D17Rat123 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D17Rat123

Symbol: D17Rat123
Previously known as: oxsts9828; R0230-D12; 
RGD ID: 40198
Expected Size: 171 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81763,460,310 - 63,460,481 (+)Marker Load Pipeline
mRatBN7.21758,768,794 - 58,768,965 (-)MAPPERmRatBN7.2
Rnor_6.01765,739,231 - 65,739,401NCBIRnor6.0
Rnor_5.01767,489,835 - 67,490,005UniSTSRnor5.0
RGSC_v3.41769,337,501 - 69,337,672RGDRGSC3.4
RGSC_v3.41769,337,502 - 69,337,672UniSTSRGSC3.4
RGSC_v3.11769,348,334 - 69,348,505RGD
Celera1761,772,098 - 61,772,268UniSTS
SHRSP x BN Map1732.6999UniSTS
SHRSP x BN Map1732.6999RGD
Cytogenetic Map17q12.1UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Ryr2  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines


 
Forward Primer CACCATACTGAGGTGGGCTT
Reverse Primer GTGCCTAGGTGGTCTGTGGT
 
Strain, Expected Size(s)

ACI/N 158 AVN/Orl 158 BBDP/Rhw 158
BBDR/Rhw 158 BC/CpbU 158 BDIX/Han 158
BDVII/Cub 158 BN-Lx/Cub 168 BN/SsNHsd 168
BP/Cub 158 BUF/Pit 158 COP/OlaHsd 158
DA/PitN 158 DON/Melb 162 F344/Pit 158
FHH/Eur 158 GH/Omr 158 GK/KyoSwe 158
IS/Kyo 168 LEW/Pit 158 LH/Mav 158
LN/Mav 158 LOU/CHan 158 M520/N 158
MHS/Gib 158 MNR/N 158 MNRA/N 158
MNS/Gib 158 MR/Pit 158 NEDH/K 158
NP9 158 ODU/N 158 OKA/Wsl 158
OM/Ztm 158 P5C 158 PVG/Pit 158
SD/Rij 158 SHR/OlaHsd 158 SHRSP/Riv 158
SR/Jr 158 SS/Jr 158 WAG/RijKyo 158
WF/Pit 158 WIST/Nhg 158 WKY/OlaHsd 158
WN/N 158 WTC/Kyo 158


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
620314Ryr2ryanodine receptor 2175838992558975641Rat
GenBank Nucleotide AU049552 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 53 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171578159260781592Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
1354654Spl7Serum phospholipid level QTL 75.5blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)175089090860781592Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172129303960781592Rat
1354629Scl31Serum cholesterol level QTL 314.1blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)175089090860781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1600398Edcs5Endometrial carcinoma susceptibility QTL 52.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)175724672370852846Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318468653184Rat

1 to 10 of 53 rows


Database
Acc Id
Source(s)
NCBI Gene 689560 UniSTS