D7Mit27 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D7Mit27

Symbol: D7Mit27
Previously known as: oxsts9198; 
RGD ID: 10939
Expected Size: 210 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8795,485,031 - 95,485,241 (+)Marker Load Pipeline
mRatBN7.2793,595,631 - 93,595,843 (+)MAPPERmRatBN7.2
Rnor_6.07102,588,240 - 102,588,450NCBIRnor6.0
Rnor_5.07103,159,379 - 103,159,589UniSTSRnor5.0
RGSC_v3.4798,955,068 - 98,955,278RGDRGSC3.4
RGSC_v3.4798,955,069 - 98,955,278UniSTSRGSC3.4
RGSC_v3.1798,989,298 - 98,989,508RGD
Celera790,265,830 - 90,266,033UniSTS
RH 3.4 Map7653.02RGD
RH 3.4 Map7653.02UniSTS
RH 2.0 Map7540.8RGD
Cytogenetic Map7q33UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   ACI.BN-(D7Uwm33-D7Mit27)/Shul  
QTLs:   Niddm52  
Genes:   Myc  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer AGCGTCACTGATAGTAGGGA
Reverse Primer CAGCAAGGGAAGCAAGTCTA
 
Strain, Expected Size(s)

ACI/N 204 AVN/Orl 204 BBDP/Rhw 210
BBDR/Rhw 210 BC/CpbU 202 BDIX/Han 204
BDVII/Cub 204 BN-Lx/Cub 210 BN/SsNHsd 210
BP/Cub 204 BUF/Pit 206 COP/OlaHsd 204
DA/PitN 206 DON/Melb 204 F344/Pit 204
FHH/Eur 212 GH/Omr 206 IS/Kyo 206
LE/Mol 204 LEW/Pit 204 LH/Mav 204
LN/Mav 204 LOU/CHan 204 M520/N 204
MHS/Gib 204 MNR/N 204 MNRA/N 204
MNS/Gib 204 MR/Pit 204 NEDH/K 210
NP9 204 ODU/N 204 OKA/Wsl 204
OM/Ztm 204 P5C 204 PVG/Pit 210
SD/Rij 204 SHR/OlaHsd 204 SHRSP/Riv 204
SR/Jr 204 SS/Jr 204 WAG/RijKyo 204
WF/Pit 204 WIST/Nhg 204 WN/N 204
WTC/Kyo 202


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
3130MycMYC proto-oncogene, bHLH transcription factor79359370593598633Rat
GenBank Nucleotide Y00396 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 40 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)759238038104238038Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
1357338Stl17Serum triglyceride level QTL 173.23blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)769736356112729554Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
10450828Scl79Serum cholesterol level QTL 793.50.001blood HDL cholesterol amount (VT:0000184)blood low density lipoprotein cholesterol level (CMO:0000053)789867376101773158Rat

1 to 10 of 40 rows


Database
Acc Id
Source(s)
NCBI Gene 24577 UniSTS
  387452 UniSTS