Mir21 (microRNA 21) - Rat Genome Database

Name: Mir21
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Functional Annotation unavailable	Annotation Distribution unavailable	Genomic Variants unavailble Genomic Variants unavailable
Functional Annotation	Annotation Distribution	Genomic Variants

Protein-Protein Interactions unavailable	Genome Viewer unavailable	Damaging Variants unavailble Damaging Variants unavailable
Protein-Protein Interactions	Genome Viewer	Damaging Variants

Annotation Comparison unavailable	OLGA unavailable
Annotation Comparison	OLGA	Excel (Download)

Gene Enrichment unavailable	Ortholog Finder unavailable
Gene Enrichment	Ortholog Finder

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir21 (microRNA 21) Rattus norvegicus

Analyze

General
Array IDs
References

Symbol:

Mir21

Name:

microRNA 21

Description:

Involved in wound healing. Orthologous to human MIR21 (microRNA 21); INTERACTS WITH (R)-lipoic acid; 17beta-estradiol; 2-acetamidofluorene.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

microRNA mir-21; rno-mir-21

Orthologs:

Homo sapiens (human) : MIR21 (microRNA 21) HGNC Alliance
Mus musculus (house mouse) : Mir21a (microRNA 21a) MGI
Canis lupus familiaris (dog) : MIR21 (microRNA mir-21)
Sus scrofa (pig) : MIR21 (microRNA mir-21)

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MIR21 (microRNA 21)	HGNC	Ensembl
Mus musculus (house mouse):	Mir21a (microRNA 21a)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MIR21 (microRNA mir-21)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	MIR21 (microRNA mir-21)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Alliance orthologs ³
Homo sapiens (human):	MIR21 (microRNA 21)	Alliance	DIOPT (HGNC)

Latest Assembly:

Rnor_6.0 - RGSC Genome Assembly v6.0

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	10	73,902,210 - 73,902,301 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	10	76,197,081 - 76,197,172 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	10	70,326,375 - 70,326,466 (-)	NCBI		Celera
Cytogenetic Map	10	q26	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

RGD Manual Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
hepatoblastoma		ISO	RGD:1349265	14695023	miRNA:increased expression:plasma, extracellular exosome	RGD
hepatocellular carcinoma		ISO	RGD:1349265	14695022	miRNA:increased expression:liver	RGD
intrahepatic cholangiocarcinoma		ISO	RGD:1349265	14928335	RNA:increased expression:liver, plasma	RGD
liver cirrhosis	onset	IEP		14695024	associated with nonalcoholic fatty liver disease, miRNA:increased expression:liver, plasma	RGD
Varicose Ulcer		ISO	RGD:1349265	10412021	miRNA:increased expression:skin:	RGD

Imported Annotations - CTD

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Cardiomegaly		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:17525252
Chemical and Drug Induced Liver Injury		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28545106
Disease Progression		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27816459
endometriosis		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:21063030
Esophageal Neoplasms		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:21248297
Fibrosis		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:23469132
heart disease		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:29355689
Inflammation		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:29355689
kidney disease		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:23469132
Lung Neoplasms		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:27323401
Microsatellite Instability		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:25701956
Myocardial Reperfusion Injury		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:22050707
Neoplasm Invasiveness		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:29501572
Neoplastic Cell Transformation		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism, therapeutic	CTD	PMID:27323401 more ...
obesity		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:23954404
Prostatic Neoplasms		ISO	RGD:1349265	11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:23272133
Weight Gain		ISO	RGD:1608349	11554173	CTD Direct Evidence: therapeutic	CTD	PMID:26996129

