p.Gly231Val) | single nucleotide variant | Generalized juvenile polyposis/juvenile polyposis coli [RCV001789836]|Juvenile polyposis syndrome [RCV001885214] | Chr18:51058149 [GRCh38] Chr18:48584519 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1139+388G>A | single nucleotide variant | not provided [RCV001786925] | Chr18:51065994 [GRCh38] Chr18:48592364 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.605C>T (p.Ala202Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV003772004]|not provided [RCV001758556] | Chr18:51054931 [GRCh38] Chr18:48581301 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1309-15G>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001804322]|Juvenile polyposis syndrome [RCV002074182] | Chr18:51076623 [GRCh38] Chr18:48602993 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668G>A (p.Ser223Asn) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV001805673] | Chr18:51058125 [GRCh38] Chr18:48584495 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.400G>A (p.Glu134Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002370332]|Hereditary cancer-predisposing syndrome [RCV001805389]|Juvenile polyposis syndrome [RCV001869539] | Chr18:51048836 [GRCh38] Chr18:48575206 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.849C>A (p.His283Gln) | single nucleotide variant | not specified [RCV001820727] | Chr18:51058401 [GRCh38] Chr18:48584771 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1448-5G>T | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002388678]|Hereditary cancer-predisposing syndrome [RCV001805506] | Chr18:51078251 [GRCh38] Chr18:48604621 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.197C>T (p.Ala66Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002422866]|Hereditary cancer-predisposing syndrome [RCV001804526] | Chr18:51047243 [GRCh38] Chr18:48573613 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1415C>T (p.Pro472Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002388677]|Hereditary cancer-predisposing syndrome [RCV001805482]|Juvenile polyposis syndrome [RCV001869547] | Chr18:51076744 [GRCh38] Chr18:48603114 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1627A>T (p.Met543Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002397758]|Hereditary cancer-predisposing syndrome [RCV001805532]|Juvenile polyposis syndrome [RCV003597217] | Chr18:51078435 [GRCh38] Chr18:48604805 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.773C>T (p.Ala258Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558791]|Juvenile polyposis syndrome [RCV001986884] | Chr18:51058230 [GRCh38] Chr18:48584600 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1342C>A (p.Gln448Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV002045113] | Chr18:51076671 [GRCh38] Chr18:48603041 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1411G>A (p.Gly471Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001863472] | Chr18:51076740 [GRCh38] Chr18:48603110 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1050T>C (p.Val350=) | single nucleotide variant | Juvenile polyposis syndrome [RCV001971400] | Chr18:51065517 [GRCh38] Chr18:48591887 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.937C>G (p.Pro313Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002370689]|Juvenile polyposis syndrome [RCV002042652] | Chr18:51059898 [GRCh38] Chr18:48586268 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.656T>C (p.Val219Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002361385]|Juvenile polyposis syndrome [RCV002025951] | Chr18:51054982 [GRCh38] Chr18:48581352 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.639C>G (p.Asn213Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001896233] | Chr18:51054965 [GRCh38] Chr18:48581335 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.579G>C (p.Glu193Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV001908448] | Chr18:51054905 [GRCh38] Chr18:48581275 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.190A>G (p.Asn64Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV001891982] | Chr18:51047236 [GRCh38] Chr18:48573606 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.905-6C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001949914] | Chr18:51059860 [GRCh38] Chr18:48586230 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1642C>T (p.Pro548Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV002045043] | Chr18:51078450 [GRCh38] Chr18:48604820 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1154A>C (p.Lys385Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002043859] | Chr18:51067033 [GRCh38] Chr18:48593403 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.541A>T (p.Thr181Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV002024977] | Chr18:51054867 [GRCh38] Chr18:48581237 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1580T>C (p.Ile527Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001986786] | Chr18:51078388 [GRCh38] Chr18:48604758 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.714dup (p.Gln239fs) | duplication | Juvenile polyposis syndrome [RCV001908693] | Chr18:51058170..51058171 [GRCh38] Chr18:48584540..48584541 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.894del (p.Gly299fs) | deletion | Juvenile polyposis syndrome [RCV001825132] | Chr18:51058444 [GRCh38] Chr18:48584814 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.468G>A (p.Met156Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV001983561] | Chr18:51054794 [GRCh38] Chr18:48581164 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1507A>G (p.Met503Val) | single nucleotide variant | not provided [RCV001847469] | Chr18:51078315 [GRCh38] Chr18:48604685 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1030A>G (p.Ser344Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV001890873] | Chr18:51065497 [GRCh38] Chr18:48591867 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.787+18A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001891763] | Chr18:51058262 [GRCh38] Chr18:48584632 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.557C>G (p.Pro186Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002043514] | Chr18:51054883 [GRCh38] Chr18:48581253 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+6C>T | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558696]|Juvenile polyposis syndrome [RCV001895032] | Chr18:51058462 [GRCh38] Chr18:48584832 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.296G>A (p.Trp99Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV001969919] | Chr18:51048732 [GRCh38] Chr18:48575102 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1523del (p.Gly508fs) | deletion | Juvenile polyposis syndrome [RCV001872983]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003464193] | Chr18:51078330 [GRCh38] Chr18:48604700 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.691G>A (p.Gly231Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV001908539] | Chr18:51058148 [GRCh38] Chr18:48584518 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.737C>T (p.Pro246Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002386643]|Juvenile polyposis syndrome [RCV001889874] | Chr18:51058194 [GRCh38] Chr18:48584564 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.104T>A (p.Phe35Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001914129] | Chr18:51047150 [GRCh38] Chr18:48573520 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.112del (p.Arg38fs) | deletion | Juvenile polyposis syndrome [RCV001910798] | Chr18:51047154 [GRCh38] Chr18:48573524 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.472del (p.Met157_Val158insTer) | deletion | Juvenile polyposis syndrome [RCV001946287] | Chr18:51054797 [GRCh38] Chr18:48581167 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.404G>T (p.Arg135Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001892167] | Chr18:51048840 [GRCh38] Chr18:48575210 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1612G>A (p.Glu538Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002397841]|Juvenile polyposis syndrome [RCV001871453] | Chr18:51078420 [GRCh38] Chr18:48604790 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1034G>C (p.Cys345Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003170372]|Juvenile polyposis syndrome [RCV002005644] | Chr18:51065501 [GRCh38] Chr18:48591871 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+16_904+17insTTTTTTTTTTTTTTTTTTTTNNNNNNNNNNCATGCTGTTTTGGTTACTGTAGCCTTGTATGATAGTTTGAAGTCAGGTTGTGTGATTCCTCCAGCTTTGTTCTTTTGGAGTAAGCTCTTGTTTTT | insertion | Juvenile polyposis syndrome [RCV001870817] | Chr18:51058456..51058457 [GRCh38] Chr18:48584826..48584827 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1186G>A (p.Asp396Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV001872297] | Chr18:51067065 [GRCh38] Chr18:48593435 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18p11.32-q23(chr18:136226-78014123) | copy number gain | not specified [RCV002052616] | Chr18:136226..78014123 [GRCh37] Chr18:18p11.32-q23 |
pathogenic |
NM_005359.6(SMAD4):c.530A>G (p.His177Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001908468]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003471001] | Chr18:51054856 [GRCh38] Chr18:48581226 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1253C>T (p.Ala418Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV002039400] | Chr18:51067132 [GRCh38] Chr18:48593502 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1658G>C (p.Ter553Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558768]|Juvenile polyposis syndrome [RCV001966373] | Chr18:51078466 [GRCh38] Chr18:48604836 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18q21.1-23(chr18:47656799-78014123) | copy number loss | not specified [RCV002052636] | Chr18:47656799..78014123 [GRCh37] Chr18:18q21.1-23 |
pathogenic |
NM_005359.6(SMAD4):c.737del (p.Pro246fs) | deletion | Juvenile polyposis syndrome [RCV001938801] | Chr18:51058193 [GRCh38] Chr18:48584563 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.742C>T (p.Gln248Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV001940629] | Chr18:51058199 [GRCh38] Chr18:48584569 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.815G>A (p.Arg272Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001982278]|not provided [RCV003238881] | Chr18:51058367 [GRCh38] Chr18:48584737 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.375T>G (p.Ser125Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001974031] | Chr18:51048811 [GRCh38] Chr18:48575181 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1643C>G (p.Pro548Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001944398] | Chr18:51078451 [GRCh38] Chr18:48604821 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+1G>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002017822]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004046640] | Chr18:51047296 [GRCh38] Chr18:48573666 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.82C>A (p.Gln28Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV002033178] | Chr18:51047128 [GRCh38] Chr18:48573498 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.772G>T (p.Ala258Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV002048710] | Chr18:51058229 [GRCh38] Chr18:48584599 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.695G>A (p.Ser232Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV001962651] | Chr18:51058152 [GRCh38] Chr18:48584522 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1647A>C (p.Gln549His) | single nucleotide variant | Juvenile polyposis syndrome [RCV002000605] | Chr18:51078455 [GRCh38] Chr18:48604825 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1415dup (p.Gly473fs) | duplication | Juvenile polyposis syndrome [RCV001941599] | Chr18:51076741..51076742 [GRCh38] Chr18:48603111..48603112 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.287C>T (p.Ala96Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV002001428] | Chr18:51048723 [GRCh38] Chr18:48575093 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.837T>G (p.Asn279Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002441114]|Juvenile polyposis syndrome [RCV001956763] | Chr18:51058389 [GRCh38] Chr18:48584759 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1285A>G (p.Ile429Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558683]|Juvenile polyposis syndrome [RCV001905141] | Chr18:51067164 [GRCh38] Chr18:48593534 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.905-1G>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002037544] | Chr18:51059865 [GRCh38] Chr18:48586235 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.205A>G (p.Ser69Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002423152]|Juvenile polyposis syndrome [RCV001994970] | Chr18:51047251 [GRCh38] Chr18:48573621 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1189G>A (p.Val397Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV001936403]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010920] | Chr18:51067068 [GRCh38] Chr18:48593438 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.454+3A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002038009] | Chr18:51049327 [GRCh38] Chr18:48575697 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1579A>G (p.Ile527Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001934897] | Chr18:51078387 [GRCh38] Chr18:48604757 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.47G>T (p.Cys16Phe) | single nucleotide variant | Juvenile polyposis syndrome [RCV001867171] | Chr18:51047093 [GRCh38] Chr18:48573463 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.35G>A (p.Ser12Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV001899152] | Chr18:51047081 [GRCh38] Chr18:48573451 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-5_3del (p.Met1fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV004558778]|Juvenile polyposis syndrome [RCV001974029]|not specified [RCV002465912] | Chr18:51047040..51047047 [GRCh38] Chr18:48573410..48573417 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.946A>G (p.Asn316Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV001900557] | Chr18:51059907 [GRCh38] Chr18:48586277 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.237_241dup (p.Arg81fs) | duplication | Juvenile polyposis syndrome [RCV001882303] | Chr18:51047279..51047280 [GRCh38] Chr18:48573649..48573650 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1013C>G (p.Thr338Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002010658] | Chr18:51065480 [GRCh38] Chr18:48591850 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668-4C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV001953313] | Chr18:51058121 [GRCh38] Chr18:48584491 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.76C>T (p.His26Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001867537] | Chr18:51047122 [GRCh38] Chr18:48573492 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.520A>G (p.Thr174Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002334783]|Juvenile polyposis syndrome [RCV001877845] | Chr18:51054846 [GRCh38] Chr18:48581216 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.902dup (p.Tyr301Ter) | duplication | Juvenile polyposis syndrome [RCV001953721] | Chr18:51058453..51058454 [GRCh38] Chr18:48584823..48584824 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.787+4T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002406995]|Hereditary cancer-predisposing syndrome [RCV002258322]|Juvenile polyposis syndrome [RCV001902820] | Chr18:51058248 [GRCh38] Chr18:48584618 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.341A>G (p.Tyr114Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002458976]|Juvenile polyposis syndrome [RCV002028875] | Chr18:51048777 [GRCh38] Chr18:48575147 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.348_349del (p.Tyr117fs) | deletion | Juvenile polyposis syndrome [RCV001901203] | Chr18:51048784..51048785 [GRCh38] Chr18:48575154..48575155 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.131T>C (p.Val44Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV001866846] | Chr18:51047177 [GRCh38] Chr18:48573547 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(?_48603002)_(48604843_?)dup | duplication | Juvenile polyposis syndrome [RCV001918813] | Chr18:48603002..48604843 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1552A>G (p.Ile518Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001875619] | Chr18:51078360 [GRCh38] Chr18:48604730 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1548del (p.Ser517fs) | deletion | Juvenile polyposis syndrome [RCV001994848] | Chr18:51078356 [GRCh38] Chr18:48604726 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1432A>G (p.Ile478Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001976225] | Chr18:51076761 [GRCh38] Chr18:48603131 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.925G>C (p.Ala309Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV002033322] | Chr18:51059886 [GRCh38] Chr18:48586256 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.832C>A (p.Pro278Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003170189]|Juvenile polyposis syndrome [RCV001953992] | Chr18:51058384 [GRCh38] Chr18:48584754 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.23del (p.Asn8fs) | deletion | Juvenile polyposis syndrome [RCV002049264] | Chr18:51047068 [GRCh38] Chr18:48573438 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1339A>T (p.Met447Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001954249] | Chr18:51076668 [GRCh38] Chr18:48603038 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.622G>A (p.Ala208Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558793]|Juvenile polyposis syndrome [RCV002015184] | Chr18:51054948 [GRCh38] Chr18:48581318 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1087T>G (p.Cys363Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV002012941]|SMAD4-related disorder [RCV003402038] | Chr18:51065554 [GRCh38] Chr18:48591924 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1002G>C (p.Gln334His) | single nucleotide variant | Juvenile polyposis syndrome [RCV002011648] | Chr18:51065469 [GRCh38] Chr18:48591839 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1285A>C (p.Ile429Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001996452] | Chr18:51067164 [GRCh38] Chr18:48593534 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.673C>T (p.Pro225Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002361373]|Juvenile polyposis syndrome [RCV001999454]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004571940] | Chr18:51058130 [GRCh38] Chr18:48584500 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.409G>C (p.Val137Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001903831] | Chr18:51048845 [GRCh38] Chr18:48575215 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.25A>G (p.Thr9Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002425375]|Juvenile polyposis syndrome [RCV001995772] | Chr18:51047071 [GRCh38] Chr18:48573441 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.892C>A (p.Pro298Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001881475] | Chr18:51058444 [GRCh38] Chr18:48584814 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.637A>C (p.Asn213His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002352703]|Juvenile polyposis syndrome [RCV001998939] | Chr18:51054963 [GRCh38] Chr18:48581333 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(?_48556583)_(48556993_?)dup | duplication | Juvenile polyposis syndrome [RCV001992820] | Chr18:48556583..48556993 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.491A>T (p.His164Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558663]|Juvenile polyposis syndrome [RCV002029972] | Chr18:51054817 [GRCh38] Chr18:48581187 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1385C>T (p.Ala462Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV001884014] | Chr18:51076714 [GRCh38] Chr18:48603084 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(?_48591783)_(48591986_?)del | deletion | Juvenile polyposis syndrome [RCV001950962] | Chr18:48591783..48591986 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1172G>A (p.Cys391Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001961192] | Chr18:51067051 [GRCh38] Chr18:48593421 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.143A>G (p.Lys48Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002388972]|Juvenile polyposis syndrome [RCV001978147] | Chr18:51047189 [GRCh38] Chr18:48573559 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.516G>T (p.Leu172Phe) | single nucleotide variant | Juvenile polyposis syndrome [RCV001978190] | Chr18:51054842 [GRCh38] Chr18:48581212 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(?