D4Rat12 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D4Rat12

Symbol: D4Rat12
Previously known as: oxsts7029; R025-C11; R0025-C11; 
RGD ID: 35847
Expected Size: 153 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8439,431,983 - 39,432,136 (+)Marker Load Pipeline
mRatBN7.2438,465,774 - 38,465,927 (+)MAPPERmRatBN7.2
Rnor_6.0436,615,599 - 36,615,751NCBIRnor6.0
Rnor_5.0436,467,227 - 36,467,379UniSTSRnor5.0
Celera433,924,454 - 33,924,606UniSTS
RH 3.4 Map4184.6UniSTS
RH 3.4 Map4184.6RGD
RH 2.0 Map4272.0RGD
SHRSP x BN Map420.45RGD
FHH x ACI Map423.22RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Srcrt3   Bp179  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer AAGGTCCCTGTATGACTATGGTT
Reverse Primer AAATTGGGAAATGTTTGCTTTT
 
Strain, Expected Size(s)

ACI/N 144 AVN/Orl 148 BBDP/Rhw 148
BBDR/Rhw 148 BC/CpbU 148 BDIX/Han 148
BDVII/Cub 148 BN-Lx/Cub 154 BN/SsNHsd 154
BP/Cub 148 BUF/Pit 148 COP/OlaHsd 144
DA/PitN 144 DON/Melb 146 F344/Pit 146
FHH/Eur 150 GH/Omr 148 GK/KyoSwe 148
IS/Kyo 150 LE/Mol 148 LEW/Pit 148
LH/Mav 148 LN/Mav 148 LOU/CHan 148
M520/N 148 MHS/Gib 148 MNR/N 148
MNRA/N 148 MNS/Gib 148 MR/Pit 148
NEDH/K 148 NP9 148 ODU/N 148
OKA/Wsl 148 OM/Ztm 148 P5C 148
PVG/Pit 148 SD/Rij 148 SHR/OlaHsd 148
SHRSP/Riv 148 SR/Jr 148 SS/Jr 150
WAG/RijKyo 148 WF/Pit 148 WIST/Nhg 148
WKY/OlaHsd 148 WN/N 148 WTC/Kyo 148


GenBank Nucleotide CH473959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 38 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41008408955084089Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)426775591168368347Rat
8655949Rf62Renal function QTL 6222blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)43443011944463908Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41008408955084089Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
70222Eae2Experimental allergic encephalomyelitis QTL 24.3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)42133334339505420Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat

1 to 10 of 38 rows


Database
Acc Id
Source(s)
NCBI Gene 100302754 UniSTS
  444955 UniSTS