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
(-)-Arctigenin	decreases expression	ISO	RGD:1349265	6480464	arctigenin results in decreased expression of MIR21 mRNA	CTD	PMID:25380086
(-)-Arctigenin	multiple interactions	ISO	RGD:1349265	6480464	arctigenin inhibits the reaction [Quercetin results in increased expression of MIR21 mRNA]	CTD	PMID:25380086
(R)-lipoic acid	multiple interactions	EXP		6480464	Cyclosporine inhibits the reaction [Thioctic Acid promotes the reaction [Acetic Acid results in increased expression of MIR21 mRNA]], Thioctic Acid promotes the reaction [Acetic Acid results in increased expression of MIR21 mRNA]	CTD	PMID:26276312
17beta-estradiol	multiple interactions	ISO	RGD:1349265	6480464	afimoxifene inhibits the reaction [Estradiol results in decreased expression of MIR21 mRNA] more ...	CTD	PMID:19264808 more ...
17beta-estradiol	increases expression	EXP		6480464	Estradiol results in increased expression of MIR21 mRNA	CTD	PMID:26945725
17beta-estradiol	decreases expression	ISO	RGD:1349265	6480464	Estradiol results in decreased expression of MIR21 mRNA	CTD	PMID:19264808 more ...
17beta-hydroxy-5alpha-androstan-3-one	multiple interactions	ISO	RGD:1349265	6480464	bicalutamide inhibits the reaction [Dihydrotestosterone results in increased expression of MIR21 mRNA] more ...	CTD	PMID:23052036
17beta-hydroxy-5alpha-androstan-3-one	increases expression	ISO	RGD:1349265	6480464	Dihydrotestosterone results in increased expression of MIR21 mRNA	CTD	PMID:23052036, PMID:29581250
2,3-bis(4-hydroxyphenyl)propionitrile	decreases expression	ISO	RGD:1349265	6480464	2, 3-bis(4-hydroxyphenyl)-propionitrile results in decreased expression of MIR21 mRNA	CTD	PMID:19264808
2-acetamidofluorene	increases expression	EXP		6480464	2-Acetylaminofluorene results in increased expression of MIR21 mRNA	CTD	PMID:19167416
2-hydroxypropanoic acid	increases expression	ISO	RGD:1349265	6480464	Lactic Acid results in increased expression of MIR21 mRNA	CTD	PMID:30851411
3,7-dihydropurine-6-thione	increases expression	EXP		6480464	Mercaptopurine results in increased expression of MIR21 mRNA	CTD	PMID:23358152
acetic acid	multiple interactions	EXP		6480464	Cyclosporine inhibits the reaction [Thioctic Acid promotes the reaction [Acetic Acid results in increased expression of MIR21 mRNA]] more ...	CTD	PMID:26276312
acetic acid	increases expression	EXP		6480464	Acetic Acid results in increased expression of MIR21 mRNA	CTD	PMID:26276312
actinomycin D	multiple interactions	ISO	RGD:1349265	6480464	Dactinomycin inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA] more ...	CTD	PMID:19264808 more ...
afimoxifene	increases expression	ISO	RGD:1349265	6480464	afimoxifene results in increased expression of MIR21 mRNA	CTD	PMID:19264808
afimoxifene	multiple interactions	ISO	RGD:1349265	6480464	afimoxifene inhibits the reaction [Estradiol results in decreased expression of MIR21 mRNA]	CTD	PMID:19264808
aflatoxin B1	increases expression	EXP		6480464	Aflatoxin B1 results in increased expression of MIR21 mRNA	CTD	PMID:24472605
all-trans-retinoic acid	increases expression	ISO	RGD:1349265	6480464	Tretinoin results in increased expression of MIR21 mRNA	CTD	PMID:21934132
all-trans-retinoic acid	multiple interactions	ISO	RGD:1349265	6480464	[Tretinoin co-treated with Phenylbutyrates co-treated with 1-hydroxy-2-oxo-3, 3-bis(2-aminoethyl)-1-triazene] results in increased expression of MIR21 mRNA	CTD	PMID:23284745
anthra[1,9-cd]pyrazol-6(2H)-one	affects expression	ISO	RGD:1349265	6480464	pyrazolanthrone affects the expression of MIR21 mRNA	CTD	PMID:24434654
anthra[1,9-cd]pyrazol-6(2H)-one	multiple interactions	ISO	RGD:1349265	6480464	pyrazolanthrone affects the reaction [arsenic trichloride affects the expression of MIR21 mRNA]	CTD	PMID:24434654
antirheumatic drug	decreases expression	ISO	RGD:1349265	6480464	Antirheumatic Agents results in decreased expression of MIR21 mRNA	CTD	PMID:24449571
aristolochic acid	increases expression	EXP		6480464	aristolochic acid I results in increased expression of MIR21 mRNA	CTD	PMID:27422293
arsane	increases expression	ISO	RGD:1349265	6480464	Arsenic results in increased expression of MIR21 mRNA	CTD	PMID:18039032
arsenic atom	increases expression	ISO	RGD:1349265	6480464	Arsenic results in increased expression of MIR21 mRNA	CTD	PMID:18039032
arsenic trichloride	multiple interactions	ISO	RGD:1349265	6480464	MIR21 mRNA affects the reaction [arsenic trichloride results in increased expression of RIOX2 mRNA] more ...	CTD	PMID:24434654
arsenic trichloride	affects expression	ISO	RGD:1349265	6480464	arsenic trichloride affects the expression of MIR21 mRNA	CTD	PMID:24434654
arsenic(3+)	increases expression	ISO	RGD:1349265	6480464	Arsenic results in increased expression of MIR21 mRNA	CTD	PMID:18039032
arsenite(3-)	increases expression	ISO	RGD:1349265	6480464	arsenite results in increased expression of MIR21 mRNA	CTD	PMID:22387281, PMID:23469214
arsenite(3-)	multiple interactions	ISO	RGD:1608349	6480464	CAT protein inhibits the reaction [arsenite results in increased expression of MIR21 mRNA]	CTD	PMID:22387281
arsenite(3-)	increases expression	ISO	RGD:1608349	6480464	arsenite results in increased expression of MIR21 mRNA	CTD	PMID:22387281
arsenite(3-)	multiple interactions	ISO	RGD:1349265	6480464	3-(4-methylphenylsulfonyl)-2-propenenitrile inhibits the reaction [arsenite promotes the reaction [RELA protein binds to MIR21 promoter]] more ...	CTD	PMID:22387281
baicalein	multiple interactions	ISO	RGD:1349265	6480464	baicalein inhibits the reaction [TGFB1 protein results in increased expression of MIR21 mRNA], MIR21 mRNA inhibits the reaction [baicalein inhibits the reaction [TGFB1 protein results in increased expression of ACTA2 protein]]	CTD	PMID:30201452
bicalutamide	multiple interactions	ISO	RGD:1349265	6480464	bicalutamide inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA] more ...	CTD	PMID:23052036, PMID:25969534
biphenyl-4-amine	increases expression	ISO	RGD:1349265	6480464	4-biphenylamine results in increased expression of MIR21 mRNA	CTD	PMID:24857880
bis(2-chloroethyl) sulfide	decreases expression	ISO	RGD:1608349	6480464	Mustard Gas results in decreased expression of MIR21A mRNA	CTD	PMID:26456178
bisphenol A	affects expression	ISO	RGD:1349265	6480464	bisphenol A affects the expression of MIR21 mRNA	CTD	PMID:20170705, PMID:22403704
bisphenol A	multiple interactions	ISO	RGD:1608349	6480464	MAP2K3 protein inhibits the reaction [MIR21A mRNA inhibits the reaction [bisphenol A results in increased expression of ADIPOQ mRNA]] more ...	CTD	PMID:26996129
bisphenol A	decreases expression	ISO	RGD:1608349	6480464	bisphenol A results in decreased expression of MIR21A mRNA	CTD	PMID:26996129
bisphenol A	increases expression	ISO	RGD:1608349	6480464	bisphenol A results in increased expression of MIR21 mRNA	CTD	PMID:28774890
bisphenol A	decreases expression	ISO	RGD:1349265	6480464	bisphenol A results in decreased expression of MIR21 mRNA	CTD	PMID:23629000
bisphenol A	multiple interactions	ISO	RGD:1349265	6480464	ESR1 protein affects the reaction [bisphenol A affects the expression of MIR21 mRNA]	CTD	PMID:22403704
bisphenol A	increases expression	ISO	RGD:1349265	6480464	bisphenol A results in increased expression of MIR21 mRNA	CTD	PMID:20417706
bleomycin A2	increases expression	EXP		6480464	Bleomycin results in increased expression of MIR21 mRNA	CTD	PMID:25933445
bortezomib	increases expression	ISO	RGD:1349265	6480464	Bortezomib results in increased expression of MIR21 mRNA	CTD	PMID:20977926
cadmium atom	decreases expression	ISO	RGD:1349265	6480464	Cadmium results in decreased expression of MIR21 mRNA	CTD	PMID:24376830
cadmium dichloride	decreases expression	ISO	RGD:1349265	6480464	Cadmium Chloride results in decreased expression of MIR21 mRNA	CTD	PMID:20145152, PMID:26314618
carbamazepine	increases expression	ISO	RGD:1349265	6480464	Carbamazepine results in increased expression of MIR21 mRNA	CTD	PMID:29644860
carbon atom	increases expression	ISO	RGD:1349265	6480464	Carbon results in increased expression of MIR21 mRNA	CTD	PMID:26068961
chromium(6+)	multiple interactions	ISO	RGD:1349265	6480464	Acetylcysteine inhibits the reaction [chromium hexavalent ion results in increased expression of MIR21 mRNA] more ...	CTD	PMID:27323401 more ...
chromium(6+)	increases expression	ISO	RGD:1608349	6480464	chromium hexavalent ion results in increased expression of MIR21 mRNA	CTD	PMID:27323401
chromium(6+)	increases response to substance	ISO	RGD:1349265	6480464	MIR21 mRNA results in increased susceptibility to chromium hexavalent ion	CTD	PMID:27344173
chromium(6+)	increases expression	ISO	RGD:1349265	6480464	chromium hexavalent ion results in increased expression of MIR21 mRNA	CTD	PMID:27323401 more ...
cisplatin	increases expression	EXP		6480464	Cisplatin results in increased expression of MIR21 mRNA	CTD	PMID:24880025
cisplatin	multiple interactions	ISO	RGD:1349265	6480464	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [[MIR21 mRNA results in decreased susceptibility to Cisplatin] which results in increased phosphorylation of AKT1 protein] more ...	CTD	PMID:23466500
cisplatin	decreases response to substance	ISO	RGD:1349265	6480464	MIR21 mRNA results in decreased susceptibility to Cisplatin	CTD	PMID:23466500
cisplatin	increases expression	ISO	RGD:1349265	6480464	Cisplatin results in increased expression of MIR21 mRNA	CTD	PMID:20145152
cobalt atom	multiple interactions	ISO	RGD:1608349	6480464	[tungsten carbide analog co-treated with Cobalt analog] results in increased expression of MIR21 mRNA	CTD	PMID:23758151
cobalt(2+)	multiple interactions	ISO	RGD:1608349	6480464	[tungsten carbide analog co-treated with Cobalt analog] results in increased expression of MIR21 mRNA	CTD	PMID:23758151
copper atom	decreases expression	EXP		6480464	Copper results in decreased expression of MIR21 mRNA	CTD	PMID:30556269
copper(0)	decreases expression	EXP		6480464	Copper results in decreased expression of MIR21 mRNA	CTD	PMID:30556269
copper(2+)	decreases expression	EXP		6480464	Copper results in decreased expression of MIR21 mRNA	CTD	PMID:30556269
coumestrol	multiple interactions	ISO	RGD:1349265	6480464	[Coumestrol co-treated with 2, 3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of MIR21 mRNA	CTD	PMID:19167446
curcumin	decreases expression	ISO	RGD:1349265	6480464	Curcumin results in decreased expression of MIR21 mRNA	CTD	PMID:29723631
cycloheximide	multiple interactions	ISO	RGD:1349265	6480464	Cycloheximide inhibits the reaction [Dihydrotestosterone results in increased expression of MIR21 mRNA] more ...	CTD	PMID:19264808, PMID:23052036
cycloheximide	increases expression	ISO	RGD:1349265	6480464	Cycloheximide results in increased expression of MIR21 mRNA	CTD	PMID:23052036
cyclosporin A	multiple interactions	EXP		6480464	Cyclosporine inhibits the reaction [Thioctic Acid promotes the reaction [Acetic Acid results in increased expression of MIR21 mRNA]], Cyclosporine promotes the reaction [Acetic Acid results in increased expression of MIR21 mRNA]	CTD	PMID:26276312
daunorubicin	decreases response to substance	ISO	RGD:1349265	6480464	MIR21 results in decreased susceptibility to Daunorubicin	CTD	PMID:21187093
DDT	decreases expression	ISO	RGD:1349265	6480464	DDT results in decreased expression of MIR21 mRNA	CTD	PMID:22403704
dehydroepiandrosterone	increases expression	ISO	RGD:1349265	6480464	Dehydroepiandrosterone results in increased expression of MIR21 mRNA	CTD	PMID:25969534
dehydroepiandrosterone	multiple interactions	ISO	RGD:1349265	6480464	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA] more ...	CTD	PMID:25969534
diallyl trisulfide	decreases expression	ISO	RGD:1349265	6480464	diallyl trisulfide results in decreased expression of MIR21 mRNA	CTD	PMID:23430952
dioxygen	increases expression	EXP		6480464	Oxygen results in increased expression of MIR21 mRNA	CTD	PMID:22911455
dorsomorphin	multiple interactions	ISO	RGD:1349265	6480464	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ...	CTD	PMID:27188386
doxorubicin	increases expression	ISO	RGD:1349265	6480464	Doxorubicin results in increased expression of MIR21 mRNA	CTD	PMID:26842497
elemental carbon	increases expression	ISO	RGD:1349265	6480464	Carbon results in increased expression of MIR21 mRNA	CTD	PMID:26068961
Enterolactone	multiple interactions	ISO	RGD:1349265	6480464	[Coumestrol co-treated with 2, 3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of MIR21 mRNA	CTD	PMID:19167446
fenhexamid	increases expression	ISO	RGD:1349265	6480464	N-(2, 3-dichloro-4-hydroxyphenyl)-1-methylcyclohexanecarboxamide results in increased expression of MIR21 mRNA	CTD	PMID:23052036
fenhexamid	multiple interactions	ISO	RGD:1349265	6480464	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [N-(2 more ...	CTD	PMID:23052036
ferulic acid	multiple interactions	EXP		6480464	[resveratrol co-treated with Phytic Acid co-treated with ferulic acid co-treated with Quercetin] results in increased expression of MIR21 mRNA	CTD	PMID:21203465
fludioxonil	multiple interactions	ISO	RGD:1349265	6480464	2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [fludioxonil results in increased expression of MIR21 mRNA] more ...	CTD	PMID:23052036
fludioxonil	increases expression	ISO	RGD:1349265	6480464	fludioxonil results in increased expression of MIR21 mRNA	CTD	PMID:23052036