_46570425)_(48604837_?)dup | duplication | not provided [RCV001923066] | Chr18:46570425..48604837 [GRCh37] Chr18:18q21.1-21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.470T>A (p.Met157Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV001875548] | Chr18:51054796 [GRCh38] Chr18:48581166 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.821C>T (p.Ala274Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002407262]|Juvenile polyposis syndrome [RCV002019214]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003475278]|not provided [RCV003159226] | Chr18:51058373 [GRCh38] Chr18:48584743 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(?_48602998)_(48604837_?)del | deletion | Juvenile polyposis syndrome [RCV001958986] | Chr18:48602998..48604837 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1396G>A (p.Ala466Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV001885592] | Chr18:51076725 [GRCh38] Chr18:48603095 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.676G>C (p.Ala226Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV001883756] | Chr18:51058133 [GRCh38] Chr18:48584503 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1125_1128dup (p.Glu377delinsHisTer) | duplication | Juvenile polyposis syndrome [RCV001934724] | Chr18:51065591..51065592 [GRCh38] Chr18:48591961..48591962 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1017dup (p.Lys340Ter) | duplication | Juvenile polyposis syndrome [RCV001980186] | Chr18:51065481..51065482 [GRCh38] Chr18:48591851..48591852 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1587A>C (p.Leu529Phe) | single nucleotide variant | Juvenile polyposis syndrome [RCV001939706] | Chr18:51078395 [GRCh38] Chr18:48604765 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1646A>G (p.Gln549Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001998257] | Chr18:51078454 [GRCh38] Chr18:48604824 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1373dup (p.Ala459fs) | duplication | Juvenile polyposis syndrome [RCV001940281] | Chr18:51076701..51076702 [GRCh38] Chr18:48603071..48603072 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.728G>C (p.Gly243Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV002035598] | Chr18:51058185 [GRCh38] Chr18:48584555 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.713_719del (p.Leu237_Leu238insTer) | deletion | Juvenile polyposis syndrome [RCV001886185] | Chr18:51058169..51058175 [GRCh38] Chr18:48584539..48584545 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.668-15T>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585168]|Juvenile polyposis syndrome [RCV001939600] | Chr18:51058110 [GRCh38] Chr18:48584480 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.688G>A (p.Gly230Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001931262] | Chr18:51058145 [GRCh38] Chr18:48584515 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1355C>T (p.Ala452Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002386889]|Juvenile polyposis syndrome [RCV002047846] | Chr18:51076684 [GRCh38] Chr18:48603054 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.332_333del (p.His111fs) | deletion | Juvenile polyposis syndrome [RCV001939853] | Chr18:51048768..51048769 [GRCh38] Chr18:48575138..48575139 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1507A>T (p.Met503Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV002028865] | Chr18:51078315 [GRCh38] Chr18:48604685 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1176dup (p.Gly393fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV004558764]|Juvenile polyposis syndrome [RCV001956348] | Chr18:51067052..51067053 [GRCh38] Chr18:48593422..48593423 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1036C>G (p.Pro346Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002388830]|Juvenile polyposis syndrome [RCV001933160] | Chr18:51065503 [GRCh38] Chr18:48591873 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.542C>G (p.Thr181Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002343986]|Juvenile polyposis syndrome [RCV001917664]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004571569] | Chr18:51054868 [GRCh38] Chr18:48581238 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.895G>A (p.Gly299Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV001989205]|not specified [RCV002268595] | Chr18:51058447 [GRCh38] Chr18:48584817 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.908C>A (p.Pro303His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002370616]|Juvenile polyposis syndrome [RCV001953947]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010990]|Myhre syndrome [RCV002507710] | Chr18:51059869 [GRCh38] Chr18:48586239 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1025C>T (p.Pro342Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV001918645] | Chr18:51065492 [GRCh38] Chr18:48591862 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.225G>A (p.Gln75=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002210192] | Chr18:51047271 [GRCh38] Chr18:48573641 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.522T>A (p.Thr174=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002076092] | Chr18:51054848 [GRCh38] Chr18:48581218 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.905-16G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002085285] | Chr18:51059850 [GRCh38] Chr18:48586220 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+9C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002186479] | Chr18:51067196 [GRCh38] Chr18:48593566 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+9G>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002209360] | Chr18:51076785 [GRCh38] Chr18:48603155 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.425-12T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002124533] | Chr18:51049283 [GRCh38] Chr18:48575653 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+20T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002091265] | Chr18:51076796 [GRCh38] Chr18:48603166 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.429C>T (p.Leu143=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585231]|Juvenile polyposis syndrome [RCV002186563] | Chr18:51049299 [GRCh38] Chr18:48575669 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.955+19T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002205196] | Chr18:51059935 [GRCh38] Chr18:48586305 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.956-4A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002205153] | Chr18:51065419 [GRCh38] Chr18:48591789 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.348G>A (p.Gln116=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002071254] | Chr18:51048784 [GRCh38] Chr18:48575154 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.425-17C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002208064] | Chr18:51049278 [GRCh38] Chr18:48575648 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140-15T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002187123] | Chr18:51067004 [GRCh38] Chr18:48593374 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+7T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002075177] | Chr18:51058463 [GRCh38] Chr18:48584833 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.425-77A>G | single nucleotide variant | not provided [RCV002223396] | Chr18:51049218 [GRCh38] Chr18:48575588 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.425-16C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002147715] | Chr18:51049279 [GRCh38] Chr18:48575649 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140-5C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002192320] | Chr18:51067014 [GRCh38] Chr18:48593384 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.24T>C (p.Asn8=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002170033] | Chr18:51047070 [GRCh38] Chr18:48573440 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.69G>A (p.Leu23=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002194940] | Chr18:51047115 [GRCh38] Chr18:48573485 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1410T>C (p.Pro470=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002196715] | Chr18:51076739 [GRCh38] Chr18:48603109 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.849C>T (p.His283=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002094061] | Chr18:51058401 [GRCh38] Chr18:48584771 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.18T>C (p.Ile6=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002134969] | Chr18:51047064 [GRCh38] Chr18:48573434 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.591C>T (p.Thr197=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002171284]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004005419] | Chr18:51054917 [GRCh38] Chr18:48581287 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.905-5T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002190282] | Chr18:51059861 [GRCh38] Chr18:48586231 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+13A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002091975] | Chr18:51055006 [GRCh38] Chr18:48581376 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-15T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002211729] | Chr18:51054766 [GRCh38] Chr18:48581136 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.249+11_249+12del | microsatellite | Juvenile polyposis syndrome [RCV002132979] | Chr18:51047304..51047305 [GRCh38] Chr18:48573674..48573675 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1503C>T (p.Leu501=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002093834] | Chr18:51078311 [GRCh38] Chr18:48604681 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.675T>G (p.Pro225=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002094072] | Chr18:51058132 [GRCh38] Chr18:48584502 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.249+7C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002078169] | Chr18:51047302 [GRCh38] Chr18:48573672 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1080T>C (p.Asp360=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002079045] | Chr18:51065547 [GRCh38] Chr18:48591917 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.714G>A (p.Leu238=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002152813] | Chr18:51058171 [GRCh38] Chr18:48584541 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1113C>T (p.His371=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002209224] | Chr18:51065580 [GRCh38] Chr18:48591950 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+19T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002110782] | Chr18:51067206 [GRCh38] Chr18:48593576 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.888C>T (p.Pro296=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002149996] | Chr18:51058440 [GRCh38] Chr18:48584810 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-18C>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002215161] | Chr18:51078238 [GRCh38] Chr18:48604608 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-11T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002166118] | Chr18:51078245 [GRCh38] Chr18:48604615 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-16T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002091818] | Chr18:51054765 [GRCh38] Chr18:48581135 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1185T>G (p.Gly395=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002096858] | Chr18:51067064 [GRCh38] Chr18:48593434 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.513G>A (p.Ser171=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002346533]|Juvenile polyposis syndrome [RCV002171447] | Chr18:51054839 [GRCh38] Chr18:48581209 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-16A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002134857] | Chr18:51078240 [GRCh38] Chr18:48604610 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.555A>C (p.Pro185=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002077978] | Chr18:51054881 [GRCh38] Chr18:48581251 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1139+18A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002153987] | Chr18:51065624 [GRCh38] Chr18:48591994 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.787+20A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002139059] | Chr18:51058264 [GRCh38] Chr18:48584634 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.45C>G (p.Ala15=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002175441] | Chr18:51047091 [GRCh38] Chr18:48573461 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+7A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002141275] | Chr18:51076783 [GRCh38] Chr18:48603153 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.787+16A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002118933] | Chr18:51058260 [GRCh38] Chr18:48584630 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1218G>T (p.Ala406=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002199195] | Chr18:51067097 [GRCh38] Chr18:48593467 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.981T>C (p.Ala327=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558891]|Juvenile polyposis syndrome [RCV002154366] | Chr18:51065448 [GRCh38] Chr18:48591818 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1221C>G (p.Val407=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002216882] | Chr18:51067100 [GRCh38] Chr18:48593470 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.492T>C (p.His164=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002179492] | Chr18:51054818 [GRCh38] Chr18:48581188 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.424+16T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002143431] | Chr18:51048876 [GRCh38] Chr18:48575246 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.424+13T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002143499] | Chr18:51048873 [GRCh38] Chr18:48575243 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.279G>A (p.Val93=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002155640] | Chr18:51048715 [GRCh38] Chr18:48575085 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1272T>C (p.Asp424=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002137682] | Chr18:51067151 [GRCh38] Chr18:48593521 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-10G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002123659] | Chr18:51058115 [GRCh38] Chr18:48584485 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+20G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002118721] | Chr18:51055013 [GRCh38] Chr18:48581383 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.249+13_249+14insAT | insertion | Juvenile polyposis syndrome [RCV002158729]|not specified [RCV003388100] | Chr18:51047308..51047309 [GRCh38] Chr18:48573678..48573679 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.711G>T (p.Leu237=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002361441]|Juvenile polyposis syndrome [RCV002177802]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004011221] | Chr18:51058168 [GRCh38] Chr18:48584538 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.955+18T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002154379] | Chr18:51059934 [GRCh38] Chr18:48586304 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1209T>C (p.Ser403=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002141082] | Chr18:51067088 [GRCh38] Chr18:48593458 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+7T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002204226] | Chr18:51055000 [GRCh38] Chr18:48581370 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.30A>T (p.Pro10=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002325696]|Juvenile polyposis syndrome [RCV002184194] | Chr18:51047076 [GRCh38] Chr18:48573446 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.955+14A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002219565] | Chr18:51059930 [GRCh38] Chr18:48586300 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1350G>A (p.Gln450=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003161602]|Juvenile polyposis syndrome [RCV002124178] | Chr18:51076679 [GRCh38] Chr18:48603049 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.414A>T (p.Ser138=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002144311] | Chr18:51048850 [GRCh38] Chr18:48575220 [GRCh37] Chr18:18q21.2 |
likely benign |
NC_000018.9:g.(?_48602988)_(48604837_?)del | deletion | Juvenile polyposis syndrome [RCV003116354] | Chr18:48602988..48604837 [GRCh37] Chr18:18q21.2 |
pathogenic |
NC_000018.9:g.(?_48591783)_(48593567_?)del | deletion | Juvenile polyposis syndrome [RCV003116355] | Chr18:48591783..48593567 [GRCh37] Chr18:18q21.2 |
pathogenic |
NC_000018.9:g.(?_48604616)_(48604837_?)dup | duplication | Juvenile polyposis syndrome [RCV003116356] | Chr18:48604616..48604837 [GRCh37] Chr18:18q21.2 |
likely benign |
NC_000018.9:g.(?_48573397)_(48573685_?)dup | duplication | Juvenile polyposis syndrome [RCV003116357] | Chr18:48573397..48573685 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.353C>T (p.Ala118Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558907]|Juvenile polyposis syndrome [RCV003094187]|not provided [RCV002255744] | Chr18:51048789 [GRCh38] Chr18:48575159 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-128+6_-128+7insCTTGCAACGTTA | insertion | Hereditary cancer-predisposing syndrome [RCV002258706] | Chr18:51030629..51030630 [GRCh38] Chr18:48556999..48557000 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-128+7G>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002258707] | Chr18:51030630 [GRCh38] Chr18:48557000 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.202C>A (p.Pro68Thr) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002258708] | Chr18:51047248 [GRCh38] Chr18:48573618 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.998T>C (p.Val333Ala) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV002258710] | Chr18:51065465 [GRCh38] Chr18:48591835 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.662C>T (p.Ser221Phe) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002366736]|Juvenile polyposis syndrome [RCV003120947] | Chr18:51054988 [GRCh38] Chr18:48581358 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.878C>G (p.Pro293Arg) | single nucleotide variant | not provided [RCV002267533] | Chr18:51058430 [GRCh38] Chr18:48584800 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.905-3T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002290214] | Chr18:51059863 [GRCh38] Chr18:48586233 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*3760dup | duplication | not provided [RCV002263123] | Chr18:51082218..51082219 [GRCh38] Chr18:48608588..48608589 [GRCh37] Chr18:18q21.2 |
benign|likely benign |
