Symbol:
Mir21
Name:
microRNA 21
RGD ID:
2325598
Description:
Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Involved in several processes, including cellular response to mechanical stimulus; negative regulation of programmed cell death; and positive regulation of intracellular signal transduction. Located in extracellular vesicle. Used to study glioblastoma; status epilepticus; and thyroid cancer. Biomarker of several diseases, including cerebral infarction; diabetic retinopathy; pulmonary hypertension; sciatic neuropathy; and status epilepticus. Orthologous to human MIR21 (microRNA 21); INTERACTS WITH (R)-lipoic acid; 17beta-estradiol; 2,5-hexanedione.
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
microRNA mir-21; rno-mir-21
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 71,902,600 - 71,902,691 (-) NCBI GRCr8 mRatBN7.2 10 71,405,257 - 71,405,348 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 71,405,257 - 71,405,348 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 76,026,707 - 76,026,798 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 75,531,582 - 75,531,673 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 70,996,132 - 70,996,223 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 73,902,210 - 73,902,301 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 73,902,210 - 73,902,301 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 76,197,081 - 76,197,172 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 10 70,326,375 - 70,326,466 (-) NCBI Celera Cytogenetic Map 10 q26 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mir21 Rat Acute Lung Injury IEP 41410885 RNA:increased expression:lung RGD Mir21 Rat acute myocardial infarction ISO RGD:1349265 21081515 miRNA:increased expression:peripheral blood mononuclear cell, plasma RGD Mir21 Rat acute myocardial infarction ISO RGD:1349265 401851053 RNA:decreased expression:serum RGD Mir21 Rat alcohol use disorder sexual_dimorphism ISO RGD:1608349 598099545 miRNA:decreased expression: cerebral cortex (mouse) RGD Mir21 Rat Alcoholic Intoxication sexual_dimorphism ISO RGD:1349265 598099545 miRNA:decreased expression:blood plasma (human, female) RGD Mir21 Rat allergic contact dermatitis treatment IEP 41404666 RGD Mir21 Rat anaplastic thyroid carcinoma ISO RGD:1349265 41404697 RNA:increased expression:thyroid gland: RGD Mir21 Rat Angina Pectoris ISO RGD:1349265 21081515 miRNA:increased expression:peripheral blood mononuclear cell, plasma RGD Mir21 Rat atherosclerosis severity ISO RGD:1349265 21081515 miRNA:increased expression:peripheral blood mononuclear cell, plasma RGD Mir21 Rat Atrial Remodeling treatment IEP 41404716 RGD Mir21 Rat autoimmune uveitis ameliorates ISO RGD:1608349 41404699 RGD Mir21 Rat brain glioma ISO RGD:1349265 152998875 human cells in mouse model; RNA:increased expression:brain (human) RGD Mir21 Rat breast cancer IEP 152025189 RNA:increased expression:thoracic lymph node RGD Mir21 Rat breast cancer severity ISO RGD:1349265 9068941 miRNA:increased expression:breast (human) RGD PMID:18812439|REF_RGD_ID:152998878 Mir21 Rat breast cancer ISO RGD:1349265 152998900 RNA:increased expression:blood serum (human) RGD Mir21 Rat breast cancer ISO RGD:1349265 153297766 RNA:increased expression:peripheral blood mononuclear cell (human) RGD Mir21 Rat Burkitt lymphoma treatment ISO RGD:1349265 41404643 RGD Mir21 Rat Cardio-Renal Syndrome ameliorates IMP 41410821 RGD Mir21 