Symbol:
ARRB2
Name:
arrestin beta 2
RGD ID:
18471525
Description:
ENCODES a protein that exhibits 14-3-3 protein binding (ortholog); alpha-1A adrenergic receptor binding (ortholog); alpha-1B adrenergic receptor binding (ortholog); INVOLVED IN circadian rhythm (ortholog); detection of temperature stimulus involved in sensory perception of pain (ortholog); endocytosis (ortholog); PARTICIPATES IN angiotensin II signaling pathway via AT1 receptor; calcium signaling pathway via the calcium-sensing receptor; corticotropin-releasing hormone signaling pathway; ASSOCIATED WITH alcohol dependence (ortholog); amphetamine abuse (ortholog); Arteriovenous Fistula (ortholog); FOUND IN basolateral plasma membrane (ortholog); dendritic spine (ortholog); endosome (ortholog)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
beta-arrestin-2
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 4,191,040 - 4,202,382 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 4,191,172 - 4,202,385 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666059 17,439,881 - 17,451,765 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Imported Annotations - PID (archival)
ARRB2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 4,191,040 - 4,202,382 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 4,191,172 - 4,202,385 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666059 17,439,881 - 17,451,765 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
ARRB2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 4,710,632 - 4,721,497 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 4,710,596 - 4,721,499 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 4,613,927 - 4,624,792 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 4,560,538 - 4,571,544 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 4,560,537 - 4,571,543 NCBI Celera 17 4,629,166 - 4,639,975 (+) NCBI Celera Cytogenetic Map 17 p13.2 NCBI HuRef 17 4,502,952 - 4,513,866 (+) NCBI HuRef CHM1_1 17 4,622,557 - 4,633,518 (+) NCBI CHM1_1 T2T-CHM13v2.0 17 4,600,371 - 4,611,146 (+) NCBI T2T-CHM13v2.0
Arrb2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 70,323,051 - 70,331,654 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 70,323,461 - 70,331,654 (+) Ensembl GRCm39 Ensembl GRCm38 11 70,432,485 - 70,440,828 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 70,432,635 - 70,440,828 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 70,246,155 - 70,254,176 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 70,248,893 - 70,257,018 (+) NCBI MGSCv36 mm8 Celera 11 77,978,619 - 77,986,640 (+) NCBI Celera Cytogenetic Map 11 B3 NCBI cM Map 11 42.99 NCBI
Arrb2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 55,645,539 - 55,653,485 (+) NCBI GRCr8 mRatBN7.2 10 55,146,887 - 55,154,854 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 55,146,818 - 55,154,850 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 59,825,196 - 59,833,080 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 59,313,709 - 59,321,593 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 54,812,911 - 54,820,795 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 57,040,252 - 57,048,045 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 57,040,267 - 57,048,134 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 56,797,489 - 56,805,282 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 57,244,071 - 57,284,166 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 57,289,995 - 57,297,789 (+) NCBI Celera 10 54,285,120 - 54,301,063 (+) NCBI Celera Cytogenetic Map 10 q24 NCBI
Arrb2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955467 10,110,003 - 10,123,022 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955467 10,109,985 - 10,118,687 (+) NCBI ChiLan1.0 ChiLan1.0
ARRB2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 12,328,333 - 12,339,069 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 14,296,695 - 14,307,332 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 4,766,616 - 4,777,253 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 4,757,048 - 4,767,517 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 4,757,048 - 4,767,517 (+) Ensembl panpan1.1 panPan2
ARRB2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 5 31,831,208 - 31,838,875 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 5 31,829,864 - 31,839,454 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 5 31,968,270 - 31,977,918 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 5 31,934,052 - 31,943,706 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 5 31,934,872 - 31,943,667 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 5 31,900,361 - 31,910,009 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 5 31,860,046 - 31,869,691 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 5 32,036,284 - 32,045,935 (-) NCBI UU_Cfam_GSD_1.0
Arrb2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 52,719,545 - 52,727,921 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936677 3,172,925 - 3,181,520 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936677 3,173,054 - 3,181,475 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
ARRB2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 52,161,778 - 52,170,342 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 52,161,776 - 52,170,362 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 54,280,938 - 54,286,249 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Arrb2
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000011186 ⟹ ENSCSAP00000009268
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 16 4,191,172 - 4,202,385 (+) Ensembl
RefSeq Acc Id:
XM_008009931 ⟹ XP_008008122
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 16 4,191,075 - 4,202,382 (+) NCBI Vero_WHO_p1.0 NW_023666059 17,439,881 - 17,451,765 (-) NCBI
Sequence:
GCGCGAAGGGCTGGGGGCGGAGCCAGTGGCCCCGCGTGTCTGCTAGGAGAGGGCGGGCAGCGCCGCGGCGCGCGCGATCCGGCTGACGCATCTGGCCCCGGTTCCCCCAGACCAGAGCGGGGCCGGGA
hide sequence
RefSeq Acc Id:
XM_008009934 ⟹ XP_008008125
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 16 4,191,057 - 4,202,382 (+) NCBI Vero_WHO_p1.0 NW_023666059 17,439,881 - 17,451,765 (-) NCBI
Sequence:
CTCCCCGGCTGGGACGGAGCGCGAAGGGCTGGGGGCGGAGCCAGTGGCCCCGCGTGTCTGCTAG
hide sequence
RefSeq Acc Id:
XM_008009935 ⟹ XP_008008126
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 16 4,191,091 - 4,202,382 (+) NCBI Vero_WHO_p1.0 NW_023666059 17,439,881 - 17,451,765 (-) NCBI
Sequence:
GCGGAGCCAGTGGCCCCGCGTGTCTGCTAGGAGAGGGCGGGCAGCGCCGCGGCGCGCGCGATCC
hide sequence
RefSeq Acc Id:
XM_037987434 ⟹ XP_037843362
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source Vero_WHO_p1.0 NW_023666059 17,439,881 - 17,451,765 (-) NCBI
RefSeq Acc Id:
XM_037987435 ⟹ XP_037843363
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source Vero_WHO_p1.0 NW_023666059 17,439,881 - 17,451,765 (-) NCBI
RefSeq Acc Id:
XM_037987436 ⟹ XP_037843364
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source Vero_WHO_p1.0 NW_023666059 17,439,881 - 17,451,765 (-) NCBI
RefSeq Acc Id:
XP_008008125 ⟸ XM_008009934
- Peptide Label:
isoform X2
RefSeq Acc Id:
XP_008008122 ⟸ XM_008009931
- Peptide Label:
isoform X1
RefSeq Acc Id:
XP_008008126 ⟸ XM_008009935
- Peptide Label:
isoform X3
- UniProtKB:
A0A0D9RKX9 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000009268 ⟸ ENSCSAT00000011186
RefSeq Acc Id:
XP_037843363 ⟸ XM_037987435
- Peptide Label:
isoform X5
RefSeq Acc Id:
XP_037843362 ⟸ XM_037987434
- Peptide Label:
isoform X4
RefSeq Acc Id:
XP_037843364 ⟸ XM_037987436
- Peptide Label:
isoform X5
