D2Rat73 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D2Rat73

Symbol: D2Rat73
Previously known as: oxsts6895; R031-B05; R0031-B05; 
RGD ID: 36145
Expected Size: 170 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2226,999,571 - 26,999,741 (+)MAPPERmRatBN7.2
Rnor_6.0226,267,995 - 26,268,162NCBIRnor6.0
Rnor_5.0245,399,390 - 45,399,557UniSTSRnor5.0
RGSC_v3.4226,101,089 - 26,101,256UniSTSRGSC3.4
RGSC_v3.4226,101,088 - 26,101,256RGDRGSC3.4
RGSC_v3.1226,021,458 - 26,021,625RGD
Celera223,061,384 - 23,061,537UniSTS
RH 3.4 Map213.3RGD
RH 3.4 Map213.3UniSTS
RH 2.0 Map281.9RGD
FHH x ACI Map214.1699RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Bp205   Pain1  
Genes:   Iqgap2   LOC100363987  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer AGTGCCAGCTGCTCCATAGT
Reverse Primer CCATGAATGGAGAGGTCACA
 
Strain, Expected Size(s)

AVN/Orl 172 BBDP/Rhw 172 BBDR/Rhw 160
BC/CpbU 158 BDIX/Han 158 BDVII/Cub 158
BN-Lx/Cub 168 BN/SsNHsd 168 BP/Cub 164
BUF/Pit 158 COP/OlaHsd 158 DA/PitN 166
DON/Melb 172 F344/Pit 172 FHH/Eur 172
GH/Omr 174 GK/KyoSwe 172 IS/Kyo 164
LE/Mol 172 LH/Mav 166 LN/Mav 158
LOU/CHan 166 M520/N 166 MHS/Gib 172
MNR/N 172 MNRA/N 172 MNS/Gib 172
MR/Pit 172 NEDH/K 158 NP9 162
ODU/N 166 OKA/Wsl 168 OM/Ztm 172
P5C 164 PVG/Pit 176 SD/Rij 166
SHR/OlaHsd 168 SHRSP/Riv 168 SR/Jr 158
SS/Jr 166 WAG/RijKyo 172 WF/Pit 172
WIST/Nhg 172 WKY/OlaHsd 172 WN/N 158
WTC/Kyo 172


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
2321734Iqgap2IQ motif containing GTPase activating protein 222689483627170270Rat
GenBank Nucleotide CH473955 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000232 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 30 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
10755430Coatc6Coat color QTL 60.02576coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)21159110056591100Rat
7387318Stl32Serum triglyceride level QTL 323.20.0003blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)22238462767384627Rat
631682Bp115Blood pressure QTL 1154.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2137410502Rat
10755499Bp389Blood pressure QTL 3892.61arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)218960362228801039Rat
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
731167Glom4Glomerulus QTL 42.40.0082kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)22030467265304672Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
738012Anxrr3Anxiety related response QTL 33.8exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)2902351954023519Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat

1 to 10 of 30 rows


Database
Acc Id
Source(s)
NCBI Gene 100302916 UniSTS
  100360623 UniSTS
  100363987 UniSTS
  544384 UniSTS