NM_005359.6(SMAD4):c.904+43_904+45dup | duplication | not specified [RCV002268942] | Chr18:51058485..51058486 [GRCh38] Chr18:48584855..48584856 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.904+44_904+45del | deletion | not specified [RCV002268943] | Chr18:51058486..51058487 [GRCh38] Chr18:48584856..48584857 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-49G>C | single nucleotide variant | not specified [RCV002269129] | Chr18:51078207 [GRCh38] Chr18:48604577 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1140-3A>T | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002452010]|Juvenile polyposis syndrome [RCV003102363] | Chr18:51067016 [GRCh38] Chr18:48593386 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.369del (p.Cys123fs) | deletion | Juvenile polyposis syndrome [RCV002288371] | Chr18:51048805 [GRCh38] Chr18:48575175 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.788-31C>T | single nucleotide variant | not specified [RCV002268941] | Chr18:51058309 [GRCh38] Chr18:48584679 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+49A>T | single nucleotide variant | not specified [RCV002268944] | Chr18:51058505 [GRCh38] Chr18:48584875 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1309-48G>A | single nucleotide variant | not specified [RCV002269116] | Chr18:51076590 [GRCh38] Chr18:48602960 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.812G>T (p.Ser271Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002421331] | Chr18:51058364 [GRCh38] Chr18:48584734 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-3A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002452004] | Chr18:51067016 [GRCh38] Chr18:48593386 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1325A>T (p.Gln442Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002385769] | Chr18:51076654 [GRCh38] Chr18:48603024 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.798C>A (p.Thr266=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002419069]|Juvenile polyposis syndrome [RCV003597432] | Chr18:51058350 [GRCh38] Chr18:48584720 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.378C>A (p.Val126=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002351199] | Chr18:51048814 [GRCh38] Chr18:48575184 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1335A>G (p.Arg445=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002387570]|Juvenile polyposis syndrome [RCV003597436] | Chr18:51076664 [GRCh38] Chr18:48603034 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+38G>C | single nucleotide variant | not specified [RCV002268940] | Chr18:51049362 [GRCh38] Chr18:48575732 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.956-17C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV003096087]|not specified [RCV002269104] | Chr18:51065406 [GRCh38] Chr18:48591776 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.624T>C (p.Ala208=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002366678] | Chr18:51054950 [GRCh38] Chr18:48581320 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.357T>C (p.Phe119=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002455082] | Chr18:51048793 [GRCh38] Chr18:48575163 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.28C>T (p.Pro10Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002438047] | Chr18:51047074 [GRCh38] Chr18:48573444 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.954T>G (p.Pro318=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002385183] | Chr18:51059915 [GRCh38] Chr18:48586285 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.553C>A (p.Pro185Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002351872]|Juvenile polyposis syndrome [RCV003096784] | Chr18:51054879 [GRCh38] Chr18:48581249 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.457C>G (p.Pro153Ala) | single nucleotide variant | not specified [RCV002266413] | Chr18:51054783 [GRCh38] Chr18:48581153 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1243G>A (p.Asp415Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002385083] | Chr18:51067122 [GRCh38] Chr18:48593492 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.635C>G (p.Ala212Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002369015] | Chr18:51054961 [GRCh38] Chr18:48581331 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1330C>G (p.His444Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002387483] | Chr18:51076659 [GRCh38] Chr18:48603029 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.670C>G (p.Gln224Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002367195] | Chr18:51058127 [GRCh38] Chr18:48584497 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1019dup (p.Val341fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002369126] | Chr18:51065484..51065485 [GRCh38] Chr18:48591854..48591855 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.956-11_956-1del | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002385200] | Chr18:51065412..51065422 [GRCh38] Chr18:48591782..48591792 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.337A>G (p.Lys113Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002451807] | Chr18:51048773 [GRCh38] Chr18:48575143 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.674C>A (p.Pro225His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002369215] | Chr18:51058131 [GRCh38] Chr18:48584501 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.372_373dup (p.Ser125fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002349088]|Myhre syndrome [RCV003314038] | Chr18:51048806..51048807 [GRCh38] Chr18:48575176..48575177 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.623C>G (p.Ala208Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002366606] | Chr18:51054949 [GRCh38] Chr18:48581319 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.637A>G (p.Asn213Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002369112] | Chr18:51054963 [GRCh38] Chr18:48581333 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.709C>G (p.Leu237Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002367319] | Chr18:51058166 [GRCh38] Chr18:48584536 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1221C>T (p.Val407=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002369138] | Chr18:51067100 [GRCh38] Chr18:48593470 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.203C>G (p.Pro68Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002419896] | Chr18:51047249 [GRCh38] Chr18:48573619 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.286G>T (p.Ala96Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002437670] | Chr18:51048722 [GRCh38] Chr18:48575092 [GRCh37] Chr18:18q21.2 |
uncertain significance |
GRCh37/hg19 18q21.2(chr18:48273185-51134173)x3 | copy number gain | not provided [RCV002473750] | Chr18:48273185..51134173 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.454+23C>T | single nucleotide variant | not specified [RCV002466209] | Chr18:51049347 [GRCh38] Chr18:48575717 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.559A>C (p.Ser187Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002344852]|Juvenile polyposis syndrome [RCV003096803] | Chr18:51054885 [GRCh38] Chr18:48581255 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.564T>A (p.Asn188Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002345193] | Chr18:51054890 [GRCh38] Chr18:48581260 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.312T>C (p.Leu104=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002320584] | Chr18:51048748 [GRCh38] Chr18:48575118 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1139+1_1139+4dup | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002320955]|Hereditary cancer-predisposing syndrome [RCV003585251]|Juvenile polyposis syndrome [RCV003763108] | Chr18:51065606..51065607 [GRCh38] Chr18:48591976..48591977 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.851A>C (p.Gln284Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV002304097] | Chr18:51058403 [GRCh38] Chr18:48584773 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1343A>G (p.Gln448Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV002304143] | Chr18:51076672 [GRCh38] Chr18:48603042 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1407C>T (p.Ile469=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002389398] | Chr18:51076736 [GRCh38] Chr18:48603106 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.725C>G (p.Ser242Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002382528]|Juvenile polyposis syndrome [RCV003763140] | Chr18:51058182 [GRCh38] Chr18:48584552 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1289dup (p.Tyr430Ter) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002383255] | Chr18:51067167..51067168 [GRCh38] Chr18:48593537..48593538 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.748C>G (p.Gln250Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002391549] | Chr18:51058205 [GRCh38] Chr18:48584575 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1634T>C (p.Ile545Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002401350]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007344] | Chr18:51078442 [GRCh38] Chr18:48604812 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1363C>G (p.Gln455Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002383542] | Chr18:51076692 [GRCh38] Chr18:48603062 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.572C>G (p.Ser191Trp) | single nucleotide variant | Juvenile polyposis syndrome [RCV002305243] | Chr18:51054898 [GRCh38] Chr18:48581268 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1645C>A (p.Gln549Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002394963] | Chr18:51078453 [GRCh38] Chr18:48604823 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.240G>A (p.Gly80=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002450322] | Chr18:51047286 [GRCh38] Chr18:48573656 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.643C>A (p.Pro215Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002361768] | Chr18:51054969 [GRCh38] Chr18:48581339 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1530A>T (p.Gly510=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002402958] | Chr18:51078338 [GRCh38] Chr18:48604708 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1569C>A (p.Cys523Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002405587] | Chr18:51078377 [GRCh38] Chr18:48604747 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.222A>G (p.Ile74Met) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002428209] | Chr18:51047268 [GRCh38] Chr18:48573638 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.447G>A (p.Gln149=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002328549] | Chr18:51049317 [GRCh38] Chr18:48575687 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1327T>G (p.Cys443Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV002297937] | Chr18:51076656 [GRCh38] Chr18:48603026 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1507_1508insATCC (p.Met503fs) | insertion | Familial thoracic aortic aneurysm and aortic dissection [RCV002390017] | Chr18:51078315..51078316 [GRCh38] Chr18:48604685..48604686 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1548G>A (p.Gln516=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002403300] | Chr18:51078356 [GRCh38] Chr18:48604726 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1004T>G (p.Val335Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002407588] | Chr18:51065471 [GRCh38] Chr18:48591841 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1410_1413dup (p.Pro472fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002389483] | Chr18:51076737..51076738 [GRCh38] Chr18:48603107..48603108 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.660T>A (p.Ala220=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002375866] | Chr18:51054986 [GRCh38] Chr18:48581356 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.581C>T (p.Thr194Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002353149] | Chr18:51054907 [GRCh38] Chr18:48581277 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1031G>A (p.Ser344Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002381193] | Chr18:51065498 [GRCh38] Chr18:48591868 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.857G>A (p.Gly286Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002447900] | Chr18:51058409 [GRCh38] Chr18:48584779 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-5T>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002431140] | Chr18:51048681 [GRCh38] Chr18:48575051 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+5_1308+11del | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002380993]|Juvenile polyposis syndrome [RCV003763146] | Chr18:51067191..51067197 [GRCh38] Chr18:48593561..48593567 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.210A>G (p.Lys70=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002424357]|Juvenile polyposis syndrome [RCV003775101] | Chr18:51047256 [GRCh38] Chr18:48573626 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1622A>T (p.His541Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002401084]|Juvenile polyposis syndrome [RCV003597444] | Chr18:51078430 [GRCh38] Chr18:48604800 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.633dup (p.Ala212fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002354038] | Chr18:51054958..51054959 [GRCh38] Chr18:48581328..48581329 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1372G>A (p.Ala458Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002294953] | Chr18:51076701 [GRCh38] Chr18:48603071 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.860_861insGATA (p.His287fs) | insertion | Familial thoracic aortic aneurysm and aortic dissection [RCV002447996] | Chr18:51058411..51058412 [GRCh38] Chr18:48584781..48584782 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.588C>G (p.Ser196Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002353566] | Chr18:51054914 [GRCh38] Chr18:48581284 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1305A>G (p.Ile435Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV002299012] | Chr18:51067184 [GRCh38] Chr18:48593554 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.263_287dup (p.Leu98fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002426471] | Chr18:51048698..51048699 [GRCh38] Chr18:48575068..48575069 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.320del (p.Asn107fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002445425] | Chr18:51048752 [GRCh38] Chr18:48575122 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1225G>A (p.Val409Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002364374] | Chr18:51067104 [GRCh38] Chr18:48593474 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.655G>A (p.Val219Met) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002364406]|Juvenile polyposis syndrome [RCV003763137] | Chr18:51054981 [GRCh38] Chr18:48581351 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.337_343del (p.Lys113fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002451744] | Chr18:51048771..51048777 [GRCh38] Chr18:48575141..48575147 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.897A>T (p.Gly299=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002376248] | Chr18:51058449 [GRCh38] Chr18:48584819 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.223C>T (p.Gln75Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002428351] | Chr18:51047269 [GRCh38] Chr18:48573639 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1158_1159insTG (p.Val387fs) | insertion | Familial thoracic aortic aneurysm and aortic dissection [RCV002355622] | Chr18:51067037..51067038 [GRCh38] Chr18:48593407..48593408 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1546C>T (p.Gln516Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002403263]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004059035] | Chr18:51078354 [GRCh38] Chr18:48604724 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.1366G>A (p.Ala456Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002383596]|Juvenile polyposis syndrome [RCV003774289] | Chr18:51076695 [GRCh38] Chr18:48603065 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1106A>T (p.Asn369Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002426297] | Chr18:51065573 [GRCh38] Chr18:48591943 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1491C>A (p.Arg497=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002389705]|Juvenile polyposis syndrome [RCV003095231] | Chr18:51078299 [GRCh38] Chr18:48604669 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.593C>A (p.Pro198Gln) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002355913] | Chr18:51054919 [GRCh38] Chr18:48581289 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.654T>C (p.Pro218=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002364370] | Chr18:51054980 [GRCh38] Chr18:48581350 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.214G>A (p.Val72Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558933]|Juvenile polyposis syndrome [RCV002301728] | Chr18:51047260 [GRCh38] Chr18:48573630 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.395A>T (p.His132Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002375445] | Chr18:51048831 [GRCh38] Chr18:48575201 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.407T>C (p.Val136Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002323110] | Chr18:51048843 [GRCh38] Chr18:48575213 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.267A>G (p.Gly89=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002428877] | Chr18:51048703 [GRCh38] Chr18:48575073 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1468A>G (p.Ile490Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002396866]|Juvenile polyposis syndrome [RCV003763153] | Chr18:51078276 [GRCh38] Chr18:48604646 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1599C>G (p.Leu533=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002398572]|Juvenile polyposis syndrome [RCV003100739]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007336] | Chr18:51078407 [GRCh38] Chr18:48604777 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.501G>A (p.Glu167=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002335558]|Juvenile polyposis syndrome [RCV003096569] | Chr18:51054827 [GRCh38] Chr18:48581197 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.917del (p.Asn306fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002450029] | Chr18:51059877 [GRCh38] Chr18:48586247 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1225G>T (p.Val409Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002364393] | Chr18:51067104 [GRCh38] Chr18:48593474 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.418G>A (p.Gly140Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002327771] | Chr18:51048854 [GRCh38] Chr18:48575224 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.455C>T (p.Ala152Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002340189] | Chr18:51054781 [GRCh38] Chr18:48581151 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.969G>A (p.Trp323Ter) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002376616] | Chr18:51065436 [GRCh38] Chr18:48591806 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1362A>G (p.Ala454=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002383512] | Chr18:51076691 [GRCh38] Chr18:48603061 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.274C>T (p.His92Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002439343] | Chr18:51048710 [GRCh38] Chr18:48575080 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.57T>G (p.Ile19Met) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002359882] | Chr18:51047103 [GRCh38] Chr18:48573473 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.915del (p.His305fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002378827] | Chr18:51059876 [GRCh38] Chr18:48586246 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1099C>T (p.Leu367Phe) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002450535] | Chr18:51065566 [GRCh38] Chr18:48591936 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1464T>A (p.Ala488=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002396795]|Juvenile polyposis syndrome [RCV003774344] | Chr18:51078272 [GRCh38] Chr18:48604642 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1592G>C (p.Arg531Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002398463] | Chr18:51078400 [GRCh38] Chr18:48604770 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1067C>T (p.Pro356Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002408174] | Chr18:51065534 [GRCh38] Chr18:48591904 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1473T>G (p.Gly491=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002396998]|Juvenile polyposis syndrome [RCV003597439] | Chr18:51078281 [GRCh38] Chr18:48604651 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.718A>T (p.Ile240Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002370772]|Juvenile polyposis syndrome [RCV003763139] | Chr18:51058175 [GRCh38] Chr18:48584545 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1290C>T (p.Tyr430=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002380529] | Chr18:51067169 [GRCh38] Chr18:48593539 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.139C>G (p.Leu47Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002389199] | Chr18:51047185 [GRCh38] Chr18:48573555 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.424+1G>T | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002328207] | Chr18:51048861 [GRCh38] Chr18:48575231 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1408C>T (p.Pro470Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002389430]|not provided [RCV003138244] | Chr18:51076737 [GRCh38] Chr18:48603107 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140G>T (p.Arg380Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002456912] | Chr18:51067019 [GRCh38] Chr18:48593389 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.973T>A (p.Ser325Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002298351] | Chr18:51065440 [GRCh38] Chr18:48591810 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.683T>C (p.Ile228Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002362064] | Chr18:51058140 [GRCh38] Chr18:48584510 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.430T>G (p.Ser144Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002331969] | Chr18:51049300 [GRCh38] Chr18:48575670 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1441G>C (p.Ala481Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002394370] | Chr18:51076770 [GRCh38] Chr18:48603140 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.14C>G (p.Ser5Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002389893] | Chr18:51047060 [GRCh38] Chr18:48573430 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.808G>A (p.Gly270Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558924]|not provided [RCV002300820] | Chr18:51058360 [GRCh38] Chr18:48584730 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.692del (p.Gly231fs) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002362388]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004052972] | Chr18:51058144 [GRCh38] Chr18:48584514 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.271C>A (p.Pro91Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002431257] | Chr18:51048707 [GRCh38] Chr18:48575077 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1093G>C (p.Gly365Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002448402] | Chr18:51065560 [GRCh38] Chr18:48591930 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.179C>A (p.Ala60Asp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002404270] | Chr18:51047225 [GRCh38] Chr18:48573595 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.462A>T (p.Ser154=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002342549] | Chr18:51054788 [GRCh38] Chr18:48581158 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1244A>G (p.Asp415Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002391471] | Chr18:51067123 [GRCh38] Chr18:48593493 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.590C>T (p.Thr197Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002355746] | Chr18:51054916 [GRCh38] Chr18:48581286 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1000C>G (p.Gln334Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002327988] | Chr18:51065467 [GRCh38] Chr18:48591837 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1135G>C (p.Ala379Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002445697] | Chr18:51065602 [GRCh38] Chr18:48591972 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.*10C>T | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002373460] | Chr18:51078477 [GRCh38] Chr18:48604847 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.879T>A (p.Pro293=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002373686] | Chr18:51058431 [GRCh38] Chr18:48584801 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1591C>G (p.Arg531Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV002301552] | Chr18:51078399 [GRCh38] Chr18:48604769 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.183A>T (p.Ile61=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002412793] | Chr18:51047229 [GRCh38] Chr18:48573599 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.883C>G (p.Pro295Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002373793] | Chr18:51058435 [GRCh38] Chr18:48584805 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.220A>G (p.Ile74Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002425832]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007407] | Chr18:51047266 [GRCh38] Chr18:48573636 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.479dup (p.Asp160fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002337853] | Chr18:51054804..51054805 [GRCh38] Chr18:48581174..48581175 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.478G>C (p.Asp160His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002337812] | Chr18:51054804 [GRCh38] Chr18:48581174 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1212C>A (p.Asp404Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV002294892] | Chr18:51067091 [GRCh38] Chr18:48593461 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1434A>T (p.Ile478=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002392136] | Chr18:51076763 [GRCh38] Chr18:48603133 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.497T>C (p.Phe166Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002342899] | Chr18:51054823 [GRCh38] Chr18:48581193 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1377T>G (p.Ala459=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002381082] | Chr18:51076706 [GRCh38] Chr18:48603076 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.25A>C (p.Thr9Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002426217] | Chr18:51047071 [GRCh38] Chr18:48573441 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.729G>T (p.Gly243=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002382740] | Chr18:51058186 [GRCh38] Chr18:48584556 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.950A>G (p.His317Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002374164] | Chr18:51059911 [GRCh38] Chr18:48586281 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1309-5A>T | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002381022]|Juvenile polyposis syndrome [RCV003763147] | Chr18:51076633 [GRCh38] Chr18:48603003 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1239_1242del (p.Tyr412_Tyr413insTer) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV002378398] | Chr18:51067116..51067119 [GRCh38] Chr18:48593486..48593489 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.959C>T (p.Pro320Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002374345] | Chr18:51065426 [GRCh38] Chr18:48591796 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.400G>C (p.Glu134Gln) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002357846] | Chr18:51048836 [GRCh38] Chr18:48575206 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1147A>G (p.Ile383Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002460264] | Chr18:51067026 [GRCh38] Chr18:48593396 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.584dup (p.Tyr195Ter) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV002353334]|Juvenile polyposis syndrome [RCV003096895] | Chr18:51054909..51054910 [GRCh38] Chr18:48581279..48581280 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.961G>A (p.Glu321Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002382518]|Juvenile polyposis syndrome [RCV002305083] | Chr18:51065428 [GRCh38] Chr18:48591798 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1387G>A (p.Ala463Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002396573] | Chr18:51076716 [GRCh38] Chr18:48603086 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1379C>T (p.Ala460Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002381113] | Chr18:51076708 [GRCh38] Chr18:48603078 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.77A>G (p.His26Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002409895] | Chr18:51047123 [GRCh38] Chr18:48573493 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.239G>A (p.Gly80Glu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002450238] | Chr18:51047285 [GRCh38] Chr18:48573655 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1396G>T (p.Ala466Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV002389129] | Chr18:51076725 [GRCh38] Chr18:48603095 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1448-11T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002881387] | Chr18:51078245 [GRCh38] Chr18:48604615 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.424+13T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003014551] | Chr18:51048873 [GRCh38] Chr18:48575243 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.392A>G (p.Tyr131Cys) | single nucleotide variant | not provided [RCV002511896] | Chr18:51048828 [GRCh38] Chr18:48575198 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1480G>T (p.Asp494Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003014395] | Chr18:51078288 [GRCh38] Chr18:48604658 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-16_1140-15del | deletion | Juvenile polyposis syndrome [RCV002862272] | Chr18:51067002..51067003 [GRCh38] Chr18:48593372..48593373 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+10C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV003015884] | Chr18:51076786 [GRCh38] Chr18:48603156 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-18G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003017635] | Chr18:51054763 [GRCh38] Chr18:48581133 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1572G>T (p.Trp524Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV003076990] | Chr18:51078380 [GRCh38] Chr18:48604750 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1401A>G (p.Gly467=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003014143] | Chr18:51076730 [GRCh38] Chr18:48603100 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1356T>C (p.Ala452=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002866099] | Chr18:51076685 [GRCh38] Chr18:48603055 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1371A>T (p.Ala457=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003077026] | Chr18:51076700 [GRCh38] Chr18:48603070 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-2A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002842558] | Chr18:51078254 [GRCh38] Chr18:48604624 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.856G>T (p.Gly286Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV002971892] | Chr18:51058408 [GRCh38] Chr18:48584778 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+14T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002838710] | Chr18:51055007 [GRCh38] Chr18:48581377 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.393T>C (p.Tyr131=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559981]|Juvenile polyposis syndrome [RCV002880753] | Chr18:51048829 [GRCh38] Chr18:48575199 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1302T>C (p.Tyr434=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003015715] | Chr18:51067181 [GRCh38] Chr18:48593551 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+20C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003032693] | Chr18:51049344 [GRCh38] Chr18:48575714 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-6del | deletion | Juvenile polyposis syndrome [RCV002819459] | Chr18:51058118 [GRCh38] Chr18:48584488 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+12G>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003075699] | Chr18:51049336 [GRCh38] Chr18:48575706 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.476A>T (p.Lys159Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV002685727] | Chr18:51054802 [GRCh38] Chr18:48581172 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+19T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002995444] | Chr18:51055012 [GRCh38] Chr18:48581382 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.130G>T (p.Val44Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV003053482] | Chr18:51047176 [GRCh38] Chr18:48573546 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.139C>T (p.Leu47=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002638360] | Chr18:51047185 [GRCh38] Chr18:48573555 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1420T>A (p.Ser474Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003054921] | Chr18:51076749 [GRCh38] Chr18:48603119 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.358G>A (p.Asp120Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV002825305] | Chr18:51048794 [GRCh38] Chr18:48575164 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(48556994_48573289)_48573471dup | duplication | Juvenile polyposis syndrome [RCV002510378] | Chr18:48573289..48573471 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.527G>T (p.Gly176Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004560002]|Juvenile polyposis syndrome [RCV003018508] | Chr18:51054853 [GRCh38] Chr18:48581223 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.454G>A (p.Ala152Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV002619088] | Chr18:51049324 [GRCh38] Chr18:48575694 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1058A>T (p.Tyr353Phe) | single nucleotide variant | Juvenile polyposis syndrome [RCV002885320] | Chr18:51065525 [GRCh38] Chr18:48591895 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.170_173del (p.Ser56_Leu57insTer) | deletion | Juvenile polyposis syndrome [RCV003038895] | Chr18:51047215..51047218 [GRCh38] Chr18:48573585..48573588 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.454+19A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002909428] | Chr18:51049343 [GRCh38] Chr18:48575713 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.249+10A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002949552] | Chr18:51047305 [GRCh38] Chr18:48573675 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.44C>T (p.Ala15Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV002975984] | Chr18:51047090 [GRCh38] Chr18:48573460 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1171T>C (p.Cys391Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004560057]|Juvenile polyposis syndrome [RCV002636698] | Chr18:51067050 [GRCh38] Chr18:48593420 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.33A>C (p.Thr11=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003019140] | Chr18:51047079 [GRCh38] Chr18:48573449 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.250-5del | deletion | Juvenile polyposis syndrome [RCV003054249] | Chr18:51048677 [GRCh38] Chr18:48575047 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.495C>T (p.Asp165=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003054007] | Chr18:51054821 [GRCh38] Chr18:48581191 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.4G>C (p.Asp2His) | single nucleotide variant | Juvenile polyposis syndrome [RCV003021179] | Chr18:51047050 [GRCh38] Chr18:48573420 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1010del (p.Glu337fs) | deletion | Juvenile polyposis syndrome [RCV002797085] | Chr18:51065477 [GRCh38] Chr18:48591847 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.51G>A (p.Leu17=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002885042] | Chr18:51047097 [GRCh38] Chr18:48573467 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1470del (p.Ile490fs) | deletion | Juvenile polyposis syndrome [RCV002846551] | Chr18:51078277 [GRCh38] Chr18:48604647 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.803G>A (p.Trp268Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV002889248] | Chr18:51058355 [GRCh38] Chr18:48584725 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.534A>G (p.Ser178=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003006204] | Chr18:51054860 [GRCh38] Chr18:48581230 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.137_155del (p.Lys46fs) | deletion | Juvenile polyposis syndrome [RCV003008352] | Chr18:51047178..51047196 [GRCh38] Chr18:48573548..48573566 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.425-12T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003085716] | Chr18:51049283 [GRCh38] Chr18:48575653 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1506G>A (p.Arg502=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002875999] | Chr18:51078314 [GRCh38] Chr18:48604684 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-8C>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002790801] | Chr18:51054773 [GRCh38] Chr18:48581143 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.406G>A (p.Val136Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV002928944] | Chr18:51048842 [GRCh38] Chr18:48575212 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+17T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV002872392] | Chr18:51067204 [GRCh38] Chr18:48593574 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.522T>C (p.Thr174=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003022955]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004009263] | Chr18:51054848 [GRCh38] Chr18:48581218 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1257G>T (p.Gly419=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003057751] | Chr18:51067136 [GRCh38] Chr18:48593506 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1586T>G (p.Leu529Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV003024690] | Chr18:51078394 [GRCh38] Chr18:48604764 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.589A>T (p.Thr197Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV002982369] | Chr18:51054915 [GRCh38] Chr18:48581285 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.33A>T (p.Thr11=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003024919] | Chr18:51047079 [GRCh38] Chr18:48573449 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.424+10C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002711344] | Chr18:51048870 [GRCh38] Chr18:48575240 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.270T>C (p.Phe90=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002876122] | Chr18:51048706 [GRCh38] Chr18:48575076 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.477G>A (p.Lys159=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002850933] | Chr18:51054803 [GRCh38] Chr18:48581173 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.420A>G (p.Gly140=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003024463] | Chr18:51048856 [GRCh38] Chr18:48575226 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.249+10dup | duplication | Juvenile polyposis syndrome [RCV002805294] | Chr18:51047304..51047305 [GRCh38] Chr18:48573674..48573675 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.617C>G (p.Ser206Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV002700384]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007547] | Chr18:51054943 [GRCh38] Chr18:48581313 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1537T>A (p.Tyr513Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV003059319] | Chr18:51078345 [GRCh38] Chr18:48604715 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+16A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003086219] | Chr18:51067203 [GRCh38] Chr18:48593573 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.793A>C (p.Thr265Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV003010276] | Chr18:51058345 [GRCh38] Chr18:48584715 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.386A>G (p.Asn129Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV002938424] | Chr18:51048822 [GRCh38] Chr18:48575192 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1650T>C (p.Pro550=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003065949] | Chr18:51078458 [GRCh38] Chr18:48604828 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.2T>C (p.Met1Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004560050]|Juvenile polyposis syndrome [RCV002599165] | Chr18:51047048 [GRCh38] Chr18:48573418 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.822A>G (p.Ala274=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003030826] | Chr18:51058374 [GRCh38] Chr18:48584744 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1260T>C (p.Arg420=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003047969] | Chr18:51067139 [GRCh38] Chr18:48593509 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+18T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003011527] | Chr18:51067205 [GRCh38] Chr18:48593575 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.850C>T (p.Gln284Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV002899128] | Chr18:51058402 [GRCh38] Chr18:48584772 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1448-15A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003088361] | Chr18:51078241 [GRCh38] Chr18:48604611 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-14T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003086201] | Chr18:51058111 [GRCh38] Chr18:48584481 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.292C>G (p.Leu98Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV002647897] | Chr18:51048728 [GRCh38] Chr18:48575098 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.456T>C (p.Ala152=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002856790] | Chr18:51054782 [GRCh38] Chr18:48581152 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1204C>A (p.Leu402Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV003045407] | Chr18:51067083 [GRCh38] Chr18:48593453 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.778_779dup (p.His261fs) | duplication | Juvenile polyposis syndrome [RCV003029486] | Chr18:51058234..51058235 [GRCh38] Chr18:48584604..48584605 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1357A>G (p.Thr453Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV003027962] | Chr18:51076686 [GRCh38] Chr18:48603056 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1425A>G (p.Val475=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002720416] | Chr18:51076754 [GRCh38] Chr18:48603124 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1311C>T (p.Val437=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002601716]|not specified [RCV003493965] | Chr18:51076640 [GRCh38] Chr18:48603010 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.894C>G (p.Pro298=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003048002] | Chr18:51058446 [GRCh38] Chr18:48584816 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.250-18G>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002834579] | Chr18:51048668 [GRCh38] Chr18:48575038 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.432A>G (p.Ser144=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002811704] | Chr18:51049302 [GRCh38] Chr18:48575672 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.340T>G (p.Tyr114Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV003046121] | Chr18:51048776 [GRCh38] Chr18:48575146 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.425-18C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002962343] | Chr18:51049277 [GRCh38] Chr18:48575647 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+6T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003046707] | Chr18:51054999 [GRCh38] Chr18:48581369 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.156T>G (p.Asp52Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV003044668] | Chr18:51047202 [GRCh38] Chr18:48573572 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.425-9A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003044912] | Chr18:51049286 [GRCh38] Chr18:48575656 [GRCh37] Chr18:18q21.2 |