Rat Cardiomegaly ISO RGD:1608349 41404711 RNA:increased expression:heart: RGD Mir21 Rat cerebral infarction IEP 41410884 RNA:increased expression:brain RGD Mir21 Rat cervical cancer severity ISO RGD:1349265 40925949 RGD Mir21 Rat cervical squamous cell carcinoma ISO RGD:1349265 41404529 RNA:increased expression:cervical cell RGD Mir21 Rat cervicitis ISO RGD:1349265 41404529 RNA:increased expression:cervical cell RGD Mir21 Rat cervix uteri carcinoma in situ ISO RGD:1349265 41404529 RNA:increased expression:cervical cell RGD Mir21 Rat chlamydia ISO RGD:1608349 41404696 associated with asthma;RNA:increased expression:lung RGD Mir21 Rat cholangiocarcinoma ISO RGD:1349265 41404678 RNA:increased expression:urine RGD Mir21 Rat Cholangiofibrosis ISO RGD:1349265 41404678 RNA:increased expression:urine RGD Mir21 Rat Chronic Hepatitis ISO RGD:1349265 41404642 RNA:increased expression:plasma RGD Mir21 Rat chronic lymphocytic leukemia ISO RGD:1349265 21081544 miRNA:increased expression:peripheral blood mononuclear cell RGD Mir21 Rat colon cancer ISO RGD:1349265 153297766 RNA:increased expression:peripheral blood mononuclear cell (human) RGD Mir21 Rat colon cancer disease_progression ISO RGD:1349265 152995486 RNA:increased expression:colon (human) RGD Mir21 Rat colorectal cancer ameliorates ISO RGD:1608349 40925941 associated with Fusobacterium Infections RGD Mir21 Rat colorectal cancer ISO RGD:1349265 152998900 RNA:increased expression:blood serum (human) RGD Mir21 Rat colorectal cancer exacerbates ISO RGD:1349265 152995497 RNA:increased expression:colorectum (human) RGD Mir21 Rat colorectal cancer severity ISO RGD:1349265 11538337 RNA:increased expression:colorectum (human) RGD Mir21 Rat colorectal cancer disease_progression ISO RGD:1349265 152995509 RNA:increased expression:colorectum (human) RGD Mir21 Rat colorectal cancer sexual_dimorphism ISO RGD:1608349 152995508 RNA:increased expression:colorectum, blood serum (human) RGD Mir21 Rat colorectal cancer ISO RGD:1349265 153297812 RNA:increased expression:colorectum (human) RGD Mir21 Rat colorectal cancer ISO RGD:1349265 40925941 RNA:increased expression:colorectum RGD Mir21 Rat congestive heart failure disease_progression ISO RGD:1608349 41404712 RGD Mir21 Rat congestive heart failure ISO RGD:1349265 41404712 RNA:increased expression:left ventricular myocardium RGD Mir21 Rat congestive heart failure treatment ISO RGD:1608349 41404712 RGD Mir21 Rat congestive heart failure IEP 41404712 RNA:increased expression:heart, myofibroblast: RGD Mir21 Rat coronary artery disease ISO RGD:1349265 21081515 miRNA:increased expression:peripheral blood mononuclear cell, plasma RGD Mir21 Rat coronary artery disease ISO RGD:1349265 11056497 miRNA:increased expression:blood plasma (human) RGD Mir21 Rat Crohn's disease ISO RGD:1349265 41404530 RNA:increased expression:leukocyte RGD Mir21 Rat cryptosporidiosis ISO RGD:1608349 40925950 RNA:increased expression:ileum RGD Mir21 Rat dengue disease ISO RGD:1349265 41404658 RNA:increased expression:serum: RGD Mir21 Rat Diabetic Nephropathies IEP 41410820 RNA:increased expression:kidney RGD Mir21 Rat diabetic retinopathy IEP 41410819 RNA:increased expression:retina RGD Mir21 Rat endometrial cancer ISO RGD:1349265 126775148 miRNA:increased expression:endometrium RGD Mir21 Rat esophageal cancer ISO RGD:1349265 152995510 RNA:increased expression:esophagus (human) RGD Mir21 Rat esophageal cancer ISO