D3Rat187 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D3Rat187

Symbol: D3Rat187
Previously known as: oxsts10729; R0248-D10; 
RGD ID: 40362
Expected Size: 162 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2344,193,643 - 44,193,805 (+)MAPPERmRatBN7.2
Rnor_6.0345,778,223 - 45,778,384NCBIRnor6.0
Rnor_5.0350,890,043 - 50,890,204UniSTSRnor5.0
RGSC_v3.4341,425,668 - 41,425,830RGDRGSC3.4
RGSC_v3.4341,425,669 - 41,425,830UniSTSRGSC3.4
RGSC_v3.1341,322,040 - 41,322,202RGD
Celera342,240,420 - 42,240,581UniSTS
SHRSP x BN Map331.7698UniSTS
SHRSP x BN Map331.7698RGD
Cytogenetic Map3q21UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Tanc1  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines


 
Forward Primer CTTGCTCTCCTGCTTATCCG
Reverse Primer TCCAAACTAAGCCCACTTCC
 
Strain, Expected Size(s)

ACI/N 164 AVN/Orl 160 BBDP/Rhw 164
BBDR/Rhw 164 BC/CpbU 170 BDIX/Han 160
BDVII/Cub 160 BN-Lx/Cub 160 BN/SsNHsd 160
BP/Cub 170 BUF/Pit 160 COP/OlaHsd 164
DA/PitN 164 F344/Pit 160 FHH/Eur 164
GH/Omr 164 GK/KyoSwe 160 IS/Kyo 160
LE/Mol 164 LEW/Pit 160 LH/Mav 160
LN/Mav 160 LOU/CHan 160 M520/N 164
MHS/Gib 160 MNR/N 160 MNRA/N 160
MNS/Gib 160 MR/Pit 160 NEDH/K 160
NP9 164 ODU/N 162 OKA/Wsl 162
P5C 160 PVG/Pit 170 SD/Rij 160
SHR/OlaHsd 162 SHRSP/Riv 164 SR/Jr 164
SS/Jr 160 WAG/RijKyo 160 WF/Pit 160
WIST/Nhg 160 WN/N 160 WTC/Kyo 160


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
1302949Tanc1tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 134409938744335478Rat
GenBank Nucleotide CH473983 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000233 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 60 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3822719447233430Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31500542276927699Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32824968773249687Rat
10450816Scl75Serum cholesterol level QTL 754.40.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33819223350749747Rat
2313093Bmd77Bone mineral density QTL 772.20.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)32749462150302886Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)343827364121056321Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31831145447233430Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31831145447233430Rat

1 to 10 of 60 rows


Database
Acc Id
Source(s)
NCBI Gene 311055 UniSTS