pathogenic|uncertain significance |
NM_005359.6(SMAD4):c.766C>T (p.Gln256Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV003030166] | Chr18:51058223 [GRCh38] Chr18:48584593 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1063G>A (p.Asp355Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV003026318] | Chr18:51065530 [GRCh38] Chr18:48591900 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.424+9A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003064136] | Chr18:51048869 [GRCh38] Chr18:48575239 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.729G>A (p.Gly243=) | single nucleotide variant | Juvenile polyposis syndrome [RCV002877422] | Chr18:51058186 [GRCh38] Chr18:48584556 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+16A>T | single nucleotide variant | Juvenile polyposis syndrome [RCV003051863] | Chr18:51067203 [GRCh38] Chr18:48593573 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.454+15T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002653182] | Chr18:51049339 [GRCh38] Chr18:48575709 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1309-17A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003093629] | Chr18:51076621 [GRCh38] Chr18:48602991 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.391dup (p.Tyr131fs) | duplication | Juvenile polyposis syndrome [RCV002942209] | Chr18:51048826..51048827 [GRCh38] Chr18:48575196..48575197 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.955+6T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002942889]|not specified [RCV003988038] | Chr18:51059922 [GRCh38] Chr18:48586292 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.455-19T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV002603220] | Chr18:51054762 [GRCh38] Chr18:48581132 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1139+14A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003069292] | Chr18:51065620 [GRCh38] Chr18:48591990 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+20G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003071746] | Chr18:51058476 [GRCh38] Chr18:48584846 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.668-13_668-11del | microsatellite | Hereditary cancer-predisposing syndrome [RCV003585346]|Juvenile polyposis syndrome [RCV003070754] | Chr18:51058108..51058110 [GRCh38] Chr18:48584478..48584480 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.905-11C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003070777] | Chr18:51059855 [GRCh38] Chr18:48586225 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.117A>G (p.Ala39=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585351]|Juvenile polyposis syndrome [RCV003073212] | Chr18:51047163 [GRCh38] Chr18:48573533 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.453T>A (p.Asn151Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV002654410] | Chr18:51049323 [GRCh38] Chr18:48575693 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.847C>T (p.His283Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003072231] | Chr18:51058399 [GRCh38] Chr18:48584769 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.517T>G (p.Ser173Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV002653902] | Chr18:51054843 [GRCh38] Chr18:48581213 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+12A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002612041] | Chr18:51047307 [GRCh38] Chr18:48573677 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.892C>T (p.Pro298Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV003049539] | Chr18:51058444 [GRCh38] Chr18:48584814 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.249+16G>T | single nucleotide variant | Juvenile polyposis syndrome [RCV002943360] | Chr18:51047311 [GRCh38] Chr18:48573681 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+11A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV002943459] | Chr18:51067198 [GRCh38] Chr18:48593568 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1012A>G (p.Thr338Ala) | single nucleotide variant | not provided [RCV003228333] | Chr18:51065479 [GRCh38] Chr18:48591849 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.864T>C (p.Leu288=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003165094] | Chr18:51058416 [GRCh38] Chr18:48584786 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1233_1249del (p.Ser411fs) | deletion | Gastric cancer [RCV003164697] | Chr18:51067106..51067122 [GRCh38] Chr18:48593476..48593492 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1544G>A (p.Arg515Lys) | single nucleotide variant | not provided [RCV003225568] | Chr18:51078352 [GRCh38] Chr18:48604722 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1453T>C (p.Ser485Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172601] | Chr18:51078261 [GRCh38] Chr18:48604631 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-5del | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV003172602] | Chr18:51067013 [GRCh38] Chr18:48593383 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.107C>T (p.Ala36Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172603] | Chr18:51047153 [GRCh38] Chr18:48573523 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.835A>T (p.Asn279Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172604] | Chr18:51058387 [GRCh38] Chr18:48584757 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1278T>C (p.Val426=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172605] | Chr18:51067157 [GRCh38] Chr18:48593527 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1566T>A (p.Pro522=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172606] | Chr18:51078374 [GRCh38] Chr18:48604744 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-15A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172612] | Chr18:51078241 [GRCh38] Chr18:48604611 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1104C>G (p.Ser368=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172613] | Chr18:51065571 [GRCh38] Chr18:48591941 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.965A>G (p.Tyr322Cys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172615] | Chr18:51065432 [GRCh38] Chr18:48591802 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.549G>A (p.Gln183=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172616] | Chr18:51054875 [GRCh38] Chr18:48581245 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1014A>T (p.Thr338=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172618]|Juvenile polyposis syndrome [RCV003761632] | Chr18:51065481 [GRCh38] Chr18:48591851 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.667+1G>C | single nucleotide variant | Gastric cancer [RCV003164589] | Chr18:51054994 [GRCh38] Chr18:48581364 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.250G>T (p.Val84Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172607] | Chr18:51048686 [GRCh38] Chr18:48575056 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.168T>C (p.Ser56=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172608] | Chr18:51047214 [GRCh38] Chr18:48573584 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1632G>T (p.Pro544=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172609]|Juvenile polyposis syndrome [RCV003761631] | Chr18:51078440 [GRCh38] Chr18:48604810 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.727G>A (p.Gly243Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172610] | Chr18:51058184 [GRCh38] Chr18:48584554 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.858C>A (p.Gly286=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172611]|Juvenile polyposis syndrome [RCV003596235] | Chr18:51058410 [GRCh38] Chr18:48584780 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.*1837C>T | single nucleotide variant | Myhre syndrome [RCV003142290] | Chr18:51080304 [GRCh38] Chr18:48606674 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1551C>T (p.Ser517=) | single nucleotide variant | Breast-ovarian cancer, familial, susceptibility to, 2 [RCV003142396] | Chr18:51078359 [GRCh38] Chr18:48604729 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1349A>G (p.Gln450Arg) | single nucleotide variant | Colorectal cancer, hereditary nonpolyposis, type 2 [RCV003142398] | Chr18:51076678 [GRCh38] Chr18:48603048 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1552dup (p.Ile518fs) | duplication | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003140325] | Chr18:51078359..51078360 [GRCh38] Chr18:48604729..48604730 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.332A>T (p.His111Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003164838]|not provided [RCV003136866] | Chr18:51048768 [GRCh38] Chr18:48575138 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.513_514del (p.Leu172fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003140393] | Chr18:51054839..51054840 [GRCh38] Chr18:48581209..48581210 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.794dup (p.Thr266fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV003172600] | Chr18:51058345..51058346 [GRCh38] Chr18:48584715..48584716 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.710T>C (p.Leu237Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV003172614]|Juvenile polyposis syndrome [RCV003596236] | Chr18:51058167 [GRCh38] Chr18:48584537 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-41C>T | single nucleotide variant | not specified [RCV003321989] | Chr18:51048645 [GRCh38] Chr18:48575015 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+37T>G | single nucleotide variant | not specified [RCV003322386] | Chr18:51058493 [GRCh38] Chr18:48584863 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904+36_904+37insAT | insertion | not specified [RCV003322385] | Chr18:51058491..51058492 [GRCh38] Chr18:48584861..48584862 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1529dup (p.Pro511fs) | duplication | not provided [RCV003322388] | Chr18:51078333..51078334 [GRCh38] Chr18:48604703..48604704 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1140-26A>C | single nucleotide variant | not specified [RCV003322387] | Chr18:51066993 [GRCh38] Chr18:48593363 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.250-42G>T | single nucleotide variant | not specified [RCV003321988] | Chr18:51048644 [GRCh38] Chr18:48575014 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.934C>A (p.Pro312Thr) | single nucleotide variant | not provided [RCV003318969] | Chr18:51059895 [GRCh38] Chr18:48586265 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668-26A>G | single nucleotide variant | not specified [RCV003322384] | Chr18:51058099 [GRCh38] Chr18:48584469 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1066C>T (p.Pro356Ser) | single nucleotide variant | SMAD4-related disorder [RCV003397394] | Chr18:51065533 [GRCh38] Chr18:48591903 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1058_1061del (p.Tyr353fs) | deletion | Juvenile polyposis syndrome [RCV003334438] | Chr18:51065524..51065527 [GRCh38] Chr18:48591894..48591897 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.875del (p.Pro292fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003455813]|Myhre syndrome [RCV003387574] | Chr18:51058425 [GRCh38] Chr18:48584795 [GRCh37] Chr18:18q21.2 |
pathogenic|likely pathogenic |
NM_005359.6(SMAD4):c.455-2A>T | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003463548] | Chr18:51054779 [GRCh38] Chr18:48581149 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1515dup (p.Val506fs) | duplication | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003463549] | Chr18:51078319..51078320 [GRCh38] Chr18:48604689..48604690 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.699dup (p.Ser234Ter) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV004560173]|Juvenile polyposis syndrome [RCV003596249]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003452620] | Chr18:51058155..51058156 [GRCh38] Chr18:48584525..48584526 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.801C>G (p.Thr267=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003875285] | Chr18:51058353 [GRCh38] Chr18:48584723 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.31A>C (p.Thr11Pro) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474041] | Chr18:51047077 [GRCh38] Chr18:48573447 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1631C>T (p.Pro544Leu) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474039] | Chr18:51078439 [GRCh38] Chr18:48604809 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.592C>G (p.Pro198Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004560189]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003474040] | Chr18:51054918 [GRCh38] Chr18:48581288 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.931C>G (p.Gln311Glu) | single nucleotide variant | SMAD4-related disorder [RCV003404176] | Chr18:51059892 [GRCh38] Chr18:48586262 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.788-16G>A | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV003463547] | Chr18:51058324 [GRCh38] Chr18:48584694 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.106G>T (p.Ala36Ser) | single nucleotide variant | SMAD4-related disorder [RCV003410550] | Chr18:51047152 [GRCh38] Chr18:48573522 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.487G>T (p.Val163Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596246]|SMAD4-related disorder [RCV003400241] | Chr18:51054813 [GRCh38] Chr18:48581183 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1504A>C (p.Arg502=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003829078] | Chr18:51078312 [GRCh38] Chr18:48604682 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.663C>T (p.Ser221=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559044]|Juvenile polyposis syndrome [RCV003882690] | Chr18:51054989 [GRCh38] Chr18:48581359 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.460T>C (p.Ser154Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV003830913] | Chr18:51054786 [GRCh38] Chr18:48581156 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1450C>G (p.Leu484Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV003827698] | Chr18:51078258 [GRCh38] Chr18:48604628 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.72G>A (p.Met24Ile) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585811]|Juvenile polyposis syndrome [RCV003761686] | Chr18:51047118 [GRCh38] Chr18:48573488 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.260G>A (p.Arg87Gln) | single nucleotide variant | Juvenile polyposis syndrome [RCV003825752] | Chr18:51048696 [GRCh38] Chr18:48575066 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+30A>G | single nucleotide variant | not specified [RCV003494224] | Chr18:51055023 [GRCh38] Chr18:48581393 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.849C>G (p.His283Gln) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597023] | Chr18:51058401 [GRCh38] Chr18:48584771 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.888C>A (p.Pro296=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597035] | Chr18:51058440 [GRCh38] Chr18:48584810 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.79A>G (p.Arg27Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597045] | Chr18:51047125 [GRCh38] Chr18:48573495 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.687G>T (p.Leu229=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558179]|Juvenile polyposis syndrome [RCV003762413] | Chr18:51058144 [GRCh38] Chr18:48584514 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.904T>A (p.Trp302Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597102] | Chr18:51058456 [GRCh38] Chr18:48584826 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.208_215del (p.Lys70fs) | deletion | Juvenile polyposis syndrome [RCV003597155] | Chr18:51047252..51047259 [GRCh38] Chr18:48573622..48573629 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.454+9T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003762398] | Chr18:51049333 [GRCh38] Chr18:48575703 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.96T>C (p.Ser32=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762535] | Chr18:51047142 [GRCh38] Chr18:48573512 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.898C>G (p.His300Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597149] | Chr18:51058450 [GRCh38] Chr18:48584820 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.401A>G (p.Glu134Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597186] | Chr18:51048837 [GRCh38] Chr18:48575207 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.703G>A (p.Glu235Lys) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597187] | Chr18:51058160 [GRCh38] Chr18:48584530 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.424+2T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003762576] | Chr18:51048862 [GRCh38] Chr18:48575232 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1036C>A (p.Pro346Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762539] | Chr18:51065503 [GRCh38] Chr18:48591873 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.121G>T (p.Glu41Ter) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762642] | Chr18:51047167 [GRCh38] Chr18:48573537 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1309-14T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003762623] | Chr18:51076624 [GRCh38] Chr18:48602994 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.885G>C (p.Pro295=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762629] | Chr18:51058437 [GRCh38] Chr18:48584807 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.938C>A (p.Pro313His) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762719] | Chr18:51059899 [GRCh38] Chr18:48586269 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1583A>G (p.His528Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763335] | Chr18:51078391 [GRCh38] Chr18:48604761 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.665C>T (p.Thr222Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763303] | Chr18:51054991 [GRCh38] Chr18:48581361 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.354G>T (p.Ala118=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763350] | Chr18:51048790 [GRCh38] Chr18:48575160 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.428T>C (p.Leu143Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763341] | Chr18:51049298 [GRCh38] Chr18:48575668 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.936_939del (p.Pro313fs) | deletion | Juvenile polyposis syndrome [RCV003763398] | Chr18:51059895..51059898 [GRCh38] Chr18:48586265..48586268 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.166T>G (p.Ser56Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763422] | Chr18:51047212 [GRCh38] Chr18:48573582 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1498A>C (p.Ile500Leu) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763558] | Chr18:51078306 [GRCh38] Chr18:48604676 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1262C>T (p.Ala421Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596316] | Chr18:51067141 [GRCh38] Chr18:48593511 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1599C>T (p.Leu533=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596396] | Chr18:51078407 [GRCh38] Chr18:48604777 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1630C>T (p.Pro544Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596397]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004574066] | Chr18:51078438 [GRCh38] Chr18:48604808 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1127T>C (p.Ile376Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596391] | Chr18:51065594 [GRCh38] Chr18:48591964 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1649C>T (p.Pro550Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558145]|Juvenile polyposis syndrome [RCV003596758] | Chr18:51078457 [GRCh38] Chr18:48604827 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1563A>T (p.Thr521=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763735] | Chr18:51078371 [GRCh38] Chr18:48604741 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.905-14T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003596721] | Chr18:51059852 [GRCh38] Chr18:48586222 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1300T>A (p.Tyr434Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596759] | Chr18:51067179 [GRCh38] Chr18:48593549 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.5A>C (p.Asp2Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV003761730]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004011651] | Chr18:51047051 [GRCh38] Chr18:48573421 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.558A>G (p.Pro186=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596890] | Chr18:51054884 [GRCh38] Chr18:48581254 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.883C>A (p.Pro295Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596869] | Chr18:51058435 [GRCh38] Chr18:48584805 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.668-13C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003762354] | Chr18:51058112 [GRCh38] Chr18:48584482 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+14T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003762367] | Chr18:51076790 [GRCh38] Chr18:48603160 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.956-15A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003764350] | Chr18:51065408 [GRCh38] Chr18:48591778 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.243G>A (p.Arg81=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596987] | Chr18:51047289 [GRCh38] Chr18:48573659 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1264C>T (p.Pro422Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762488] | Chr18:51067143 [GRCh38] Chr18:48593513 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1585_1590del (p.Leu529_His530del) | deletion | Juvenile polyposis syndrome [RCV003596362] | Chr18:51078390..51078395 [GRCh38] Chr18:48604760..48604765 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.454+11T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003596364] | Chr18:51049335 [GRCh38] Chr18:48575705 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.569C>G (p.Ala190Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596365] | Chr18:51054895 [GRCh38] Chr18:48581265 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+8T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003596372] | Chr18:51076784 [GRCh38] Chr18:48603154 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.86G>A (p.Gly29Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596373] | Chr18:51047132 [GRCh38] Chr18:48573502 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1139+13T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003596389] | Chr18:51065619 [GRCh38] Chr18:48591989 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.326_331del (p.Leu109_Lys110del) | deletion | Juvenile polyposis syndrome [RCV003597111] | Chr18:51048759..51048764 [GRCh38] Chr18:48575129..48575134 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.819dup (p.Ala274fs) | duplication | Juvenile polyposis syndrome [RCV003762563] | Chr18:51058370..51058371 [GRCh38] Chr18:48584740..48584741 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.916A>C (p.Asn306His) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597169] | Chr18:51059877 [GRCh38] Chr18:48586247 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.425-16C>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003596369] | Chr18:51049279 [GRCh38] Chr18:48575649 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.598C>G (p.Leu200Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558191]|Juvenile polyposis syndrome [RCV003762612] | Chr18:51054924 [GRCh38] Chr18:48581294 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.906G>C (p.Trp302Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762653] | Chr18:51059867 [GRCh38] Chr18:48586237 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.425-19T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003763651] | Chr18:51049276 [GRCh38] Chr18:48575646 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.425-7A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003596731] | Chr18:51049288 [GRCh38] Chr18:48575658 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.504A>T (p.Gly168=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003817161] | Chr18:51054830 [GRCh38] Chr18:48581200 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1346A>G (p.Gln449Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558168]|Juvenile polyposis syndrome [RCV003761694] | Chr18:51076675 [GRCh38] Chr18:48603045 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.588C>T (p.Ser196=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558171]|Juvenile polyposis syndrome [RCV003761709] | Chr18:51054914 [GRCh38] Chr18:48581284 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.959C>G (p.Pro320Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596817] | Chr18:51065426 [GRCh38] Chr18:48591796 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.853A>G (p.Asn285Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596864] | Chr18:51058405 [GRCh38] Chr18:48584775 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1296T>C (p.Ser432=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596868] | Chr18:51067175 [GRCh38] Chr18:48593545 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-10T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003596899] | Chr18:51054771 [GRCh38] Chr18:48581141 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1011G>A (p.Glu337=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596877] | Chr18:51065478 [GRCh38] Chr18:48591848 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1309-2del | deletion | Juvenile polyposis syndrome [RCV003763400] | Chr18:51076633 [GRCh38] Chr18:48603003 [GRCh37] Chr18:18q21.2 |
benign |
NM_005359.6(SMAD4):c.904+16_904+61del | deletion | Juvenile polyposis syndrome [RCV003763401] | Chr18:51058465..51058510 [GRCh38] Chr18:48584835..48584880 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1628T>C (p.Met543Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763358] | Chr18:51078436 [GRCh38] Chr18:48604806 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.956-14T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003764351] | Chr18:51065409 [GRCh38] Chr18:48591779 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1001A>G (p.Gln334Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597010] | Chr18:51065468 [GRCh38] Chr18:48591838 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-13A>G | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585807] | Chr18:51047034 [GRCh38] Chr18:48573404 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.383_384del (p.Val128fs) | microsatellite | Hereditary cancer-predisposing syndrome [RCV003585812] | Chr18:51048815..51048816 [GRCh38] Chr18:48575185..48575186 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.740G>T (p.Gly247Val) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585814] | Chr18:51058197 [GRCh38] Chr18:48584567 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.907C>A (p.Pro303Thr) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585816] | Chr18:51059868 [GRCh38] Chr18:48586238 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.779A>G (p.Tyr260Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762364] | Chr18:51058236 [GRCh38] Chr18:48584606 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-19T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003762394] | Chr18:51048667 [GRCh38] Chr18:48575037 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1542A>G (p.Pro514=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585821] | Chr18:51078350 [GRCh38] Chr18:48604720 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1646A>C (p.Gln549Pro) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585822] | Chr18:51078454 [GRCh38] Chr18:48604824 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-13T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003762481] | Chr18:51067006 [GRCh38] Chr18:48593376 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.43G>T (p.Ala15Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV003764360] | Chr18:51047089 [GRCh38] Chr18:48573459 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.889C>A (p.His297Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596273] | Chr18:51058441 [GRCh38] Chr18:48584811 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+13T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003764436] | Chr18:51076789 [GRCh38] Chr18:48603159 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.321T>C (p.Asn107=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597069] | Chr18:51048757 [GRCh38] Chr18:48575127 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1165T>C (p.Leu389=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003855079] | Chr18:51067044 [GRCh38] Chr18:48593414 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.508C>T (p.Pro170Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV003840193] | Chr18:51054834 [GRCh38] Chr18:48581204 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.860dup (p.His287fs) | duplication | Juvenile polyposis syndrome [RCV003763278] | Chr18:51058411..51058412 [GRCh38] Chr18:48584781..48584782 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.363A>G (p.Leu121=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763286] | Chr18:51048799 [GRCh38] Chr18:48575169 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.700dup (p.Ser234fs) | duplication | Juvenile polyposis syndrome [RCV003763411] | Chr18:51058156..51058157 [GRCh38] Chr18:48584526..48584527 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.653C>G (p.Pro218Arg) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763407] | Chr18:51054979 [GRCh38] Chr18:48581349 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.212G>A (p.Cys71Tyr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596265] | Chr18:51047258 [GRCh38] Chr18:48573628 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1564C>A (p.Pro522Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596295] | Chr18:51078372 [GRCh38] Chr18:48604742 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1278del (p.His427fs) | deletion | Juvenile polyposis syndrome [RCV003596307] | Chr18:51067156 [GRCh38] Chr18:48593526 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.905-11C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV003763521] | Chr18:51059855 [GRCh38] Chr18:48586225 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.455-7T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003596368] | Chr18:51054774 [GRCh38] Chr18:48581144 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.485A>G (p.Tyr162Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596921] | Chr18:51054811 [GRCh38] Chr18:48581181 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1398A>C (p.Ala466=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596982] | Chr18:51076727 [GRCh38] Chr18:48603097 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.613G>C (p.Glu205Gln) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596969] | Chr18:51054939 [GRCh38] Chr18:48581309 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1139+9T>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003597028] | Chr18:51065615 [GRCh38] Chr18:48591985 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.419G>C (p.Gly140Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597043] | Chr18:51048855 [GRCh38] Chr18:48575225 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.788A>G (p.Asn263Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597091] | Chr18:51058340 [GRCh38] Chr18:48584710 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.693C>A (p.Gly231=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762434]|not provided [RCV003885360] | Chr18:51058150 [GRCh38] Chr18:48584520 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.323A>G (p.Glu108Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762451] | Chr18:51048759 [GRCh38] Chr18:48575129 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.472_516del (p.Val158_Leu172del) | deletion | Juvenile polyposis syndrome [RCV003597192] | Chr18:51054796..51054840 [GRCh38] Chr18:48581166..48581210 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.250-1G>T | single nucleotide variant | Juvenile polyposis syndrome [RCV003762505] | Chr18:51048685 [GRCh38] Chr18:48575055 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.402A>C (p.Glu134Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762523] | Chr18:51048838 [GRCh38] Chr18:48575208 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.541A>C (p.Thr181Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762592] | Chr18:51054867 [GRCh38] Chr18:48581237 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.895_896del (p.Gly299fs) | deletion | Juvenile polyposis syndrome [RCV003762651] | Chr18:51058447..51058448 [GRCh38] Chr18:48584817..48584818 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.-10A>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585808] | Chr18:51047037 [GRCh38] Chr18:48573407 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-3C>T | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585809] | Chr18:51047044 [GRCh38] Chr18:48573414 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-1A>C | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585810] | Chr18:51047046 [GRCh38] Chr18:48573416 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.577G>C (p.Glu193Gln) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585813] | Chr18:51054903 [GRCh38] Chr18:48581273 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.887C>G (p.Pro296Arg) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585815] | Chr18:51058439 [GRCh38] Chr18:48584809 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1047T>A (p.Thr349=) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585817] | Chr18:51065514 [GRCh38] Chr18:48591884 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1166T>C (p.Leu389Ser) | single nucleotide variant | Hereditary cancer-predisposing syndrome [RCV003585819] | Chr18:51067045 [GRCh38] Chr18:48593415 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1463C>T (p.Ala488Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558167]|Hereditary cancer-predisposing syndrome [RCV003585820] | Chr18:51078271 [GRCh38] Chr18:48604641 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+17_667+114del | deletion | Juvenile polyposis syndrome [RCV003596991] | Chr18:51055010..51055107 [GRCh38] Chr18:48581380..48581477 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.487G>A (p.Val163Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597077] | Chr18:51054813 [GRCh38] Chr18:48581183 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.455-18G>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003596357] | Chr18:51054763 [GRCh38] Chr18:48581133 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1287del (p.Tyr430fs) | deletion | Juvenile polyposis syndrome [RCV003762508] | Chr18:51067166 [GRCh38] Chr18:48593536 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.424+9A>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003597163] | Chr18:51048869 [GRCh38] Chr18:48575239 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-12C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003596742] | Chr18:51078244 [GRCh38] Chr18:48604614 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1041T>C (p.Ile347=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596468] | Chr18:51065508 [GRCh38] Chr18:48591878 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1123G>A (p.Ala375Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596861] | Chr18:51065590 [GRCh38] Chr18:48591960 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1049T>C (p.Val350Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596918] | Chr18:51065516 [GRCh38] Chr18:48591886 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1091T>C (p.Leu364Ser) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596920] | Chr18:51065558 [GRCh38] Chr18:48591928 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.859C>A (p.His287Asn) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596904] | Chr18:51058411 [GRCh38] Chr18:48584781 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+18T>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003763305] | Chr18:51076794 [GRCh38] Chr18:48603164 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-25_1448-18del | deletion | Juvenile polyposis syndrome [RCV003763308] | Chr18:51078231..51078238 [GRCh38] Chr18:48604601..48604608 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.841C>G (p.Pro281Ala) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763353] | Chr18:51058393 [GRCh38] Chr18:48584763 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.955+1G>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003762335] | Chr18:51059917 [GRCh38] Chr18:48586287 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.89G>T (p.Gly30Val) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597022] | Chr18:51047135 [GRCh38] Chr18:48573505 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1578A>C (p.Glu526Asp) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596968] | Chr18:51078386 [GRCh38] Chr18:48604756 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.282_283del (p.Tyr95fs) | deletion | Juvenile polyposis syndrome [RCV003597039] | Chr18:51048717..51048718 [GRCh38] Chr18:48575087..48575088 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1118C>T (p.Thr373Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV003815784] | Chr18:51065585 [GRCh38] Chr18:48591955 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.371A>G (p.Asp124Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763372] | Chr18:51048807 [GRCh38] Chr18:48575177 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.956-17C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003595844] | Chr18:51065406 [GRCh38] Chr18:48591776 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.425A>G (p.Asp142Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV003597006] | Chr18:51049295 [GRCh38] Chr18:48575665 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.878C>A (p.Pro293His) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763465] | Chr18:51058430 [GRCh38] Chr18:48584800 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.397T>C (p.Tyr133His) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596303] | Chr18:51048833 [GRCh38] Chr18:48575203 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.472G>A (p.Val158Met) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762437] | Chr18:51054798 [GRCh38] Chr18:48581168 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1307A>C (p.Lys436Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762439] | Chr18:51067186 [GRCh38] Chr18:48593556 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-9C>A | single nucleotide variant | Juvenile polyposis syndrome [RCV003596358] | Chr18:51067010 [GRCh38] Chr18:48593380 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1448-17C>T | single nucleotide variant | Juvenile polyposis syndrome [RCV003762493] | Chr18:51078239 [GRCh38] Chr18:48604609 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.788-13C>G | single nucleotide variant | Juvenile polyposis syndrome [RCV003763564] | Chr18:51058327 [GRCh38] Chr18:48584697 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1284G>A (p.Lys428=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596426] | Chr18:51067163 [GRCh38] Chr18:48593533 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.250-19T>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003764271] | Chr18:51048667 [GRCh38] Chr18:48575037 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.627C>G (p.Thr209=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003596840] | Chr18:51054953 [GRCh38] Chr18:48581323 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1515T>C (p.Phe505=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762262] | Chr18:51078323 [GRCh38] Chr18:48604693 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.955+15A>C | single nucleotide variant | Juvenile polyposis syndrome [RCV003596888] | Chr18:51059931 [GRCh38] Chr18:48586301 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1413C>G (p.Gly471=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004558166]|Juvenile polyposis syndrome [RCV003595843] | Chr18:51076742 [GRCh38] Chr18:48603112 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.811A>G (p.Ser271Gly) | single nucleotide variant | Juvenile polyposis syndrome [RCV003855035] | Chr18:51058363 [GRCh38] Chr18:48584733 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.611C>G (p.Ser204Cys) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762341] | Chr18:51054937 [GRCh38] Chr18:48581307 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.742C>G (p.Gln248Glu) | single nucleotide variant | Juvenile polyposis syndrome [RCV003762362]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004011670] | Chr18:51058199 [GRCh38] Chr18:48584569 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.632C>T (p.Thr211Ile) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763473] | Chr18:51054958 [GRCh38] Chr18:48581328 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.162G>A (p.Leu54=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003763502] | Chr18:51047208 [GRCh38] Chr18:48573578 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1145A>C (p.His382Pro) | single nucleotide variant | Juvenile polyposis syndrome [RCV003853419] | Chr18:51067024 [GRCh38] Chr18:48593394 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.259C>T (p.Arg87Trp) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004559042]|Juvenile polyposis syndrome [RCV003872008]|Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004573378] | Chr18:51048695 [GRCh38] Chr18:48575065 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1623T>C (p.His541=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003820469] | Chr18:51078431 [GRCh38] Chr18:48604801 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1334G>A (p.Arg445Gln) | single nucleotide variant | Juvenile polyposis syndrome [RCV003853958] | Chr18:51076663 [GRCh38] Chr18:48603033 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.453T>C (p.Asn151=) | single nucleotide variant | Juvenile polyposis syndrome [RCV003853410]|SMAD4-related disorder [RCV003893509] | Chr18:51049323 [GRCh38] Chr18:48575693 [GRCh37] Chr18:18q21.2 |
likely benign|uncertain significance |
NM_005359.6(SMAD4):c.1408C>A (p.Pro470Thr) | single nucleotide variant | Juvenile polyposis syndrome [RCV003858448] | Chr18:51076737 [GRCh38] Chr18:48603107 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1355del (p.Ala452fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004440247] | Chr18:51076684 [GRCh38] Chr18:48603054 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.803_804insCTAAGTGGTAGTAG (p.Trp268delinsCysTer) | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004442466] | Chr18:51058354..51058355 [GRCh38] Chr18:48584724..48584725 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1563_1567del (p.Pro522fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004442467] | Chr18:51078371..51078375 [GRCh38] Chr18:48604741..48604745 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.747dup (p.Gln250fs) | duplication | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004442527] | Chr18:51058203..51058204 [GRCh38] Chr18:48584573..48584574 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1447+3_1447+4insGCTGCTGCTGGAATTGGTGTTGATGACCTTCGTCGCTTATGCATACTCAGGATG | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010170] | Chr18:51076779..51076780 [GRCh38] Chr18:48603149..48603150 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+4_1447+5insTTGGTGTTGATGACCTTCGTCGCTTATGCATACTCAG | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007889] | Chr18:51076780..51076781 [GRCh38] Chr18:48603150..48603151 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+2_1447+3insCTGTCAGCTGCTGCTGGAATTGGTGTTGATGACCTTCGTCGCTTATGCATACTC | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007900] | Chr18:51076778..51076779 [GRCh38] Chr18:48603148..48603149 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.905-7T>C | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007912] | Chr18:51059859 [GRCh38] Chr18:48586229 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.788-1G>C | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004439982] | Chr18:51058339 [GRCh38] Chr18:48584709 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1659A>C (p.Ter553Cys) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004440080] | Chr18:51078467 [GRCh38] Chr18:48604837 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.754G>T (p.Gly252Ter) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004442660] | Chr18:51058211 [GRCh38] Chr18:48584581 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1308+3_1308+4insTTGATTTGCGTCAGTGTCATCGACAGATGCAGCAGCAGGCGGCTACTGCACAAGCTGC | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007902] | Chr18:51067190..51067191 [GRCh38] Chr18:48593560..48593561 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.788-1G>A | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004440227] | Chr18:51058339 [GRCh38] Chr18:48584709 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.1309-2A>G | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004440419] | Chr18:51076636 [GRCh38] Chr18:48603006 [GRCh37] Chr18:18q21.2 |
likely pathogenic |
NM_005359.6(SMAD4):c.479A>T (p.Asp160Val) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004009757] | Chr18:51054805 [GRCh38] Chr18:48581175 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.854del (p.Asn285fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004442735] | Chr18:51058403 [GRCh38] Chr18:48584773 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1295G>C (p.Ser432Thr) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010245] | Chr18:51067174 [GRCh38] Chr18:48593544 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.15T>C (p.Ser5=) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010014] | Chr18:51047061 [GRCh38] Chr18:48573431 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1309-13T>G | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010233] | Chr18:51076625 [GRCh38] Chr18:48602995 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.586dup (p.Ser196fs) | duplication | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004440294] | Chr18:51054911..51054912 [GRCh38] Chr18:48581281..48581282 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1308+2_1308+3insCTTTGATTTGCGTCAGTGTCATCGACAGATGCAGCAGCAGGCGGCTACTGCACAAGC | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004007839] | Chr18:51067189..51067190 [GRCh38] Chr18:48593559..48593560 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.830C>T (p.Thr277Ile) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004011773] | Chr18:51058382 [GRCh38] Chr18:48584752 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.593del (p.Pro198fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004437853] | Chr18:51054916 [GRCh38] Chr18:48581286 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.1139+278dup | duplication | SMAD4-related disorder [RCV003893756] | Chr18:51065880..51065881 [GRCh38] Chr18:48592250..48592251 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1639del (p.Asp547fs) | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004012170] | Chr18:51078447 [GRCh38] Chr18:48604817 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.524A>G (p.Glu175Gly) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004012188] | Chr18:51054850 [GRCh38] Chr18:48581220 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1540C>T (p.Pro514Ser) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010035] | Chr18:51078348 [GRCh38] Chr18:48604718 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1541C>T (p.Pro514Leu) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004010036] | Chr18:51078349 [GRCh38] Chr18:48604719 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.10:g.51076638del | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004440365] | Chr18:51076637 [GRCh38] Chr18:48603007 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.216T>C (p.Val72=) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004012717] | Chr18:51047262 [GRCh38] Chr18:48573632 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1308+3_1308+4insTTGATTTGCGTCAGTGTCATCGACAGATGCAGC | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004015522] | Chr18:51067190..51067191 [GRCh38] Chr18:48593560..48593561 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.310C>G (p.Leu104Val) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004015120] | Chr18:51048746 [GRCh38] Chr18:48575116 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.421A>G (p.Ile141Val) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004016945] | Chr18:51048857 [GRCh38] Chr18:48575227 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.570A>G (p.Ala190=) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004012964] | Chr18:51054896 [GRCh38] Chr18:48581266 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.91G>C (p.Glu31Gln) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004015491] | Chr18:51047137 [GRCh38] Chr18:48573507 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.904+1_904+2insGCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAATCATCCTGCTCCTGAGTAT | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004013234] | Chr18:51058457..51058458 [GRCh38] Chr18:48584827..48584828 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.556C>A (p.Pro186Thr) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004013359] | Chr18:51054882 [GRCh38] Chr18:48581252 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1140-2del | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV004561261] | Chr18:51067016 [GRCh38] Chr18:48593386 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1151G>T (p.Gly384Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561262] | Chr18:51067030 [GRCh38] Chr18:48593400 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1245C>T (p.Asp415=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561265] | Chr18:51067124 [GRCh38] Chr18:48593494 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1265C>T (p.Pro422Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561267] | Chr18:51067144 [GRCh38] Chr18:48593514 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.130G>C (p.Val44Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561269] | Chr18:51047176 [GRCh38] Chr18:48573546 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1374A>G (p.Ala458=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561271] | Chr18:51076703 [GRCh38] Chr18:48603073 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1419A>T (p.Gly473=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561272] | Chr18:51076748 [GRCh38] Chr18:48603118 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+3A>G | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561273] | Chr18:51076779 [GRCh38] Chr18:48603149 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1602G>A (p.Gln534=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561275] | Chr18:51078410 [GRCh38] Chr18:48604780 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.167C>A (p.Ser56Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561277] | Chr18:51047213 [GRCh38] Chr18:48573583 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.454+5G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561289] | Chr18:51049329 [GRCh38] Chr18:48575699 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.568G>A (p.Ala190Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561294] | Chr18:51054894 [GRCh38] Chr18:48581264 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.626C>A (p.Thr209Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561296] | Chr18:51054952 [GRCh38] Chr18:48581322 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.629G>C (p.Ser210Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561297] | Chr18:51054955 [GRCh38] Chr18:48581325 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.649A>G (p.Ile217Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561298] | Chr18:51054975 [GRCh38] Chr18:48581345 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.757T>A (p.Phe253Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561300] | Chr18:51058214 [GRCh38] Chr18:48584584 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.831A>G (p.Thr277=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561302] | Chr18:51058383 [GRCh38] Chr18:48584753 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.848A>C (p.His283Pro) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561305] | Chr18:51058400 [GRCh38] Chr18:48584770 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.848A>T (p.His283Leu) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561306] | Chr18:51058400 [GRCh38] Chr18:48584770 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.881T>C (p.Met294Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561308] | Chr18:51058433 [GRCh38] Chr18:48584803 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.920A>T (p.Glu307Val) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561310] | Chr18:51059881 [GRCh38] Chr18:48586251 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.982T>C (p.Tyr328His) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561312] | Chr18:51065449 [GRCh38] Chr18:48591819 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1188T>C (p.Asp396=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561263] | Chr18:51067067 [GRCh38] Chr18:48593437 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1447+5G>A | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561274] | Chr18:51076781 [GRCh38] Chr18:48603151 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.176C>T (p.Thr59Ile) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561278] | Chr18:51047222 [GRCh38] Chr18:48573592 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.300G>T (p.Arg100Ser) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561284] | Chr18:51048736 [GRCh38] Chr18:48575106 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.334_335del (p.His111_Val112insTer) | deletion | Familial thoracic aortic aneurysm and aortic dissection [RCV004561285] | Chr18:51048769..51048770 [GRCh38] Chr18:48575139..48575140 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.801C>T (p.Thr267=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561301] | Chr18:51058353 [GRCh38] Chr18:48584723 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1040T>C (p.Ile347Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561257] | Chr18:51065507 [GRCh38] Chr18:48591877 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1045A>G (p.Thr349Ala) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561258] | Chr18:51065512 [GRCh38] Chr18:48591882 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.110A>G (p.Lys37Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561260] | Chr18:51047156 [GRCh38] Chr18:48573526 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1287C>A (p.Ile429=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561268] | Chr18:51067166 [GRCh38] Chr18:48593536 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.163G>T (p.Asp55Tyr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561276] | Chr18:51047209 [GRCh38] Chr18:48573579 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.204T>A (p.Pro68=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561279] | Chr18:51047250 [GRCh38] Chr18:48573620 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.249+3T>C | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561281] | Chr18:51047298 [GRCh38] Chr18:48573668 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.278T>G (p.Val93Gly) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561282] | Chr18:51048714 [GRCh38] Chr18:48575084 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.299G>A (p.Arg100Lys) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561283] | Chr18:51048735 [GRCh38] Chr18:48575105 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.370G>A (p.Asp124Asn) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561286] | Chr18:51048806 [GRCh38] Chr18:48575176 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.416C>G (p.Pro139Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561287] | Chr18:51048852 [GRCh38] Chr18:48575222 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.426T>C (p.Asp142=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561288] | Chr18:51049296 [GRCh38] Chr18:48575666 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.459A>G (p.Pro153=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561290] | Chr18:51054785 [GRCh38] Chr18:48581155 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.465T>A (p.Ser155Arg) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561291] | Chr18:51054791 [GRCh38] Chr18:48581161 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.567T>A (p.Arg189=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561293] | Chr18:51054893 [GRCh38] Chr18:48581263 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.690_692dup (p.Gly231_Ser232insGly) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV004561299] | Chr18:51058143..51058144 [GRCh38] Chr18:48584513..48584514 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.840G>A (p.Leu280=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561304] | Chr18:51058392 [GRCh38] Chr18:48584762 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.881dup (p.Met294fs) | duplication | Familial thoracic aortic aneurysm and aortic dissection [RCV004561307] | Chr18:51058432..51058433 [GRCh38] Chr18:48584802..48584803 [GRCh37] Chr18:18q21.2 |
pathogenic |