RGD:1349265 152998900 RNA:increased expression:blood serum (human) RGD Mir21 Rat esophagus adenocarcinoma disease_progression ISO RGD:1349265 41404702 RGD Mir21 Rat Experimental Colitis ameliorates ISO RGD:1608349 41404691 RGD Mir21 Rat Fusobacterium Infections severity ISO RGD:1349265 40925941 associated with colorectal cancer RGD Mir21 Rat glioblastoma ameliorates IMP 41404645 RGD Mir21 Rat Haemophilus Infections ameliorates ISO RGD:1608349 41404696 associated with asthma; RGD Mir21 Rat hepatitis C disease_progression ISO RGD:1349265 41404667 RGD Mir21 Rat hepatitis C ISO RGD:1349265 41404662 RNA:increased expression:liver RGD Mir21 Rat hepatoblastoma ISO RGD:1349265 14695023 miRNA:increased expression:plasma, extracellular exosome RGD Mir21 Rat hepatocellular carcinoma severity ISO RGD:1349265 40925952 RGD Mir21 Rat hepatocellular carcinoma ISO RGD:1349265 14695022 miRNA:increased expression:liver RGD Mir21 Rat hepatocellular carcinoma treatment ISO RGD:1349265 41404642 RGD Mir21 Rat Hyperoxic Lung Injury ameliorates IDA 41404709 RGD Mir21 Rat Hyperoxic Lung Injury exacerbates IMP 41404708 RGD Mir21 Rat hypertensive heart disease ISO RGD:1349265 41404711 RNA:increased expression:serum,heart: RGD Mir21 Rat influenza ameliorates ISO RGD:1608349 41404696 associated with asthma; RGD Mir21 Rat intermediate coronary syndrome ISO RGD:1349265 401851053 RNA:decreased expression:serum RGD Mir21 Rat intestinal obstruction ISO RGD:1349265 41404691 RNA:increased expression:colon RGD Mir21 Rat Intestinal Reperfusion Injury IEP 41410822 RGD Mir21 Rat intrahepatic cholangiocarcinoma ISO RGD:1349265 14928335 RNA:increased expression:liver,plasma RGD Mir21 Rat irritable bowel syndrome ISO RGD:1349265 41404691 RNA:increased expression:colon RGD Mir21 Rat laryngeal squamous cell carcinoma exacerbates ISO RGD:1349265 9068941 miRNA:increased expression:blood serum (human) RGD PMID:35117730|REF_RGD_ID:153344530 Mir21 Rat listeriosis exacerbates ISO RGD:1608349 41404664 RGD Mir21 Rat liver cirrhosis ameliorates ISO RGD:1608349 40925947 RGD Mir21 Rat liver cirrhosis treatment IEP 41404717 RGD Mir21 Rat liver cirrhosis disease_progression ISO RGD:1349265 41404701 associated with chronic hepatitis B RGD Mir21 Rat liver cirrhosis onset IEP 14695024 associated with nonalcoholic fatty liver disease;miRNA:increased expression:liver, plasma RGD Mir21 Rat liver cirrhosis disease_progression ISO RGD:1608349 41404667 RGD Mir21 Rat Liver Reperfusion Injury IEP 41410824 RNA:increased expression:liver RGD Mir21 Rat lung adenocarcinoma ISO RGD:1608349 152998954 miRNA:increased expression:sputum (human) RGD Mir21 Rat lung adenocarcinoma disease_progression ISO RGD:1349265 152998892 RNA:increased expression:lung (human) RGD Mir21 Rat lung adenoma ISO RGD:1608349 41404697 RNA:increased expression:lung: RGD Mir21 Rat lung cancer ameliorates ISO RGD:1608349 152998905 RGD Mir21 Rat lung cancer ISO RGD:1349265 152998900 RNA:increased expression:blood serum (human) RGD Mir21 Rat lung carcinoma ISO RGD:1608349 41404697 RNA:increased expression:lung: RGD Mir21 Rat lung non-small cell carcinoma disease_progression ISO RGD:1349265 41404697 RGD Mir21 Rat lung non-small cell carcinoma disease_progression ISO RGD:1349265 152998885 RNA:increased expression:blood serum (human) RGD Mir21 Rat lung non-small cell carcinoma ISO RGD:1349265 152998899 RNA:increased expression:blood serum (human) RGD Mir21 Rat lung non-small cell