formaldehyde	decreases expression	ISO	RGD:1349265	6480464	Formaldehyde results in decreased expression of MIR21 mRNA	CTD	PMID:21147603
fulvestrant	multiple interactions	ISO	RGD:1349265	6480464	4-(6-bromo-1 more ...	CTD	PMID:19264808 more ...
fulvestrant	increases expression	ISO	RGD:1349265	6480464	fulvestrant results in increased expression of MIR21 mRNA	CTD	PMID:25969534
geldanamycin	increases expression	ISO	RGD:1349265	6480464	geldanamycin results in increased expression of MIR21 mRNA	CTD	PMID:26705709
gentamycin	increases expression	EXP		6480464	Gentamicins results in increased expression of MIR21 mRNA	CTD	PMID:22705808, PMID:24863737
halothane	affects expression	ISO	RGD:1608349	6480464	Halothane affects the expression of MIR21A mRNA	CTD	PMID:24598351
hydrogen peroxide	multiple interactions	ISO	RGD:1349265	6480464	CAT protein inhibits the reaction [Hydrogen Peroxide results in increased expression of MIR21 mRNA]	CTD	PMID:22387281
hydrogen peroxide	affects expression	ISO	RGD:1349265	6480464	Hydrogen Peroxide affects the expression of MIR21 mRNA	CTD	PMID:26339600
hydrogen peroxide	increases expression	ISO	RGD:1349265	6480464	Hydrogen Peroxide results in increased expression of MIR21 mRNA	CTD	PMID:22387281
icariin	increases expression	ISO	RGD:1608349	6480464	icariin results in increased expression of MIR21A mRNA	CTD	PMID:30533443
isoprenaline	increases expression	EXP		6480464	Isoproterenol results in increased expression of MIR21 mRNA	CTD	PMID:28526319, PMID:29355689
lamotrigine	increases expression	ISO	RGD:1349265	6480464	lamotrigine results in increased expression of MIR21 mRNA	CTD	PMID:29644860
lipoic acid	multiple interactions	EXP		6480464	Cyclosporine inhibits the reaction [Thioctic Acid promotes the reaction [Acetic Acid results in increased expression of MIR21 mRNA]], Thioctic Acid promotes the reaction [Acetic Acid results in increased expression of MIR21 mRNA]	CTD	PMID:26276312
LY294002	decreases expression	ISO	RGD:1349265	6480464	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in decreased expression of MIR21 mRNA	CTD	PMID:23272133
LY294002	multiple interactions	ISO	RGD:1349265	6480464	2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [[MIR21 mRNA results in decreased susceptibility to Cisplatin] which results in increased phosphorylation of AKT1 protein], 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [MIR21 mRNA results in decreased susceptibility to Cisplatin]	CTD	PMID:23466500
medroxyprogesterone acetate	increases expression	ISO	RGD:1349265	6480464	Medroxyprogesterone Acetate results in increased expression of MIR21 mRNA	CTD	PMID:22543862
mercaptopurine	increases expression	EXP		6480464	Mercaptopurine results in increased expression of MIR21 mRNA	CTD	PMID:23358152
methapyrilene	increases expression	EXP		6480464	Methapyrilene results in increased expression of MIR21 mRNA	CTD	PMID:24880025
methyl beta-cyclodextrin	multiple interactions	ISO	RGD:1349265	6480464	methyl-beta-cyclodextrin inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA]	CTD	PMID:25969534
methylmercury chloride	increases expression	ISO	RGD:1349265	6480464	methylmercuric chloride results in increased expression of MIR21 mRNA	CTD	PMID:28001369
morphine	decreases expression	ISO	RGD:1349265	6480464	Morphine results in decreased expression of MIR21	CTD	PMID:20564181
myo-inositol hexakisphosphate	multiple interactions	EXP		6480464	[resveratrol co-treated with Phytic Acid co-treated with ferulic acid co-treated with Quercetin] results in increased expression of MIR21 mRNA	CTD	PMID:21203465
N-acetyl-L-cysteine	multiple interactions	ISO	RGD:1349265	6480464	Acetylcysteine inhibits the reaction [chromium hexavalent ion results in increased expression of MIR21 mRNA], Acetylcysteine inhibits the reaction [Vehicle Emissions affects the expression of MIR21 mRNA]	CTD	PMID:23584289, PMID:27323401
N-methyl-N'-nitro-N-nitrosoguanidine	increases expression	ISO	RGD:1349265	6480464	Methylnitronitrosoguanidine results in increased expression of MIR21 mRNA	CTD	PMID:24821435
nickel atom	increases expression	ISO	RGD:1349265	6480464	Nickel results in increased expression of MIR21 mRNA	CTD	PMID:23195993
nickel dichloride	multiple interactions	ISO	RGD:1349265	6480464	3-(4-methylphenylsulfonyl)-2-propenenitrile inhibits the reaction [nickel chloride results in increased expression of MIR21 mRNA] more ...	CTD	PMID:26026961
nickel dichloride	increases expression	ISO	RGD:1349265	6480464	nickel chloride results in increased expression of MIR21 mRNA	CTD	PMID:26026961
nickel sulfate	increases expression	ISO	RGD:1349265	6480464	nickel sulfate results in increased expression of MIR21 mRNA	CTD	PMID:22714537
nitrofen	increases expression	EXP		6480464	nitrofen results in increased expression of MIR21 mRNA	CTD	PMID:26720608
notoginsenoside R1	multiple interactions	ISO	RGD:1608349	6480464	notoginsenoside R1 inhibits the reaction [APOE gene mutant form results in increased expression of MIR21A mRNA]	CTD	PMID:24933211
ochratoxin A	decreases expression	ISO	RGD:1349265	6480464	ochratoxin A results in decreased expression of MIR21 mRNA	CTD	PMID:30559759
ochratoxin A	increases expression	ISO	RGD:1608349	6480464	ochratoxin A results in increased expression of MIR21A mRNA	CTD	PMID:28710020
paracetamol	increases expression	EXP		6480464	Acetaminophen results in increased expression of MIR21 mRNA	CTD	PMID:27397436
paracetamol	affects expression	ISO	RGD:1608349	6480464	Acetaminophen affects the expression of MIR21A mRNA	CTD	PMID:19246379
paracetamol	increases expression	ISO	RGD:1349265	6480464	Acetaminophen results in increased expression of MIR21 mRNA	CTD	PMID:25092309, PMID:28545106
paraquat	multiple interactions	ISO	RGD:1608349	6480464	plant extract, Puerariae Radix inhibits the reaction [Paraquat results in increased expression of MIR21 mRNA]	CTD	PMID:26758514
paraquat	increases expression	ISO	RGD:1608349	6480464	Paraquat results in increased expression of MIR21 mRNA	CTD	PMID:26758514
perfluorooctane-1-sulfonic acid	increases expression	EXP		6480464	perfluorooctane sulfonic acid results in increased expression of MIR21 mRNA	CTD	PMID:24420840
phenylephrine	increases expression	EXP		6480464	Phenylephrine results in increased expression of MIR21 mRNA	CTD	PMID:17525252
phenylmercury acetate	increases expression	ISO	RGD:1349265	6480464	Phenylmercuric Acetate results in increased expression of MIR21 mRNA	CTD	PMID:26272509
phenylmercury acetate	multiple interactions	ISO	RGD:1349265	6480464	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1, 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MIR21 mRNA	CTD	PMID:27188386
PhIP	decreases expression	ISO	RGD:1349265	6480464	2-amino-1-methyl-6-phenylimidazo(4, 5-b)pyridine results in decreased expression of MIR21 mRNA	CTD	PMID:24877718
piperacillin	increases expression	ISO	RGD:1349265	6480464	Piperacillin results in increased expression of MIR21 mRNA	CTD	PMID:29644860
potassium bromate	increases expression	ISO	RGD:1349265	6480464	potassium bromate results in increased expression of MIR21 mRNA	CTD	PMID:30559759
purine-6-thiol	increases expression	EXP		6480464	Mercaptopurine results in increased expression of MIR21 mRNA	CTD	PMID:23358152
quercetin	multiple interactions	EXP		6480464	[resveratrol co-treated with Phytic Acid co-treated with ferulic acid co-treated with Quercetin] results in increased expression of MIR21 mRNA	CTD	PMID:21203465
quercetin	decreases expression	EXP		6480464	Quercetin results in decreased expression of MIR21 mRNA	CTD	PMID:26432773
quercetin	increases expression	ISO	RGD:1349265	6480464	Quercetin results in increased expression of MIR21 mRNA	CTD	PMID:25380086
quercetin	multiple interactions	ISO	RGD:1349265	6480464	[Quercetin co-treated with hyperoside] results in decreased expression of MIR21 mRNA more ...	CTD	PMID:25354548 more ...
quercetin 3-O-beta-D-galactopyranoside	multiple interactions	ISO	RGD:1349265	6480464	[Quercetin co-treated with hyperoside] results in decreased expression of MIR21 mRNA more ...	CTD	PMID:25354548
rac-lactic acid	increases expression	ISO	RGD:1349265	6480464	Lactic Acid results in increased expression of MIR21 mRNA	CTD	PMID:30851411
resveratrol	increases expression	EXP		6480464	resveratrol results in increased expression of MIR21 mRNA	CTD	PMID:21203465
resveratrol	affects expression	EXP		6480464	resveratrol affects the expression of MIR21 mRNA	CTD	PMID:22050707, PMID:24447120
resveratrol	affects response to substance	ISO	RGD:1349265	6480464	MIR21 mRNA affects the susceptibility to resveratrol	CTD	PMID:23272133
resveratrol	decreases response to substance	ISO	RGD:1349265	6480464	resveratrol results in decreased susceptibility to MIR21 mRNA	CTD	PMID:23359184
resveratrol	decreases expression	ISO	RGD:1349265	6480464	resveratrol results in decreased expression of MIR21 mRNA	CTD	PMID:20637737 more ...
resveratrol	multiple interactions	ISO	RGD:1349265	6480464	MIR21 mRNA inhibits the reaction [resveratrol results in decreased expression of BCL2 protein] more ...	CTD	PMID:23359184, PMID:24535223
resveratrol	multiple interactions	EXP		6480464	[resveratrol co-treated with Phytic Acid co-treated with ferulic acid co-treated with Quercetin] results in increased expression of MIR21 mRNA	CTD	PMID:21203465
rifampicin	increases expression	ISO	RGD:1349265	6480464	Rifampin results in increased expression of MIR21 mRNA	CTD	PMID:24552687
SB 431542	multiple interactions	ISO	RGD:1349265	6480464	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ...	CTD	PMID:27188386
sodium arsenite	multiple interactions	ISO	RGD:1349265	6480464	MIR21 mRNA affects the reaction [sodium arsenite results in decreased expression of MTOR protein] more ...	CTD	PMID:27107786
sodium arsenite	increases expression	ISO	RGD:1349265	6480464	sodium arsenite results in increased expression of MIR21 mRNA	CTD	PMID:27054085, PMID:27107786
Solasodine	decreases expression	ISO	RGD:1349265	6480464	solasodine results in decreased expression of MIR21 mRNA	CTD	PMID:28283413
Sporidesmin	multiple interactions	ISO	RGD:1349265	6480464	MIR21 mRNA affects the reaction [sporidesmin affects the expression of CYP2C8 mRNA], MIR21 mRNA affects the reaction [sporidesmin results in increased expression of CYP2C18 mRNA]	CTD	PMID:28193462
Sporidesmin	increases expression	ISO	RGD:1349265	6480464	sporidesmin results in increased expression of MIR21 mRNA	CTD	PMID:28193462
stattic	multiple interactions	ISO	RGD:1349265	6480464	stattic affects the reaction [arsenic trichloride affects the expression of MIR21 mRNA]	CTD	PMID:24434654
stattic	affects expression	ISO	RGD:1349265	6480464	stattic affects the expression of MIR21 mRNA	CTD	PMID:24434654
sulfamethoxazole	increases expression	ISO	RGD:1349265	6480464	Sulfamethoxazole results in increased expression of MIR21 mRNA	CTD	PMID:29644860
tacrolimus hydrate	increases expression	ISO	RGD:1608349	6480464	Tacrolimus results in increased expression of MIR21A mRNA	CTD	PMID:29362864
tetrachloromethane	affects expression	EXP		6480464	Carbon Tetrachloride affects the expression of MIR21 mRNA	CTD	PMID:27397436
tetrachloromethane	increases expression	EXP		6480464	Carbon Tetrachloride results in increased expression of MIR21 mRNA	CTD	PMID:22112502
titanium dioxide	increases expression	ISO	RGD:1608349	6480464	titanium dioxide results in increased expression of MIR21 mRNA	CTD	PMID:21259345
trichostatin A	increases expression	ISO	RGD:1349265	6480464	trichostatin A results in increased expression of MIR21 mRNA	CTD	PMID:24935251
Tungsten carbide	multiple interactions	ISO	RGD:1608349	6480464	[tungsten carbide analog co-treated with Cobalt analog] results in increased expression of MIR21 mRNA	CTD	PMID:23758151
tyrphostin AG 1478	multiple interactions	ISO	RGD:1349265	6480464	RTKI cpd inhibits the reaction [1-(4-(6-bromobenzo(1 more ...	CTD	PMID:25969534
ursodeoxycholic acid	increases expression	ISO	RGD:1349265	6480464	Ursodeoxycholic Acid results in increased expression of MIR21 mRNA	CTD	PMID:20689055
ursodeoxycholic acid	increases expression	EXP		6480464	Ursodeoxycholic Acid results in increased expression of MIR21 mRNA	CTD	PMID:20689055
valproic acid	decreases expression	ISO	RGD:1349265	6480464	Valproic Acid results in decreased expression of MIR21 mRNA	CTD	PMID:29154799
valproic acid	multiple interactions	ISO	RGD:1349265	6480464	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1, 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of MIR21 mRNA	CTD	PMID:27188386
valproic acid	increases expression	ISO	RGD:1349265	6480464	Valproic Acid results in increased expression of MIR21 mRNA	CTD	PMID:26272509, PMID:28001369
wortmannin	multiple interactions	ISO	RGD:1349265	6480464	wortmannin inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA] more ...	CTD	PMID:23052036, PMID:25969534
zinc atom	increases expression	EXP		6480464	Zinc deficiency results in increased expression of MIR21 mRNA	CTD	PMID:22689922
zinc atom	multiple interactions	EXP		6480464	Zinc inhibits the reaction [Zinc deficiency results in increased expression of MIR21 mRNA]	CTD	PMID:22689922
zinc(0)	increases expression	EXP		6480464	Zinc deficiency results in increased expression of MIR21 mRNA	CTD	PMID:22689922
zinc(0)	multiple interactions	EXP		6480464	Zinc inhibits the reaction [Zinc deficiency results in increased expression of MIR21 mRNA]	CTD	PMID:22689922

