D10Rat156 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D10Rat156

Symbol: D10Rat156
Previously known as: oxsts8689; R0030-B12; 
RGD ID: 36087
Expected Size: 171 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81055,307,972 - 55,308,143 (+)Marker Load Pipeline
mRatBN7.21054,809,292 - 54,809,463 (+)MAPPERmRatBN7.2
Rnor_6.01056,698,730 - 56,698,900NCBIRnor6.0
Rnor_5.01056,440,444 - 56,440,614UniSTSRnor5.0
RGSC_v3.41056,930,545 - 56,930,717RGDRGSC3.4
RGSC_v3.41056,930,546 - 56,930,717UniSTSRGSC3.4
RGSC_v3.11056,944,071 - 56,944,354RGD
Celera1053,961,281 - 53,961,451UniSTS
SHRSP x BN Map1046.5699RGD
SHRSP x BN Map1046.5699UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Cm33  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines


 
Forward Primer ATGGACCCAAGATGGACAGT
Reverse Primer GGATTACTCTCTAATATAGCCCCA
 
Template 
GCCTGCAGGTCGACTCTAGAGGATCCCCACATGTGGTGTAAGGATTACTCTCTAATATAGCCCC
ACTGNACNCTACCCAGTTACTCTCAAGCATNTGTGTGTGTGTGTGTGTGTGAGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTATGNTNGTGTAAGAATTCCTCTCCTCTATTCGNAACCCCACTGTCC
ATCTTGGGTCCATGGGATGCAAGCCAACTGGCGNTCATGCCATTTCGNGCTGTGTGAGNGANAG
GCAGGGAGAAGGCGTGAAAGGTCTTGGCATGATGAGATTCAGCCTC
Strain, Expected Size(s)

ACI/N 172 AVN/Orl 168 BBDP/Rhw 162
BBDR/Rhw 162 BC/CpbU 162 BDIX/Han 168
BDVII/Cub 166 BN-Lx/Cub 174 BN/SsNHsd 174
BP/Cub 172 BUF/Pit 166 COP/OlaHsd 162
DA/PitN 172 DON/Melb 172 F344/Pit 172
FHH/Eur 170 GH/Omr 168 GK/KyoSwe 162
IS/Kyo 168 LE/Mol 168 LEW/Pit 168
LH/Mav 166 LN/Mav 174 LOU/CHan 168
M520/N 172 MHS/Gib 168 MNR/N 168
MNRA/N 168 MNS/Gib 170 MR/Pit 168
NEDH/K 145 NP9 170 ODU/N 168
OKA/Wsl 168 OM/Ztm 157 P5C 170
PVG/Pit 168 SD/Rij 166 SHR/OlaHsd 168
SHRSP/Riv 168 SR/Jr 166 SS/Jr 166
WAG/RijKyo 168 WF/Pit 166 WIST/Nhg 170
WKY/OlaHsd 168 WN/N 168 WTC/Kyo 168


GenBank Nucleotide CH473948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 77 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103539245763642539Rat
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105057470795574707Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101147401056474010Rat
152025229Scl83Serum cholesterol level QTL 834.33blood cholesterol amount (VT:0000180)103571058068663659Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103129743976297439Rat
152025227Bw195Body weight QTL 1955.73body mass (VT:0001259)104698969968663659Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101527595560275955Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102652195798003205Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)104944455181709989Rat
152025224Bw193Body weight QTL 1936.47body mass (VT:0001259)105166340575085664Rat

1 to 10 of 77 rows


Database
Acc Id
Source(s)
NCBI Gene 544501 UniSTS