carcinoma ISO RGD:1349265 152998889 RNA:increased expression:lung (human) RGD Mir21 Rat lung non-small cell carcinoma disease_progression ISO RGD:1349265 152998901 RNA:increased expression:lung (human) RGD Mir21 Rat lung non-small cell carcinoma ISO RGD:1349265 152998886 RNA:increased expression:lung (human) RGD Mir21 Rat metabolic dysfunction-associated steatohepatitis ISO RGD:1349265 41404659 RNA:increased expression:liver RGD Mir21 Rat metabolic dysfunction-associated steatohepatitis ameliorates ISO RGD:1608349 41404659 RGD Mir21 Rat Myocardial Reperfusion Injury exacerbates ISO RGD:1608349 41404665 RGD Mir21 Rat Myocardial Reperfusion Injury IEP 155882541 miRNA:increased expression:heart (rat) RGD Mir21 Rat Neoplasm Metastasis treatment ISO RGD:1349265 152998873 associated with prostate carcinoma; human cells in mouse model RGD Mir21 Rat Neoplasm Metastasis ameliorates ISO RGD:1349265 152998897 human cells in mouse model;associated with breast cancer RGD Mir21 Rat papillomavirus infectious disease ISO RGD:1349265 41404529 RNA:increased expression:cervical cell RGD Mir21 Rat Parkinson's disease IEP 41404531 RNA:increased expression: plasma extracellular vesicle RGD Mir21 Rat Peritoneal Fibrosis IEP 40925948 RNA:increased expression:peritoneal fluid,tissue RGD Mir21 Rat peritonitis ISO RGD:1608349 11342022 RGD Mir21 Rat primary biliary cholangitis severity ISO RGD:1349265 21408577 RGD Mir21 Rat pulmonary fibrosis treatment IEP 41404715 RGD Mir21 Rat pulmonary hypertension IEP 41410883 RNA:increased expression:lung RGD Mir21 Rat respiratory syncytial virus infectious disease ameliorates ISO RGD:1608349 41404696 associated with asthma; RGD Mir21 Rat sciatic neuropathy IEP 151893491 RNA:increased expression:dorsal root ganglion neuron RGD Mir21 Rat skin melanoma disease_progression ISO RGD:1349265 11342032 RNA:increased expression:skin (human) RGD Mir21 Rat skin papilloma ameliorates ISO RGD:1608349 41404663 RGD Mir21 Rat Spinal Cord Injuries exacerbates IMP 41410823 RGD Mir21 Rat status epilepticus IEP 41404707 RNA:increased expression: hippocampus RGD Mir21 Rat status epilepticus ameliorates IMP 41404714 RGD Mir21 Rat stomach cancer ISO RGD:1349265 152998900 RNA:increased expression:blood serum (human) RGD Mir21 Rat thyroid cancer ameliorates IMP 41404697 RGD Mir21 Rat toxic shock syndrome exacerbates ISO RGD:1608349 41404641 RGD Mir21 Rat toxic shock syndrome ameliorates ISO RGD:1608349 41404698 RGD Mir21 Rat Varicose Ulcer ISO RGD:1349265 10412021 miRNA:increased expression:skin: RGD Mir21 Rat Viral Myocarditis ameliorates ISO RGD:1608349 41404640 associated with Coxsackievirus Infections RGD Mir21 Rat Viral Myocarditis ameliorates ISO RGD:1608349 41404700 associated with Coxsackievirus Infections RGD Mir21 Rat visceral leishmaniasis treatment ISO RGD:1608349 40925951 RGD
Only show annotations with direct experimental evidence (0 objects hidden)
Mir21 Rat (-)-Arctigenin decreases expression ISO RGD:1349265 6480464 arctigenin results in decreased expression of MIR21 mRNA CTD PMID:25380086 Mir21 Rat (-)-Arctigenin multiple interactions ISO RGD:1349265 6480464 arctigenin inhibits the reaction [Quercetin results in increased expression of MIR21 mRNA] CTD PMID:25380086 Mir21 Rat (R)-lipoic acid multiple interactions EXP 6480464 Cyclosporine inhibits the reaction [Thioctic Acid promotes the reaction [Acetic Acid results in increased expression more ... CTD PMID:26276312 