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular response to decreased oxygen levels		ISO	RGD:1608349	1624291	(MGI:MGI:5693365, PMID:19147652)	RGD	MGI:MGI:5693365, PMID:19147652
cellular response to dexamethasone stimulus		ISO	RGD:1608349	1624291	(MGI:MGI:5556350, PMID:24391219)	RGD	MGI:MGI:5556350, PMID:24391219
cellular response to granulocyte macrophage colony-stimulating factor stimulus		ISO	RGD:1608349	1624291	(MGI:MGI:5556350, PMID:24391219)	RGD	MGI:MGI:5556350, PMID:24391219
cellular response to interleukin-6		ISO	RGD:1608349	1624291	(MGI:MGI:5556350, PMID:24391219)	RGD	MGI:MGI:5556350, PMID:24391219
cellular response to leukemia inhibitory factor		ISO	RGD:1608349	1624291	(MGI:MGI:4822296, PMID:20439489)	RGD	MGI:MGI:4822296, PMID:20439489
cellular response to transforming growth factor beta stimulus		ISO	RGD:1608349	1624291	(MGI:MGI:5556350, PMID:24391219)	RGD	MGI:MGI:5556350, PMID:24391219
female pregnancy		ISO	RGD:1608349	1624291	(MGI:MGI:3813178, PMID:18556655)	RGD	MGI:MGI:3813178, PMID:18556655
gene silencing by miRNA		ISO	RGD:1608349	1624291	(MGI:MGI:5693365 more ...	RGD	MGI:MGI:5693365 more ...
gene silencing by miRNA		ISO	RGD:1608349	1624291	(MGI:MGI:5693365, PMID:19147652)	RGD	MGI:MGI:5693365, PMID:19147652
inflammatory response to antigenic stimulus		ISO	RGD:1608349	1624291	(MGI:MGI:5426073, PMID:22517757)	RGD	MGI:MGI:5426073, PMID:22517757
negative regulation of gene expression		ISO	RGD:1608349	1624291	(MGI:MGI:5693365, PMID:19147652)	RGD	MGI:MGI:5693365, PMID:19147652
positive regulation of cell growth		ISO	RGD:1608349	1624291	MGI:MGI:2676840 (MGI:MGI:5556350, PMID:24391219)	RGD	MGI:MGI:5556350, PMID:24391219
positive regulation of interferon-gamma secretion		ISO	RGD:1608349	1624291	(MGI:MGI:5426073, PMID:22517757)	RGD	MGI:MGI:5426073, PMID:22517757
regulation of gene expression		ISO	RGD:1608349	1624291	(MGI:MGI:3813178, PMID:18556655)	RGD	MGI:MGI:3813178, PMID:18556655
response to bacterium		ISO	RGD:1608349	1624291	(MGI:MGI:5566744, PMID:24205035)	RGD	MGI:MGI:5566744, PMID:24205035
response to muscle activity		ISO	RGD:1608349	1624291	(MGI:MGI:4943838, PMID:20086200)	RGD	MGI:MGI:4943838, PMID:20086200
response to oxygen levels		ISO	RGD:1608349	1624291	(MGI:MGI:3807359, PMID:18723672)	RGD	MGI:MGI:3807359, PMID:18723672
wound healing		IDA		10412021		RGD

