D5Rat63 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D5Rat63

Symbol: D5Rat63
Previously known as: oxsts7226; R0074-A12; 
RGD ID: 38510
Expected Size: 214 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr85145,274,041 - 145,274,255 (+)Marker Load Pipeline
mRatBN7.25139,989,554 - 139,989,768 (+)MAPPERmRatBN7.2
Rnor_6.05145,726,049 - 145,726,262NCBIRnor6.0
Rnor_5.05149,494,416 - 149,494,629UniSTSRnor5.0
RGSC_v3.45147,065,698 - 147,065,912RGDRGSC3.4
RGSC_v3.45147,065,699 - 147,065,912UniSTSRGSC3.4
RGSC_v3.15147,075,738 - 147,075,951RGD
Celera5138,484,465 - 138,484,667UniSTS
RH 3.4 Map5936.6UniSTS
RH 3.4 Map5936.6RGD
RH 2.0 Map5152.9RGD
SHRSP x BN Map578.5699RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   SHR.BN-(D5Wox12-D5Wox20)/Ipcv   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Wbc1  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer TGATAGCCACAAGGGGTGAG
Reverse Primer GACAATCTCCCAGAGTTCCG
 
Strain, Expected Size(s)

ACI/N 203 AVN/Orl 203 BBDP/Rhw 203
BBDR/Rhw 203 BC/CpbU 203 BDIX/Han 203
BDVII/Cub 203 BN-Lx/Cub 225 BN/SsNHsd 225
BP/Cub 227 BUF/Pit 203 COP/OlaHsd 203
DA/PitN 203 DON/Melb 203 F344/Pit 203
FHH/Eur 203 GH/Omr 221 GK/KyoSwe 203
IS/Kyo 203 LE/Mol 225 LEW/Pit 203
LH/Mav 203 LN/Mav 203 LOU/CHan 203
M520/N 203 MHS/Gib 221 MNR/N 203
MNRA/N 203 MNS/Gib 203 MR/Pit 203
NEDH/K 203 NP9 203 ODU/N 203
OKA/Wsl 203 OM/Ztm 225 P5C 203
PVG/Pit 203 SD/Rij 203 SHR/OlaHsd 203
SR/Jr 203 SS/Jr 203 WAG/RijKyo 203
WF/Pit 203 WIST/Nhg 203 WKY/OlaHsd 203
WN/N 203 WTC/Kyo 203


GenBank Nucleotide DH636788 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 44 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat

1 to 10 of 44 rows


Database
Acc Id
Source(s)
NCBI Gene 444921 UniSTS