Mir21 Rat 1,2-dichloroethane increases expression ISO RGD:1608349 6480464 ethylene dichloride results in increased expression of MIR21A mRNA CTD PMID:28960355 Mir21 Rat 17beta-estradiol multiple interactions ISO RGD:1349265 6480464 afimoxifene inhibits the reaction [Estradiol results in decreased expression of MIR21 mRNA]; Cycloheximide inhibits the more ... CTD PMID:19264808|PMID:20302909|PMID:22403704|PMID:23052036|PMID:24758408 Mir21 Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of MIR21 mRNA CTD PMID:26945725 Mir21 Rat 17beta-estradiol decreases expression ISO RGD:1349265 6480464 Estradiol results in decreased expression of MIR21 mRNA CTD PMID:19264808|PMID:20302909|PMID:22403704|PMID:23052036|PMID:24758408|PMID:24877718 Mir21 Rat 17beta-hydroxy-5alpha-androstan-3-one multiple interactions ISO RGD:1349265 6480464 bicalutamide inhibits the reaction [Dihydrotestosterone results in increased expression of MIR21 mRNA]; Cycloheximide inhibits the more ... CTD PMID:23052036 Mir21 Rat 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO RGD:1349265 6480464 Dihydrotestosterone results in increased expression of MIR21 mRNA CTD PMID:23052036|PMID:29581250 Mir21 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:1608349 6480464 Tetrachlorodibenzodioxin results in increased expression of MIR21A mRNA CTD PMID:37318321 Mir21 Rat 2,3-bis(4-hydroxyphenyl)propionitrile decreases expression ISO RGD:1349265 6480464 2,3-bis(4-hydroxyphenyl)-propionitrile results in decreased expression of MIR21 mRNA CTD PMID:19264808 Mir21 Rat 2,5-hexanedione decreases expression EXP 6480464 2,5-hexanedione results in decreased expression of MIR21 mRNA CTD PMID:31760062 Mir21 Rat 2,5-hexanedione increases expression EXP 6480464 2,5-hexanedione results in increased expression of MIR21 mRNA CTD PMID:31760062 Mir21 Rat 2-acetamidofluorene increases expression EXP 6480464 2-Acetylaminofluorene results in increased expression of MIR21 mRNA CTD PMID:19167416 Mir21 Rat 2-hydroxypropanoic acid increases expression ISO RGD:1349265 6480464 Lactic Acid results in increased expression of MIR21 mRNA CTD PMID:30851411 Mir21 Rat 3,7-dihydropurine-6-thione increases expression EXP 6480464 Mercaptopurine results in increased expression of MIR21 mRNA CTD PMID:23358152 Mir21 Rat 3-chloropropane-1,2-diol decreases expression EXP 6480464 alpha-Chlorohydrin results in decreased expression of MIR21 mRNA CTD PMID:34461274 Mir21 Rat 4-(N-nitrosomethylamino)-1-(3-pyridyl)butan-1-one increases expression ISO RGD:1349265 6480464 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone results in increased expression of MIR21 mRNA CTD PMID:32326378 Mir21 Rat 4-(N-nitrosomethylamino)-1-(3-pyridyl)butan-1-one multiple interactions ISO RGD:1349265 6480464 MIR21 mRNA affects the reaction [4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone results in decreased expression of MSH2 protein] CTD PMID:32326378 Mir21 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of MIR21 mRNA CTD PMID:39441382 Mir21 Rat acetic acid multiple interactions EXP 6480464 Cyclosporine inhibits the reaction [Thioctic Acid promotes the reaction [Acetic Acid results in increased expression more ... CTD PMID:26276312 Mir21 Rat acetic acid increases expression EXP 6480464 Acetic Acid results in increased expression of MIR21 mRNA CTD PMID:26276312 Mir21 Rat actinomycin D multiple interactions ISO RGD:1349265 6480464 Dactinomycin inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA]; Dactinomycin inhibits the more ... CTD PMID:19264808|PMID:23052036|PMID:25969534 Mir21 Rat afimoxifene increases expression ISO RGD:1349265 6480464 afimoxifene results in increased expression of MIR21 mRNA CTD PMID:19264808 Mir21 Rat afimoxifene multiple interactions ISO RGD:1349265 6480464 afimoxifene inhibits the reaction [Estradiol results in decreased expression of MIR21 mRNA] CTD PMID:19264808 Mir21 Rat aflatoxin B1 increases expression EXP 6480464 Aflatoxin B1 results in increased expression of MIR21 mRNA CTD PMID:24472605 Mir21 Rat alcohol decreases expression ISO RGD:1349265 598099545 alcohol decreases expression of MIR21 miRNA in blood plasma (females only) RGD Mir21 Rat alcohol multiple interactions ISO RGD:1608349 598099545 alcohol increases expression of Mir21 miRNA in blood plasma and decreases expression of Mir21 miRNA more ... RGD Mir21 Rat all-trans-retinoic acid increases expression ISO RGD:1349265 6480464 Tretinoin results in increased expression of MIR21 mRNA CTD PMID:21934132 Mir21 Rat all-trans-retinoic acid multiple interactions ISO RGD:1349265 6480464 [Tretinoin co-treated with Phenylbutyrates co-treated with 1-hydroxy-2-oxo-3,3-bis(2-aminoethyl)-1-triazene] results in increased expression of MIR21 mRNA CTD PMID:23284745 Mir21 Rat Allylamine increases expression EXP 6480464 Allylamine results in increased expression of MIR21 mRNA CTD PMID:29355689 Mir21 Rat aluminium atom multiple interactions ISO RGD:1349265 6480464 [Air Pollutants, Occupational results in increased abundance of Aluminum] which results in increased expression of more ... CTD PMID:27506416 Mir21 Rat aluminium(0) multiple interactions ISO RGD:1349265 6480464 [Air Pollutants, Occupational results in increased abundance of Aluminum] which results in increased expression of more ... CTD PMID:27506416 Mir21 Rat anthra[1,9-cd]pyrazol-6(2H)-one affects expression ISO RGD:1349265 6480464 pyrazolanthrone affects the expression of MIR21 mRNA CTD PMID:24434654 Mir21 Rat anthra[1,9-cd]pyrazol-6(2H)-one multiple interactions ISO RGD:1349265 6480464 pyrazolanthrone affects the reaction [arsenic trichloride affects the expression of MIR21 mRNA] CTD PMID:24434654 Mir21 Rat antigen increases expression ISO RGD:1608349 6480464 Antigens results in increased expression of MIR21A mRNA CTD PMID:27038180 Mir21 Rat antigen multiple interactions ISO RGD:1608349 6480464 [Dronabinol inhibits the reaction [Antigens results in increased expression of MIR21A mRNA]] which results in more ... CTD PMID:27038180 Mir21 Rat antirheumatic drug decreases expression ISO RGD:1349265 6480464 Antirheumatic Agents results in decreased expression of MIR21 mRNA CTD PMID:24449571 Mir21 Rat aristolochic acid A increases expression EXP 6480464 aristolochic acid I results in increased expression of MIR21 mRNA CTD PMID:27422293 Mir21 Rat arsane increases expression ISO RGD:1349265 6480464 Arsenic results in increased expression of MIR21 mRNA CTD PMID:18039032|PMID:31359311|PMID:35031324 Mir21 Rat arsane increases expression ISO RGD:1608349 6480464 Arsenic results in increased expression of MIR21A mRNA CTD PMID:36463740 Mir21 Rat arsane multiple interactions ISO RGD:1349265 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of MIR21 more ... CTD PMID:32525701 Mir21 Rat arsenic atom multiple interactions ISO RGD:1349265 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of