Cellular Component

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
RISC complex		ISO	RGD:1608349	1624291	(MGI:MGI:5438907 more ...	RGD	MGI:MGI:5438907 more ...

Disease Annotations

	Cardiomegaly (ISO)
	Chemical and Drug Induced Liver Injury (ISO)
	Disease Progression (ISO)
	endometriosis (ISO)
	Esophageal Neoplasms (ISO)
	Fibrosis (ISO)
	heart disease (ISO)
	hepatoblastoma (ISO)

	hepatocellular carcinoma (ISO)
	Inflammation (ISO)
	intrahepatic cholangiocarcinoma (ISO)
	kidney disease (ISO)
	liver cirrhosis (IEP)
	Lung Neoplasms (ISO)
	Microsatellite Instability (ISO)
	Myocardial Reperfusion Injury (ISO)

	Neoplasm Invasiveness (ISO)
	Neoplastic Cell Transformation (ISO)
	obesity (ISO)
	Prostatic Neoplasms (ISO)
	Varicose Ulcer (ISO)
	Weight Gain (ISO)

Gene-Chemical Interaction Annotations

	(-)-Arctigenin (ISO)
	(R)-lipoic acid (EXP)
	17beta-estradiol (EXP,ISO)
	17beta-hydroxy-5alpha-androstan-3-one (ISO)
	2,3-bis(4-hydroxyphenyl)propionitrile (ISO)
	2-acetamidofluorene (EXP)
	2-hydroxypropanoic acid (ISO)
	3,7-dihydropurine-6-thione (EXP)
	acetic acid (EXP)
	actinomycin D (ISO)
	afimoxifene (ISO)
	aflatoxin B1 (EXP)
	all-trans-retinoic acid (ISO)
	anthra[1,9-cd]pyrazol-6(2H)-one (ISO)
	antirheumatic drug (ISO)
	aristolochic acid (EXP)
	arsane (ISO)
	arsenic atom (ISO)
	arsenic trichloride (ISO)
	arsenic(3+) (ISO)
	arsenite(3-) (ISO)
	baicalein (ISO)
	bicalutamide (ISO)
	biphenyl-4-amine (ISO)
	bis(2-chloroethyl) sulfide (ISO)
	bisphenol A (ISO)
	bleomycin A2 (EXP)
	bortezomib (ISO)
	cadmium atom (ISO)
	cadmium dichloride (ISO)
	carbamazepine (ISO)
	carbon atom (ISO)
	chromium(6+) (ISO)
	cisplatin (EXP,ISO)
	cobalt atom (ISO)
	cobalt(2+) (ISO)
	copper atom (EXP)
	copper(0) (EXP)

	copper(2+) (EXP)
	coumestrol (ISO)
	curcumin (ISO)
	cycloheximide (ISO)
	cyclosporin A (EXP)
	daunorubicin (ISO)
	DDT (ISO)
	dehydroepiandrosterone (ISO)
	diallyl trisulfide (ISO)
	dioxygen (EXP)
	dorsomorphin (ISO)
	doxorubicin (ISO)
	elemental carbon (ISO)
	Enterolactone (ISO)
	fenhexamid (ISO)
	ferulic acid (EXP)
	fludioxonil (ISO)
	formaldehyde (ISO)
	fulvestrant (ISO)
	geldanamycin (ISO)
	gentamycin (EXP)
	halothane (ISO)
	hydrogen peroxide (ISO)
	icariin (ISO)
	isoprenaline (EXP)
	lamotrigine (ISO)
	lipoic acid (EXP)
	LY294002 (ISO)
	medroxyprogesterone acetate (ISO)
	mercaptopurine (EXP)
	methapyrilene (EXP)
	methyl beta-cyclodextrin (ISO)
	methylmercury chloride (ISO)
	morphine (ISO)
	myo-inositol hexakisphosphate (EXP)
	N-acetyl-L-cysteine (ISO)
	N-methyl-N'-nitro-N-nitrosoguanidine (ISO)
	nickel atom (ISO)

	nickel dichloride (ISO)
	nickel sulfate (ISO)
	nitrofen (EXP)
	notoginsenoside R1 (ISO)
	ochratoxin A (ISO)
	paracetamol (EXP,ISO)
	paraquat (ISO)
	perfluorooctane-1-sulfonic acid (EXP)
	phenylephrine (EXP)
	phenylmercury acetate (ISO)
	PhIP (ISO)
	piperacillin (ISO)
	potassium bromate (ISO)
	purine-6-thiol (EXP)
	quercetin (EXP,ISO)
	quercetin 3-O-beta-D-galactopyranoside (ISO)
	rac-lactic acid (ISO)
	resveratrol (EXP,ISO)
	rifampicin (ISO)
	SB 431542 (ISO)
	sodium arsenite (ISO)
	Solasodine (ISO)
	Sporidesmin (ISO)
	stattic (ISO)
	sulfamethoxazole (ISO)
	tacrolimus hydrate (ISO)
	tetrachloromethane (EXP)
	titanium dioxide (ISO)
	trichostatin A (ISO)
	Tungsten carbide (ISO)
	tyrphostin AG 1478 (ISO)
	ursodeoxycholic acid (EXP,ISO)
	valproic acid (ISO)
	wortmannin (ISO)
	zinc atom (EXP)
	zinc(0) (EXP)

