D7Rat99 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D7Rat99

Symbol: D7Rat99
Previously known as: oxsts7404; R0054-B02; 
RGD ID: 37374
Expected Size: 199 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr87106,126,590 - 106,126,789 (+)Marker Load Pipeline
mRatBN7.27104,237,839 - 104,238,038 (+)MAPPERmRatBN7.2
Rnor_6.07113,518,262 - 113,518,460NCBIRnor6.0
Rnor_5.07113,456,474 - 113,456,672UniSTSRnor5.0
RGSC_v3.47110,025,175 - 110,025,373UniSTSRGSC3.4
Celera7100,657,078 - 100,657,276UniSTS
RH 3.4 Map1703.2RGD
RH 3.4 Map1703.2UniSTS
RH 2.0 Map1441.1RGD
SHRSP x BN Map760.22RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Aia16   Aia17  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GTAAACCCCAGTTTCGGTGA
Reverse Primer TCCTTAAAGGTTGGCTTTGTTT
 
Template
GGNAGGTCGACTCTAGAGGATCCCCACAATTAAGTAAATCCTTAAAGGTTGGCTTTGTTTAAAT
TTTTGTTTGTTTGGCCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGTGTCTTGTG
TGTGTGTAGTGGATCAGAGAAGGCGAAGAGAGATATACCAGAAGTCCATGTTAGCTATCCAGTT
TTNCTCACATCATTTTTCAAGCCAGGGTCTATCACCGAAACTGGGGTTTACCTATTTGGCTATA
CTGTTCCCTAAGATCCTCCTGCCTTTGCTTTCCCAGCACTGGGGTTATAACTATATTCACCTCA
TCTGGTTTTTGCCTGGGTGGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGT
GTGAAATTGTTATCCGCTCACAATTCCACACAACATANGAGCCGGAAGCATAAAGTGTAAAGCC
TGGGGTGCTAATGAGTGAGNCAACTCANATTAATTGCGTNCGCTCATGCCCGCTTTCCAGTCGG
GAAANTGNCGTGNACTGCATT

Region

Nucleotide Sequences
GenBank Nucleotide CH473950 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)792388565119280177Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)782111245123048330Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7104186212135371468Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)771103011106126789Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)731770293110435881Rat
1357338Stl17Serum triglyceride level QTL 173.23blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)771621154114982716Rat
70159Bp61Blood pressure QTL 610.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)773618702118618702Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)793302009131686183Rat
61397Bw17Body weight QTL 176.3body mass (VT:0001259)body weight (CMO:0000012)795485047137014596Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)746307490127866166Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)785043242130043242Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)785497398130497398Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)792362341137014596Rat
2317052Aia17Adjuvant induced arthritis QTL 172.13joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)783626689128626689Rat
1331723Bw25Body weight QTL 253.348body mass (VT:0001259)body weight (CMO:0000012)796700404111672180Rat
631529Tls2T-lymphoma susceptibility QTL 200.001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)782111382132099989Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)798549867137014596Rat
1559283Emca4Estrogen-induced mammary cancer QTL 43.7mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)763889858108889858Rat
7411607Foco15Food consumption QTL 150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)777807807122807807Rat
631201Panci1Pancreas inflammation QTL 100.001pancreas integrity trait (VT:0010560)percentage of study population displaying chronic pancreatitis at a point in time (CMO:0001214)773557047118557047Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)71509236116977875Rat
1331768Kidm10Kidney mass QTL 104.62096kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)782111245123048330Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)740540077123682549Rat
2313102Bmd79Bone mineral density QTL 792.30.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)796700404118618702Rat
2316947Rf58Renal function QTL 587.8kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)749682832115766396Rat
10450862Kidm55Kidney mass QTL 554.9kidney mass (VT:0002707)kidney weight (CMO:0000081)772725037117725037Rat
1298528Bp169Blood pressure QTL 1690.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)762963207107963207Rat
61428Scl3Serum cholesterol level QTL 33.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)7100548246137014596Rat
1331746Kidm9Kidney mass QTL 93.934kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)782111245134948181Rat
1576303Ept7Estrogen-induced pituitary tumorigenesis QTL 73.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)763889858108889858Rat
10450856Livw4Liver weight QTL 43.8liver mass (VT:0003402)liver weight (CMO:0000092)772725037117725037Rat
7411654Foco25Food consumption QTL 259.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)777807807122807807Rat
2316955Stl24Serum triglyceride level QTL 247.1blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)749682832115766396Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)778682549123682549Rat
2316952Pur22Proteinuria QTL 225.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)749682832115766396Rat
631540Bw9Body weight QTL 94.5body mass (VT:0001259)body weight (CMO:0000012)771621154119349044Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)771827901136544683Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100381222 UniSTS
  100381237 UniSTS