NM_005359.6(SMAD4):c.955+5G>T | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561311] | Chr18:51059921 [GRCh38] Chr18:48586291 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1657T>C (p.Ter553Arg) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004015535] | Chr18:51078465 [GRCh38] Chr18:48604835 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.667+2_667+3insCAGCCTGCCAGTATACTGGGGGGCAGCCATAGTGAAG | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004013864] | Chr18:51054995..51054996 [GRCh38] Chr18:48581365..48581366 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1444A>C (p.Ile482Leu) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004015748] | Chr18:51076773 [GRCh38] Chr18:48603143 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1014A>C (p.Thr338=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561255] | Chr18:51065481 [GRCh38] Chr18:48591851 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1029A>G (p.Ser343=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561256] | Chr18:51065496 [GRCh38] Chr18:48591866 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.1254T>A (p.Ala418=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561266] | Chr18:51067133 [GRCh38] Chr18:48593503 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.132A>C (p.Val44=) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561270] | Chr18:51047178 [GRCh38] Chr18:48573548 [GRCh37] Chr18:18q21.2 |
likely benign |
NM_005359.6(SMAD4):c.221T>C (p.Ile74Thr) | single nucleotide variant | Familial thoracic aortic aneurysm and aortic dissection [RCV004561280] | Chr18:51047267 [GRCh38] Chr18:48573637 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1308+2_1308+3insCTTTGATTTGCGTCAGTGTCATCGACAGATGCAGCAGCAGGCGGC | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004014755] | Chr18:51067189..51067190 [GRCh38] Chr18:48593559..48593560 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1447+6_1447+7insGTTG | insertion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004013253] | Chr18:51076782..51076783 [GRCh38] Chr18:48603152..48603153 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.895G>C (p.Gly299Arg) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004013930] | Chr18:51058447 [GRCh38] Chr18:48584817 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.244C>G (p.Leu82Val) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004014130] | Chr18:51047290 [GRCh38] Chr18:48573660 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.-7del | deletion | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004012893] | Chr18:51047039 [GRCh38] Chr18:48573409 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NC_000018.9:g.(?_48556583)_(48593567_?)del | deletion | Juvenile polyposis syndrome [RCV004579790] | Chr18:48556583..48593567 [GRCh37] | pathogenic |
NC_000018.9:g.(?_48604616)_(48604847_?)dup | duplication | Juvenile polyposis syndrome [RCV004579793] | Chr18:48604616..48604847 [GRCh37] | likely benign |
NC_000018.9:g.(?_48573290)_(48573685_?)dup | duplication | Juvenile polyposis syndrome [RCV004579794] | Chr18:48573290..48573685 [GRCh37] | likely benign |
NC_000018.9:g.(?_48591773)_(48604837_?)dup | duplication | Juvenile polyposis syndrome [RCV004579795] | Chr18:48591773..48604837 [GRCh37] | uncertain significance |
NC_000018.9:g.(?_48565515)_(48591839_?)del | deletion | Juvenile polyposis syndrome [RCV004579796] | Chr18:48565515..48591839 [GRCh37] | pathogenic |
NC_000018.9:g.(?_48573290)_(48575704_?)del | deletion | Juvenile polyposis syndrome [RCV004579792] | Chr18:48573290..48575704 [GRCh37] | pathogenic |
NM_005359.6(SMAD4):c.899A>T (p.His300Leu) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004573652] | Chr18:51058451 [GRCh38] Chr18:48584821 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.359A>T (p.Asp120Val) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004573653] | Chr18:51048795 [GRCh38] Chr18:48575165 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.1373C>T (p.Ala458Val) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004573651] | Chr18:51076702 [GRCh38] Chr18:48603072 [GRCh37] Chr18:18q21.2 |
uncertain significance |
NM_005359.6(SMAD4):c.719T>G (p.Ile240Arg) | single nucleotide variant | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome [RCV004573654] | Chr18:51058176 [GRCh38] Chr18:48584546 [GRCh37] Chr18:18q21.2 |
uncertain significance |
The detailed report is available here: | ![]() | Full Report | ![]() | CSV | ![]() | TAB | ![]() | Printer |
miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/). For more information about miRGate, see PMID:25858286 or access the full paper here. |
D18S1110 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
WI-11075 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RH75869 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AF010230 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
D18S903E |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SHGC-56739 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RH46461 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PMC86557P1 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MADH4_174 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RH44980 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RH66749 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
D8S2279 |
|
alimentary part of gastrointestinal system | circulatory system | endocrine system | exocrine system | hemolymphoid system | hepatobiliary system | integumental system | musculoskeletal system | nervous system | renal system | reproductive system | respiratory system | sensory system | visual system | adipose tissue | appendage | entire extraembryonic component | pharyngeal arch | |
High | ||||||||||||||||||
Medium | 2251 | 1681 | 1371 | 314 | 1198 | 161 | 4266 | 1769 | 1780 | 273 | 1369 | 1551 | 165 | 1 | 1182 | 2723 | 5 | 2 |
Low | 183 | 1305 | 355 | 310 | 748 | 304 | 89 | 428 | 1954 | 146 | 90 | 58 | 10 | 22 | 65 | 1 | ||
Below cutoff | 4 | 5 | 5 | 2 | 1 |
RefSeq Transcripts | NG_013013 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles |
NM_001407041 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NM_001407042 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NM_001407043 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NM_005359 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NR_176264 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NR_176265 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
GenBank Nucleotide | AB043547 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles |
AC091551 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AH005874 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AK290770 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AU120224 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BC002379 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BM701399 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BX647129 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
CH471096 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
CP068260 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
DQ660374 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
KF572431 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
KF572432 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
KF572433 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
KU178168 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
KU178169 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
U44378 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles |
Ensembl Acc Id: | ENST00000342988 ⟹ ENSP00000341551 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000398417 ⟹ ENSP00000381452 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000585448 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000586253 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000588745 ⟹ ENSP00000464901 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000588860 ⟹ ENSP00000465878 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000589076 ⟹ ENSP00000466934 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000589706 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000589941 ⟹ ENSP00000465874 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000590061 ⟹ ENSP00000464772 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000590499 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000591126 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000592186 ⟹ ENSP00000468611 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000592911 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000593223 ⟹ ENSP00000466118 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000611848 ⟹ ENSP00000478613 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000684953 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000685090 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000685232 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000688307 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000688574 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000688903 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000690892 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000691124 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714260 ⟹ ENSP00000519541 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714261 ⟹ ENSP00000519542 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714262 ⟹ ENSP00000519543 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714263 ⟹ ENSP00000519544 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714264 ⟹ ENSP00000519545 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714265 ⟹ ENSP00000519546 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714266 ⟹ ENSP00000519547 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714267 ⟹ ENSP00000519548 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714268 ⟹ ENSP00000519549 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714269 ⟹ ENSP00000519550 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714270 ⟹ ENSP00000519551 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714271 ⟹ ENSP00000519552 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714272 ⟹ ENSP00000519553 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714273 ⟹ ENSP00000519554 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000714274 ⟹ ENSP00000519555 | ||||||||
Type: | CODING | ||||||||
Position: |
|
RefSeq Acc Id: | NM_001407041 ⟹ NP_001393970 | ||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||
Type: | CODING | ||||||||||||
Position: |
|
RefSeq Acc Id: | NM_001407042 ⟹ NP_001393971 | ||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||
Type: | CODING | ||||||||||||
Position: |
|
RefSeq Acc Id: | NM_001407043 ⟹ NP_001393972 | ||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||
Type: | CODING | ||||||||||||
Position: |
|
RefSeq Acc Id: | NM_005359 ⟹ NP_005350 | ||||||||||||||||||||||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||||||||||||||||||||||
Type: | CODING | ||||||||||||||||||||||||||||||||
Position: |
|
||||||||||||||||||||||||||||||||
Sequence: |
RefSeq Acc Id: | NR_176264 | ||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||
Type: | NON-CODING | ||||||||||||
Position: |
|
RefSeq Acc Id: | NR_176265 | ||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||
Type: | NON-CODING | ||||||||||||
Position: |
|
Protein RefSeqs | NP_001393970 | (Get FASTA) | NCBI Sequence Viewer |
NP_001393971 | (Get FASTA) | NCBI Sequence Viewer | |
NP_001393972 | (Get FASTA) | NCBI Sequence Viewer | |
NP_005350 | (Get FASTA) | NCBI Sequence Viewer | |
GenBank Protein | AAA91041 | (Get FASTA) | NCBI Sequence Viewer |
AAC03051 | (Get FASTA) | NCBI Sequence Viewer | |
AAH02379 | (Get FASTA) | NCBI Sequence Viewer | |
AHA34184 | (Get FASTA) | NCBI Sequence Viewer | |
AHA34185 | (Get FASTA) | NCBI Sequence Viewer | |
AHA34186 | (Get FASTA) | NCBI Sequence Viewer | |
ALQ33626 | (Get FASTA) | NCBI Sequence Viewer | |
ALQ33627 | (Get FASTA) | NCBI Sequence Viewer | |
BAB40977 | (Get FASTA) | NCBI Sequence Viewer | |
BAF83459 | (Get FASTA) | NCBI Sequence Viewer | |
EAW62985 | (Get FASTA) | NCBI Sequence Viewer | |
EAW62986 | (Get FASTA) | NCBI Sequence Viewer | |
EAW62987 | (Get FASTA) | NCBI Sequence Viewer | |
Ensembl Protein | ENSP00000341551 | ||
ENSP00000341551.3 | |||
ENSP00000381452.1 | |||
ENSP00000464772 | |||
ENSP00000464772.1 | |||
ENSP00000464772.2 | |||
ENSP00000464901.1 | |||
ENSP00000465874.1 | |||
ENSP00000465874.2 | |||
ENSP00000465878.1 | |||
ENSP00000465878.2 | |||
ENSP00000466118.2 | |||
ENSP00000466934 | |||
ENSP00000466934.1 | |||
ENSP00000466934.2 | |||
ENSP00000468611 | |||
ENSP00000468611.1 | |||
ENSP00000478613.2 | |||
GenBank Protein | Q13485 | (Get FASTA) | NCBI Sequence Viewer |
RefSeq Acc Id: | NP_005350 ⟸ NM_005359 |
- Peptide Label: | isoform a |
- UniProtKB: | A8K405 (UniProtKB/Swiss-Prot), Q13485 (UniProtKB/Swiss-Prot), A0A024R274 (UniProtKB/TrEMBL), K7ELK2 (UniProtKB/TrEMBL) |
- Sequence: |
Ensembl Acc Id: | ENSP00000381452 ⟸ ENST00000398417 |
Ensembl Acc Id: | ENSP00000478613 ⟸ ENST00000611848 |
Ensembl Acc Id: | ENSP00000465878 ⟸ ENST00000588860 |
Ensembl Acc Id: | ENSP00000464901 ⟸ ENST00000588745 |
Ensembl Acc Id: | ENSP00000466934 ⟸ ENST00000589076 |
Ensembl Acc Id: | ENSP00000465874 ⟸ ENST00000589941 |
Ensembl Acc Id: | ENSP00000464772 ⟸ ENST00000590061 |
Ensembl Acc Id: | ENSP00000468611 ⟸ ENST00000592186 |
Ensembl Acc Id: | ENSP00000341551 ⟸ ENST00000342988 |
Ensembl Acc Id: | ENSP00000466118 ⟸ ENST00000593223 |
RefSeq Acc Id: | NP_001393971 ⟸ NM_001407042 |
- Peptide Label: | isoform a |
- UniProtKB: | Q13485 (UniProtKB/Swiss-Prot), A8K405 (UniProtKB/Swiss-Prot), K7ELK2 (UniProtKB/TrEMBL), A0A024R274 (UniProtKB/TrEMBL) |
RefSeq Acc Id: | NP_001393970 ⟸ NM_001407041 |
- Peptide Label: | isoform a |
- UniProtKB: | Q13485 (UniProtKB/Swiss-Prot), A8K405 (UniProtKB/Swiss-Prot), K7ELK2 (UniProtKB/TrEMBL), A0A024R274 (UniProtKB/TrEMBL) |
RefSeq Acc Id: | NP_001393972 ⟸ NM_001407043 |
- Peptide Label: | isoform b |
- UniProtKB: | Q9BYG6 (UniProtKB/TrEMBL) |
Ensembl Acc Id: | ENSP00000519551 ⟸ ENST00000714270 |
Ensembl Acc Id: | ENSP00000519550 ⟸ ENST00000714269 |
Ensembl Acc Id: | ENSP00000519546 ⟸ ENST00000714265 |
Ensembl Acc Id: | ENSP00000519553 ⟸ ENST00000714272 |
Ensembl Acc Id: | ENSP00000519543 ⟸ ENST00000714262 |
Ensembl Acc Id: | ENSP00000519542 ⟸ ENST00000714261 |
Ensembl Acc Id: | ENSP00000519544 ⟸ ENST00000714263 |
Ensembl Acc Id: | ENSP00000519541 ⟸ ENST00000714260 |
Ensembl Acc Id: | ENSP00000519547 ⟸ ENST00000714266 |
Ensembl Acc Id: | ENSP00000519552 ⟸ ENST00000714271 |
Ensembl Acc Id: | ENSP00000519554 ⟸ ENST00000714273 |
Ensembl Acc Id: | ENSP00000519549 ⟸ ENST00000714268 |
Ensembl Acc Id: | ENSP00000519555 ⟸ ENST00000714274 |
Ensembl Acc Id: | ENSP00000519545 ⟸ ENST00000714264 |
Ensembl Acc Id: | ENSP00000519548 ⟸ ENST00000714267 |
Name | Modeler | Protein Id | AA Range | Protein Structure |
AF-Q13485-F1-model_v2 | AlphaFold | Q13485 | 1-552 | view protein structure |
RGD ID: | 6795004 | ||||||||
Promoter ID: | HG_KWN:28029 | ||||||||
Type: | CpG-Island | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | MPROMDB | ||||||||
Tissues & Cell Lines: | CD4+TCell, CD4+TCell_12Hour, CD4+TCell_2Hour, HeLa_S3, Jurkat, K562, Lymphoblastoid, NB4 | ||||||||
Transcripts: | NM_005359, UC002LFA.2 | ||||||||
Position: |
|
RGD ID: | 6795005 | ||||||||
Promoter ID: | HG_KWN:28031 | ||||||||
Type: | Non-CpG | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | MPROMDB | ||||||||
Tissues & Cell Lines: | CD4+TCell, Lymphoblastoid | ||||||||
Transcripts: | UC002LFB.2 | ||||||||
Position: |
|
RGD ID: | 7237351 | ||||||||
Promoter ID: | EPDNEW_H24421 | ||||||||
Type: | initiation region | ||||||||
Name: | SMAD4_3 | ||||||||
Description: | SMAD family member 4 | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) | ||||||||
Alternative Promoters: | null; see alsoEPDNEW_H24423 EPDNEW_H24422 EPDNEW_H24424 | ||||||||
Experiment Methods: | Single-end sequencing.; Paired-end sequencing. | ||||||||
Position: |
|
RGD ID: | 7237355 | ||||||||
Promoter ID: | EPDNEW_H24422 | ||||||||
Type: | initiation region | ||||||||
Name: | SMAD4_1 | ||||||||
Description: | SMAD family member 4 | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) | ||||||||
Alternative Promoters: | null; see alsoEPDNEW_H24421 EPDNEW_H24423 EPDNEW_H24424 | ||||||||
Experiment Methods: | Single-end sequencing.; Paired-end sequencing. | ||||||||
Position: |
|
RGD ID: | 7237353 | ||||||||
Promoter ID: | EPDNEW_H24423 | ||||||||
Type: | initiation region | ||||||||
Name: | SMAD4_4 | ||||||||
Description: | SMAD family member 4 | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) | ||||||||
Alternative Promoters: | null; see alsoEPDNEW_H24421 EPDNEW_H24422 EPDNEW_H24424 | ||||||||
Experiment Methods: | Single-end sequencing.; Paired-end sequencing. | ||||||||
Position: |
|
RGD ID: | 7237359 | ||||||||
Promoter ID: | EPDNEW_H24424 | ||||||||
Type: | initiation region | ||||||||
Name: | SMAD4_2 | ||||||||
Description: | SMAD family member 4 | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) | ||||||||
Alternative Promoters: | null; see alsoEPDNEW_H24421 EPDNEW_H24423 EPDNEW_H24422 | ||||||||
Experiment Methods: | Single-end sequencing.; Paired-end sequencing. | ||||||||
Position: |
|
Database | Acc Id | Source(s) |
AGR Gene | HGNC:6770 | AgrOrtholog |
COSMIC | SMAD4 | COSMIC |
Ensembl Genes | ENSG00000141646 | Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
Ensembl Transcript | ENST00000342988 | ENTREZGENE |
ENST00000342988.8 | UniProtKB/Swiss-Prot | |
ENST00000398417.6 | UniProtKB/Swiss-Prot | |
ENST00000588745.5 | UniProtKB/TrEMBL | |
ENST00000588860.5 | UniProtKB/TrEMBL | |
ENST00000588860.6 | UniProtKB/Swiss-Prot | |
ENST00000589076 | ENTREZGENE | |
ENST00000589076.5 | UniProtKB/TrEMBL | |
ENST00000589076.6 | UniProtKB/Swiss-Prot | |
ENST00000589941.1 | UniProtKB/TrEMBL | |
ENST00000589941.2 | UniProtKB/Swiss-Prot | |
ENST00000590061 | ENTREZGENE | |
ENST00000590061.1 | UniProtKB/TrEMBL | |
ENST00000590061.2 | UniProtKB/Swiss-Prot | |
ENST00000592186 | ENTREZGENE | |
ENST00000592186.5 | UniProtKB/TrEMBL | |
ENST00000593223.2 | UniProtKB/TrEMBL | |
ENST00000611848.2 | UniProtKB/TrEMBL | |
Gene3D-CATH | 2.60.200.10 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
3.90.520.10 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
GTEx | ENSG00000141646 | GTEx |
HGNC ID | HGNC:6770 | ENTREZGENE |
Human Proteome Map | SMAD4 | Human Proteome Map |
InterPro | Dwarfin | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
MAD_homology1_Dwarfin-type | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
MAD_homology_MH1 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
SMAD-like_dom_sf | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
SMAD_dom_Dwarfin-type | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
SMAD_FHA_dom_sf | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
SMAD_MH1_sf | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
KEGG Report | hsa:4089 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
NCBI Gene | 4089 | ENTREZGENE |
OMIM | 600993 | OMIM |
PANTHER | MOTHERS AGAINST DECAPENTAPLEGIC HOMOLOG 4 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
PTHR13703 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
Pfam | MH1 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
MH2 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
PharmGKB | PA30527 | PharmGKB |
PROSITE | MH1 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
MH2 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
SMART | DWA | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
DWB | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
Superfamily-SCOP | SSF49879 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL |
SSF56366 | UniProtKB/Swiss-Prot, UniProtKB/TrEMBL | |
UniProt | A0A024R274 | ENTREZGENE, UniProtKB/TrEMBL |
A0A087WUF3_HUMAN | UniProtKB/TrEMBL | |
A8K405 | ENTREZGENE | |
K7EIJ2_HUMAN | UniProtKB/TrEMBL | |
K7EIU8_HUMAN | UniProtKB/TrEMBL | |
K7EL15_HUMAN | UniProtKB/TrEMBL | |
K7EL18_HUMAN | UniProtKB/TrEMBL | |
K7ELK2 | ENTREZGENE, UniProtKB/TrEMBL | |
K7ENG1_HUMAN | UniProtKB/TrEMBL | |
K7ES96_HUMAN | UniProtKB/TrEMBL | |
Q13485 | ENTREZGENE | |
Q9BYG6 | ENTREZGENE, UniProtKB/TrEMBL | |
SMAD4_HUMAN | UniProtKB/Swiss-Prot | |
U6BGT8_HUMAN | UniProtKB/TrEMBL | |
U6BKH8_HUMAN | UniProtKB/TrEMBL | |
UniProt Secondary | A0A0S2Z4B2 | UniProtKB/TrEMBL |
A8K405 | UniProtKB/Swiss-Prot |