D7Mit16 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D7Mit16

Symbol: D7Mit16
Previously known as: oxsts5245; Cypiid4; Cyp2D4; 
RGD ID: 10449
Expected Size: 162 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr87115,766,234 - 115,766,396 (+)Marker Load Pipeline
mRatBN7.27113,886,156 - 113,886,318 (+)MAPPERmRatBN7.2
Rnor_6.07123,602,837 - 123,602,998NCBIRnor6.0
Rnor_5.07123,587,556 - 123,587,717UniSTSRnor5.0
RGSC_v3.47120,745,845 - 120,746,007RGDRGSC3.4
RGSC_v3.47120,745,846 - 120,746,007UniSTSRGSC3.4
RGSC_v3.17120,780,075 - 120,780,237RGD
Celera7110,200,995 - 110,201,156UniSTS
RH 3.4 Map7898.9UniSTS
RH 3.4 Map7898.9RGD
RH 2.0 Map7684.1RGD
Cytogenetic Map7q34UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   F344.OLETF-(D7Mit16-D7Mgh20)/Tj   F344.OLETF-(D7Mgh16-D7Mit16)/Tj   ACI.BN-(D7Uwm41-D7Mit16)/Shul   ACI.BN-(D7Uwm28-D7Mit16)/Shul  
QTLs:   Rf58   Pur22   Stl24  
Genes:   Cyp2d4  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer CAGCACCAGCTTGACCTACA
Reverse Primer ACTCGATGACTCGATTTTCCA
 
Strain, Expected Size(s)

ACI/N 155 AVN/Orl 147 BBDP/Rhw 147
BBDR/Rhw 147 BC/CpbU 147 BDIX/Han 147
BDVII/Cub 147 BN-Lx/Cub 163 BN/SsNHsd 163
BP/Cub 147 BUF/Pit 155 COP/OlaHsd 147
DA/PitN 155 DON/Melb 155 F344/Pit 155
FHH/Eur 147 GH/Omr 147 GK/KyoSwe 147
IS/Kyo 157 LE/Mol 147 LEW/Pit 147
LH/Mav 159 LN/Mav 159 LOU/CHan 147
M520/N 155 MHS/Gib 147 MNR/N 147
MNRA/N 147 MNS/Gib 147 MR/Pit 147
NEDH/K 147 NP9 147 ODU/N 149
OKA/Wsl 149 OM/Ztm 147 P5C 147
PVG/Pit 155 SD/Rij 159 SHR/OlaHsd 149
SHRSP/Riv 149 SR/Jr 155 SS/Jr 159
WAG/RijKyo 147 WF/Pit 147 WIST/Nhg 159
WKY/OlaHsd 149 WN/N 147 WTC/Kyo 149


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
620640Cyp2d4cytochrome P450, family 2, subfamily d, polypeptide 47113882584113891754Rat
GenBank Nucleotide X52029 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 35 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
1357336Gluco6Glucose level QTL 63.4blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)794811326116294265Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
70159Bp61Blood pressure QTL 610.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7103146217116738842Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat

1 to 10 of 35 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 100381183 UniSTS
  100381186 UniSTS
  100381188 UniSTS
  171522 UniSTS
NCBI Nucleotide X52029