Gene Ontology Annotations

Biological Process

	cellular response to decreased oxygen levels (ISO)
	cellular response to dexamethasone stimulus (ISO)
	cellular response to granulocyte macrophage colony-stimulating factor stimulus (ISO)
	cellular response to interleukin-6 (ISO)
	cellular response to leukemia inhibitory factor (ISO)
	cellular response to transforming growth factor beta stimulus (ISO)
	female pregnancy (ISO)
	gene silencing by miRNA (ISO)
	inflammatory response to antigenic stimulus (ISO)

	negative regulation of gene expression (ISO)
	positive regulation of cell growth (ISO)
	positive regulation of interferon-gamma secretion (ISO)
	regulation of gene expression (ISO)
	response to bacterium (ISO)
	response to muscle activity (ISO)
	response to oxygen levels (ISO)
	wound healing (IDA)

Cellular Component

RISC complex (ISO)

References - curated

1.	Correa-Gallego C, etal., PLoS One. 2016 Sep 29;11(9):e0163699. doi: 10.1371/journal.pone.0163699. eCollection 2016.
2.	Liu C, etal., J Hepatol. 2010 Jul;53(1):98-107. doi: 10.1016/j.jhep.2010.02.021. Epub 2010 Apr 4.
3.	Liu W, etal., Pediatr Surg Int. 2016 Nov;32(11):1059-1065. doi: 10.1007/s00383-016-3960-8. Epub 2016 Sep 6.
4.	Pastar I, etal., J Biol Chem. 2012 Aug 24;287(35):29324-35. doi: 10.1074/jbc.M112.382135. Epub 2012 Jul 6.
5.	RGD automated import pipeline for gene-chemical interactions
6.	Takeuchi-Yorimoto A, etal., Toxicol Lett. 2016 Sep 6;258:159-167. doi: 10.1016/j.toxlet.2016.06.012. Epub 2016 Jun 15.

References - uncurated

PubMed

14691248 16381832 16766679 17604727 17805466 18850008 20219857 20403161 20498256 20840605 21162128 21698002 21704009 21852586 21853131 22019057 22022489 22790595 22907769 23097335 23154340 23473787 23647386 23665014 23902531 23978520 24161401 24237305 24388835 24492999 24556821 24562307 24676391 24743145 24903275 24913635 24951588 25106556 25108037 25156787 25483877 25484256 25536091 25598202 25633833 25704671 25840830 25879024 25973032 26302266 26323253 26380976 26415649 26621219 26830133 26862785 27053343 27075111 27152763 27226339 27336721 27429986 27634014 27680680 27708252 27798620 27803763 27979484 27999792 28214900 28335740 28347692 28374893 28402262 28473352 28656242 28731181 28760335 28807003 28939387 28971796 29028768 29115610 29187695 29248491 29355689 29436647 29444190 29627835 29696468 29709341 29795410 29968904 30089893 30132829 30212710 30257393 30309483 30463111 30504734 30830529

Genomics

Comparative Map Data

Mir21
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rnor_6.0	10	73,902,210 - 73,902,301 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	10	76,197,081 - 76,197,172 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	10	70,326,375 - 70,326,466 (-)	NCBI		Celera
Cytogenetic Map	10	q26	NCBI

MIR21
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	17	59,841,266 - 59,841,337 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	17	57,918,627 - 57,918,698 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	55,273,408 - 55,273,479 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	17	54,382,140 - 54,382,211 (+)	NCBI
Cytogenetic Map	17	q23.1	NCBI
HuRef	17	53,291,116 - 53,291,187 (+)	NCBI		HuRef
CHM1_1	17	57,982,648 - 57,982,719 (+)	NCBI		CHM1_1

Mir21a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	11	86,584,067 - 86,584,158 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
MGSCv37	11	86,397,569 - 86,397,660 (-)	NCBI	GRCm37		mm9	NCBIm37
Celera	11	96,199,974 - 96,200,065 (-)	NCBI		Celera
Cytogenetic Map	11	C	NCBI

MIR21
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	9	34,340,550 - 34,340,609 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog Cytomap	9		NCBI

MIR21
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1	12	36,065,267 - 36,065,358 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	12	37,340,385 - 37,340,476 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3
Pig Cytomap	12		NCBI

Position Markers

AI787464

Rat Assembly	Chr	Position (strand)	Source	JBrowse
Rnor_6.0	10	73,903,154 - 73,903,259	NCBI	Rnor6.0
Rnor_6.0	1	213,546,690 - 213,546,795	NCBI	Rnor6.0
Rnor_5.0	10	76,196,123 - 76,196,228	UniSTS	Rnor5.0
Rnor_5.0	1	220,441,627 - 220,441,732	UniSTS	Rnor5.0
RGSC_v3.4	10	74,865,444 - 74,865,549	UniSTS	RGSC3.4
RGSC_v3.4	1	200,953,414 - 200,953,519	UniSTS	RGSC3.4
Celera	10	70,327,319 - 70,327,424	UniSTS
Celera	1	193,519,273 - 193,519,378	UniSTS
Cytogenetic Map	1	q41	UniSTS
Cytogenetic Map	10	q26	UniSTS

RH133657

Rat Assembly	Chr	Position (strand)	Source	JBrowse
Rnor_6.0	2	196,386,053 - 196,386,235	NCBI	Rnor6.0
Rnor_6.0	10	73,902,032 - 73,902,214	NCBI	Rnor6.0
Rnor_5.0	10	76,197,168 - 76,197,350	UniSTS	Rnor5.0
Rnor_5.0	2	215,882,523 - 215,882,705	UniSTS	Rnor5.0
RGSC_v3.4	10	74,864,322 - 74,864,504	UniSTS	RGSC3.4
RGSC_v3.4	2	190,121,004 - 190,121,186	UniSTS	RGSC3.4
Celera	10	70,326,197 - 70,326,379	UniSTS
Celera	2	175,322,649 - 175,322,831	UniSTS

AA859070

Rat Assembly	Chr	Position (strand)	Source	JBrowse
Rnor_6.0	1	213,546,965 - 213,547,119	NCBI	Rnor6.0
Rnor_6.0	10	73,902,902 - 73,903,056	NCBI	Rnor6.0
Rnor_5.0	10	76,196,326 - 76,196,480	UniSTS	Rnor5.0
Rnor_5.0	1	220,441,902 - 220,442,056	UniSTS	Rnor5.0
RGSC_v3.4	10	74,865,192 - 74,865,346	UniSTS	RGSC3.4
RGSC_v3.4	1	200,953,689 - 200,953,843	UniSTS	RGSC3.4
Celera	1	193,519,550 - 193,519,704	UniSTS
Celera	10	70,327,067 - 70,327,221	UniSTS
Cytogenetic Map	10	q26	UniSTS

RH137097

Rat Assembly	Chr	Position (strand)	Source	JBrowse
Rnor_6.0	10	73,902,509 - 73,902,667	NCBI	Rnor6.0
Rnor_5.0	10	76,196,715 - 76,196,873	UniSTS	Rnor5.0
RGSC_v3.4	10	74,864,799 - 74,864,957	UniSTS	RGSC3.4
Celera	10	70,326,674 - 70,326,832	UniSTS
Cytogenetic Map	10	q26	UniSTS

