D6Arb7 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D6Arb7

Symbol: D6Arb7
Previously known as: oxsts7933; Vsnl1; 
RGD ID: 11488
Expected Size: 219 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8639,758,630 - 39,758,849 (+)Marker Load Pipeline
mRatBN7.2634,039,550 - 34,039,769 (+)MAPPERmRatBN7.2
Rnor_6.0637,002,270 - 37,002,488NCBIRnor6.0
Rnor_5.0646,752,383 - 46,752,601UniSTSRnor5.0
RGSC_v3.4634,770,962 - 34,771,181RGDRGSC3.4
RGSC_v3.4634,770,963 - 34,771,181UniSTSRGSC3.4
RGSC_v3.1634,773,915 - 34,774,134RGD
Celera633,440,006 - 33,440,224UniSTS
SHRSP x BN Map628.5599UniSTS
SHRSP x BN Map628.5599RGD
FHH x ACI Map629.35RGD
Cytogenetic Map6q14UniSTS
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr  
Genes:   Vsnl1  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines
5. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer AAAGAAGCTGCAAAAAGCGACC
Reverse Primer CAAACACAAGAAGCAAGTCC
 
Strain, Expected Size(s)

ACI/N 219 BBDP/Rhw 219 BBDR/Rhw 219
BC/CpbU 219 BDIX/Han 219 BN-Lx/Cub 219
BN/SsNHsd 219 BP/Cub 219 BUF/Pit 219
DA/PitN 217 DON/Melb 217 F344/Pit 217
FHH/Eur 217 GH/Omr 217 GK/KyoSwe 217
IS/Kyo 213 LE/Mol 217 LEW/Pit 217
LH/Mav 217 LN/Mav 217 LOU/CHan 217
M520/N 217 MHS/Gib 219 MNR/N 219
MNRA/N 217 MNS/Gib 219 MR/Pit 217
NEDH/K 217 NP9 219 ODU/N 217
OKA/Wsl 223 OM/Ztm 217 P5C 219
PVG/Pit 219 SD/Rij 219 SHR/OlaHsd 223
SHRSP/Riv 223 SR/Jr 223 SS/Jr 217
WAG/RijKyo 217 WF/Pit 219 WIST/Nhg 217
WKY/OlaHsd 217 WN/N 219 WTC/Kyo 217


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
3966Vsnl1visinin-like 163403864134159479Rat



1 to 10 of 30 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
8552962Pigfal16Plasma insulin-like growth factor 1 level QTL 169.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)6141223769Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1331743Uae28Urinary albumin excretion QTL 284.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)6134235784Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat
9589129Insul24Insulin level QTL 2419.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)6141223769Rat
1578758Tcas9Tongue tumor susceptibility QTL 93.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)6137618905Rat

1 to 10 of 30 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 24877 UniSTS
NCBI Nucleotide D10666