QTLs in Region (Rnor_6.0)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2312662	Slep8	Serum leptin concentration QTL 8		0.05	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	10	60875260	105875260	Rat
2312668	Scl65	Serum cholesterol level QTL 65		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	60875260	105875260	Rat
2312672	Insul15	Insulin level QTL 15		0.01	blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	10	60875260	105875260	Rat
2306970	Anxrr22	Anxiety related response QTL 22	5.95		fear/anxiety-related behavior trait (VT:1000241)	number of periods of voluntary immobility (CMO:0001045)	10	64648175	101691360	Rat
2316949	Gluco60	Glucose level QTL 60	3.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	14827894	110992275	Rat
2317029	Aia19	Adjuvant induced arthritis QTL 19	2.98		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	10	69385595	112626471	Rat
2317039	Aia6	Adjuvant induced arthritis QTL 6	4.31		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	10	69385595	112626471	Rat
2317042	Aia20	Adjuvant induced arthritis QTL 20	3.38		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	10	40514044	85514044	Rat
2317043	Aia7	Adjuvant induced arthritis QTL 7	3.82		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	10	40514044	85514044	Rat
1298069	Bp168	Blood pressure QTL 168	5.5		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	10	27237530	101482600	Rat
1298078	Stresp5	Stress response QTL 5	2.99	0.00025	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	10	43289657	108540162	Rat
631565	Hcuc4	Hepatic copper content QTL 4	4.15		hepatic copper amount (VT:0003065)	liver copper weight to liver dry weight ratio (CMO:0001512)	10	69348459	75983662	Rat
6893336	Cm75	Cardiac mass QTL 75	0.1	0.87	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	64648175	102149713	Rat
6893342	Cm78	Cardiac mass QTL 78	0.1	0.88	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	36185929	82675365	Rat
6893366	Bw106	Body weight QTL 106	0.3	0.47	body mass (VT:0001259)	body weight (CMO:0000012)	10	73467158	112626471	Rat
7207811	Bmd90	Bone mineral density QTL 90	5.2		femur size trait (VT:1000369)	femoral neck cross-sectional area (CMO:0001697)	10	51289203	84596393	Rat
7387312	Bw125	Body weight QTL 125	3	0.0047	retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight (CMO:0000356)	10	67880046	112626471	Rat
631269	Cia22	Collagen induced arthritis QTL 22	8.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	41260363	107857673	Rat
631270	Cia23	Collagen induced arthritis QTL 23	3.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	41260363	107857673	Rat
631530	Tls3	T-lymphoma susceptibility QTL 3	0	0.0001	thymus integrity trait (VT:0010555)	percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)	10	53625815	98939209	Rat
631542	Bp82	Blood pressure QTL 82	6.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	27237530	102427718	Rat
631547	Bp87	Blood pressure QTL 87	4.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	50638337	95638337	Rat
631552	Vetf2	Vascular elastic tissue fragility QTL 2	4.5	0.0002	aorta elastic tissue integrity trait (VT:0010556)	artery internal elastic lamina non-tumorous lesion count (CMO:0001913)	10	36185929	95845311	Rat
9589030	Epfw9	Epididymal fat weight QTL 9	19.24	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	10	46848346	91848346	Rat
7411614	Foco18	Food consumption QTL 18		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	10	46848346	91848346	Rat
8662860	Vetf10	Vascular elastic tissue fragility QTL 10			artery integrity trait (VT:0010639)	number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)	10	6229095	75983805	Rat
8552805	Bw145	Body weight QTL 145	2.2		body mass (VT:0001259)	ratio of change in body weight to total body weight (CMO:0002216)	10	43188659	81042642	Rat
8694173	Bw149	Body weight QTL 149	4.38	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	10	46848346	91848346	Rat
10402859	Bp381	Blood pressure QTL 381		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	30099909	75099909	Rat
1354608	Cm33	Cardiac mass QTL 33	2.8		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	10	56698730	101698730	Rat
1359017	Hrtrt21	Heart rate QTL 21	2.4		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	10	55224855	100224855	Rat
1558643	Cm44	Cardiac mass QTL 44	4.8	0.0000368	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	64648175	102149713	Rat
1549846	Scl47	Serum cholesterol level QTL 47	3.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	53104718	98104718	Rat
1554317	Bmd4	Bone mineral density QTL 4	9.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	20170031	102897474	Rat
1549831	Bss6	Bone structure and strength QTL 6	4		lumbar vertebra strength trait (VT:0010574)	vertebra ultimate force (CMO:0001678)	10	60450007	105450007	Rat
1579918	Bp279	Blood pressure QTL 279		0.01	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	73727917	75099909	Rat
1581559	Eae18	Experimental allergic encephalomyelitis QTL 18		0.00002	nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	10	67988218	110992091	Rat
1576308	Schws1	Schwannoma susceptibility QTL 1		0.0041	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	10	41260363	106105607	Rat
1576311	Pia26	Pristane induced arthritis QTL 26			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	31919397	78343192	Rat
1576319	Cia29	Collagen induced arthritis QTL 29			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	35139424	80139424	Rat
1578779	Tcas10	Tongue tumor susceptibility QTL 10	3.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	10	33179030	78179030	Rat
61354	Pia10	Pristane induced arthritis QTL 10		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	24483076	107857673	Rat
61396	Bp9	Blood pressure QTL 9	4.8	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	71692298	112626471	Rat
61402	Niddm3	Non-insulin dependent diabetes mellitus QTL 3	4.58		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	64648311	85513822	Rat
61427	Cia16	Collagen induced arthritis QTL 16	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	6429075	99492409	Rat
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	21523906	83549467	Rat
2292439	Bp309	Blood pressure QTL 309			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	73727917	74459500	Rat
2292441	Bp308	Blood pressure QTL 308			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	30099909	75099909	Rat
631267	Cia20	Collagen induced arthritis QTL 20	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	24483076	107857673	Rat
631268	Cia21	Collagen induced arthritis QTL 21	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	14827894	107857673	Rat
61449	Ciaa2	CIA Autoantibody QTL 2	7.1		blood autoantibody amount (VT:0003725)	calculated serum anti-type 2 collagen antibody titer (CMO:0001279)	10	65590122	110590122	Rat
61463	Bp12	Blood pressure QTL 12	6.3	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	43704955	88704955	Rat
70164	Bw21	Body weight QTL 21	4.36	0.00005	body mass (VT:0001259)	body weight (CMO:0000012)	10	55679084	102427604	Rat
70171	Cari1	Carrageenan-induced inflammation QTL 1	4.9	0.0005	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	10	55678976	112626471	Rat
61325	Aia5	Adjuvant induced arthritis QTL 5		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	24483076	107857673	Rat
2298481	Eau9	Experimental allergic uveoretinitis QTL 9		0.0169	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	10	68305037	85514044	Rat
2300218	Hpcl2	Hepatic cholesterol level QTL 2			liver cholesterol amount (VT:0010498)	liver cholesterol level (CMO:0001597)	10	46593021	98939209	Rat
2301967	Cm73	Cardiac mass QTL 73	4.55		heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	14827894	92423564	Rat
2300172	Bmd57	Bone mineral density QTL 57	9.8	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	10	73008136	112626471	Rat
2293679	Bmd30	Bone mineral density QTL 30	3.5	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	51289203	84596393	Rat
10450498	Bp384	Blood pressure QTL 384		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	70166960	112626471	Rat
1331791	Cm31	Cardiac mass QTL 31	3.84606		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	23861015	112626471	Rat
724556	Pur2	Proteinuria QTL 2	5.5		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	10	22901497	93886300	Rat
2293669	Bmd33	Bone mineral density QTL 33	4.5	0.0001	femur strength trait (VT:0010010)	femoral neck polar moment of inertia (CMO:0001670)	10	51289203	84596393	Rat
1357344	Bp249	Blood pressure QTL 249		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	69123603	101482600	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	21523906	90312401	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	21523906	90312401	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	21523906	90312401	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	21523906	90312401	Rat
2293705	Bmd25	Bone mineral density QTL 25	7.1	0.0001	femur mineral mass (VT:0010011)	cortical volumetric bone mineral density (CMO:0001730)	10	51289203	84596393	Rat
2293663	Bss33	Bone structure and strength QTL 33	9.34	0.0001	femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	10	73008136	112626471	Rat
2293646	Bss25	Bone structure and strength QTL 25	10.96	0.0001	femur morphology trait (VT:0000559)	femur cross-sectional area (CMO:0001661)	10	73008136	112626471	Rat
2313103	Bss80	Bone structure and strength QTL 80	2	0.0001	tibia strength trait (VT:1000284)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	10	65992275	110992275	Rat
2293652	Bmd22	Bone mineral density QTL 22	4.9	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	51289203	84596393	Rat
12903247	Cm112	Cardiac mass QTL 112		0.001	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	10	73727917	75099909	Rat
2313105	Bss79	Bone structure and strength QTL 79	1.8	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	10	65992275	110992275	Rat
12903246	Cm111	Cardiac mass QTL 111		0.001	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	73727917	75099909	Rat
2293698	Bss43	Bone structure and strength QTL 43	5.33	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra cross-sectional area (CMO:0001689)	10	62096293	107096293	Rat
12903245	Cm110	Cardiac mass QTL 110		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	10	73727917	75099909	Rat
1642980	Bp300	Blood pressure QTL 300			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	70800069	112626471	Rat
12903248	Am14	Aortic mass QTL 14		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	10	73727917	75099909	Rat
2289985	Bp305	Blood pressure QTL 305			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	69910832	76109716	Rat
631535	Cm51	Cardiac mass QTL 51	3		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	10	53637485	94807701	Rat
631557	Bp136	Blood pressure QTL 136		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	33343192	78343192	Rat
724527	Bp148	Blood pressure QTL 148		0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	30983805	75983805	Rat
70363	Bp71	Blood pressure QTL 71		0.04	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	64648175	84601269	Rat
12903249	Kidm68	Kidney mass QTL 68		0.02	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	10	73727917	75099909	Rat
12902615	Bw185	Body weight QTL 185		0.01	body mass (VT:0001259)	body weight (CMO:0000012)	10	73727917	75099909	Rat
70198	BpQTLcluster9	Blood pressure QTL cluster 9	2.94		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	21523906	90312401	Rat
10450500	Bp385	Blood pressure QTL 385		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	73727917	74459500	Rat
2303118	Mamtr7	Mammary tumor resistance QTL 7		0.003	mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	10	9841807	108540162	Rat
61387	Bp1	Blood pressure QTL 1	5.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	53621375	112626471	Rat
61387	Bp1	Blood pressure QTL 1	5.1		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	10	53621375	112626471	Rat

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Pdcd4	rno-miR-21-5p	Mirtarbase	external_info	Luciferase reporter assay//Western blot	Functional MTI	19158092
Pdcd4	rno-miR-21-5p	Mirtarbase	external_info	Western blot//qRT-PCR//GFP reporter assay//Lucifer	Functional MTI	19336275
Pdcd4	rno-miR-21-5p	Mirtarbase	external_info	Western blot	Functional MTI	19167416
Pdcd4	rno-miR-21-5p	Mirtarbase	external_info	qRT-PCR//Western blot	Functional MTI	21154462
Pdcd4	rno-miR-21-5p	Mirtarbase	external_info	Immunocytochemistry//Immunofluorescence//Luciferas	Functional MTI	22565856
Tpm1	rno-miR-21-5p	Mirtarbase	external_info	Microarray	Functional MTI (Weak)	18258830
Pten	rno-miR-21-5p	Mirtarbase	external_info	Microarray//qRT-PCR//Western blot	Functional MTI	17478730
Faslg	rno-miR-21-5p	Mirtarbase	external_info	Immunofluorescence//In situ hybridization//Lucifer	Functional MTI	20840605
Elavl4	rno-miR-21-5p	Mirtarbase	external_info	qRT-PCR	Functional MTI (Weak)	20584986

Predicted Targets

	Summary Value
Count of predictions:	6543
Count of gene targets:	4311
Count of transcripts:	4656
Interacting mature miRNAs:	rno-miR-21-3p, rno-miR-21-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_031823	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AAHX01065327	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AC114846	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_031823

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0	10	73,902,210 - 73,902,301 (-)	NCBI
Rnor_5.0	10	76,197,081 - 76,197,172 (+)	NCBI
Celera	10	70,326,375 - 70,326,466 (-)	NCBI

Sequence:

show sequence

TGTACCACCTTGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACAGCAG
TCGATGGGCTGTCTGACATTTTGGTATC

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Strain Variation

Strain Sequence Variants (Rnor 5.0)

ACI/EurMcwi (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

ACI/EurMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.5.9-r16 and GATK v1.3-14
Description:	Medical College of Wisconsin (Dr. Howard Jacob)

ACI/N (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

BBDP/WorN (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

BDIX.Cg-Tal/NemOda (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

BDIX/NemOda (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

BN-Lx/Cub (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

BN-Lx/CubPrin (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

BN/SsN (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

BN/SsNSlc (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

BUF/MNa (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

BUF/N (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

COP/CrCrl (MCW & UW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob) University of Wisconsin (Dr. James Shull)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.5.9-r16 and GATK v2.3-5
Breeder:	Charles River Laboratories
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob) and UW Madison (Dr. James Shull)

Crl:SD (UDEL)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK (HaplotypeCaller v.3.1-1, VariantAnnotator v.3.1-1, SnpEff v.3.6)
Description:	Provided by Barthold at al

DA/BklArbNsi (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

DOB/Oda (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

F344/DuCrlCrlj (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

F344/Jcl (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

F344/NCrl (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

F344/NHsd (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

F344/NRrrc (Illumina) (KNAW)

Visual

CSV

TAB

Printer

Platform:	Illumina
Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

F344/NRrrc (SOLiD) (KNAW)

Visual

CSV

TAB

Printer

Platform:	SOLID
Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

F344/NSlc (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

F344/Stm (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

FHH/EurMcwi (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

FHH/EurMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.5.9-r16 and GATK v1.3-14
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

FHL/EurMcwi (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

FHL/EurMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.5.9-r16 and GATK v1.3-14
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

GH/OmrMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.5.9-r16 and GATK v2.3-5
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

GK/Ox (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

HTX/Kyo (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

HWY/Slc (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

IS-Tlk/Kyo (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

IS/Kyo (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

KFRS3B/Kyo (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

LE/OrlBarth (UDEL)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK (HaplotypeCaller v.3.1-1, VariantAnnotator v.3.1-1, SnpEff v.3.6)
Description:	Provided by Barthold at al

LE/Stm (Illumina) (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

LE/Stm (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

LE/Stm (SOLiD) (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

LEC/Tj (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

LEW/Crl (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

LEW/NCrl (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

LH/MavRrrc (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

LL/MavRrrc (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

LN/MavRrrc (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

M520/N (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

MHS/Gib (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

MNS/Gib (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

MR/N (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

NIG-III/Hok (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

RCS/Kyo (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

SBH/Ygl (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SBH/Ygl (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA-0.5.8c, GATK-v1.0.6001, samtools, Picard
Breeder:	Medical College of Wisconsin
Description:	SBH/Ygl sequenced by MCW

SBN/Ygl (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SBN/Ygl (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA-0.5.8c, GATK-v1.0.6001, samtools, Picard
Breeder:	Medical College of Wisconsin
Description:	SBN/Ygl sequenced by MCW

SDLEF7/Barth (UDEL)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK (HaplotypeCaller v.3.1-1, VariantAnnotator v.3.1-1, SnpEff v.3.6)
Description:	Provided by Barthold at al

SHR/NCrlPrin (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SHR/NHsd (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SHR/OlaIpcv (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SHR/OlaIpcvPrin (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SHRSP/Gcrc (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SR/JrHsd (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SR/JrHsd (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.5.9-r16 and GATK v1.3-14
Breeder:	Harlan Laboratories
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

SS/Jr (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SS/JrHsdMcwi (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

SS/JrHsdMcwi (MCW)

Visual

CSV

TAB

Printer

Sequenced By:	Medical College of Wisconsin (Dr. Howard Jacob)
Platform:	Illumina HiSeq 2000
Secondary Analysis:	BWA v0.5.9-r16 and GATK v1.3-14
Description:	Provided by the Medical College of Wisconsin (Dr. Howard Jacob)

WAG/Rij (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

WKY/Gcrc (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

WKY/N (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

WKY/NCrl (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

WKY/NHsd (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

WN/N (KNAW)

Visual

CSV

TAB

Printer

Secondary Analysis:	GATK
Description:	Provided by Hermsen at al

ZF (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

ZFDM (KyushuU)

Visual

CSV

TAB

Printer

Sequenced By:	Kyushu University (Dr. Mikita Suyama) Kyoto University (Dr. Takashi Kuramoto)
Platform:	Illumina NextSeq 500
Secondary Analysis:	BWA (v0.7.4), SAMtools (v.0.1.12a), Picard tools (v.1.87), GATK (v.2.5.2)
Breeder:	NBRP-Rat/Kyoto University
Description:	Target capture sequencing of exons and conserved non-coding sequences. Provided by: Dr. Mikita Suyama (Kyushu University) and Dr. Takashi Kuramoto (Kyoto University)
Publications:	Yoshihara M, etal., Genom Data. 2016 Nov 14;10:155-157. eCollection 2016 Dec.

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325598	AgrOrtholog
Ensembl Genes	ENSRNOG00000035480	ENTREZGENE
Ensembl Transcript	ENSRNOT00000053603	ENTREZGENE
miRBase	MI0000850	ENTREZGENE
NCBI Gene	100314000	ENTREZGENE
PhenoGen	Mir21	PhenoGen
RNAcentral	URS0000013967	RNACentral
	URS000015930E	RNACentral
	URS000039ED8D	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir21	microRNA 21	Mir21	microRNA mir-21	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir21	microRNA mir-21			Symbol and Name status set to provisional	70820	PROVISIONAL

More on Mir21
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: rn5 rn6
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	2325598
Created:	2010-06-02
Species:	Rattus norvegicus
Last Modified:	2019-10-08
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.