MIR21 more ... CTD PMID:32525701 Mir21 Rat arsenic atom increases expression ISO RGD:1608349 6480464 Arsenic results in increased expression of MIR21A mRNA CTD PMID:36463740 Mir21 Rat arsenic atom increases expression ISO RGD:1349265 6480464 Arsenic results in increased expression of MIR21 mRNA CTD PMID:18039032|PMID:31359311|PMID:35031324 Mir21 Rat arsenic trichloride multiple interactions ISO RGD:1349265 6480464 MIR21 mRNA affects the reaction [arsenic trichloride results in increased expression of RIOX2 mRNA]; pyrazolanthrone more ... CTD PMID:24434654 Mir21 Rat arsenic trichloride affects expression ISO RGD:1349265 6480464 arsenic trichloride affects the expression of MIR21 mRNA CTD PMID:24434654 Mir21 Rat arsenite(3-) increases expression ISO RGD:1349265 6480464 arsenite results in increased expression of MIR21 mRNA CTD PMID:22387281|PMID:22728250|PMID:23469214 Mir21 Rat arsenite(3-) multiple interactions ISO RGD:1608349 6480464 CAT protein inhibits the reaction [arsenite results in increased expression of MIR21 mRNA] CTD PMID:22387281 Mir21 Rat arsenite(3-) increases expression ISO RGD:1608349 6480464 arsenite results in increased expression of MIR21 mRNA CTD PMID:22387281 Mir21 Rat arsenite(3-) multiple interactions ISO RGD:1349265 6480464 3-(4-methylphenylsulfonyl)-2-propenenitrile inhibits the reaction [arsenite promotes the reaction [RELA protein binds to MIR21 promoter]]; 3-(4-methylphenylsulfonyl)-2-propenenitrile more ... CTD PMID:22387281|PMID:24004609 Mir21 Rat arsenous acid decreases response to substance ISO RGD:1349265 6480464 MIR21 results in decreased susceptibility to Arsenic Trioxide CTD PMID:21187093 Mir21 Rat arsenous acid increases expression EXP 6480464 Arsenic Trioxide results in increased expression of MIR21 mRNA CTD PMID:25395240 Mir21 Rat arsenous acid multiple interactions ISO RGD:1349265 6480464 MIR21 mRNA promotes the reaction [Arsenic Trioxide results in decreased expression of KCNH2 protein]; MIR21 more ... CTD PMID:25395240 Mir21 Rat arsenous acid increases expression ISO RGD:1349265 6480464 Arsenic Trioxide results in increased expression of MIR21 mRNA CTD PMID:22072212|PMID:25395240 Mir21 Rat baicalein multiple interactions ISO RGD:1349265 6480464 baicalein inhibits the reaction [TGFB1 protein results in increased expression of MIR21 mRNA]; MIR21 mRNA more ... CTD PMID:30201452 Mir21 Rat Bandrowski's base decreases expression ISO RGD:1349265 6480464 Bandrowski's base results in decreased expression of MIR21 mRNA CTD PMID:32939143 Mir21 Rat benomyl decreases expression EXP 6480464 Benomyl results in decreased expression of MIR21 mRNA CTD PMID:33930522 Mir21 Rat benzene-1,2,4-triol increases expression ISO RGD:1349265 6480464 hydroxyhydroquinone results in increased expression of MIR21 mRNA CTD PMID:39245080 Mir21 Rat berberine decreases expression ISO RGD:1349265 152995489 berberine decreases expression of MIR21 RNA in colon epithelial cell RGD Mir21 Rat bicalutamide multiple interactions ISO RGD:1349265 6480464 bicalutamide inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA]; bicalutamide inhibits the more ... CTD PMID:23052036|PMID:25969534 Mir21 Rat biphenyl-4-amine increases expression ISO RGD:1349265 6480464 4-biphenylamine results in increased expression of MIR21 mRNA CTD PMID:24857880 Mir21 Rat bis(2-chloroethyl) sulfide decreases expression ISO RGD:1608349 6480464 Mustard Gas results in decreased expression of MIR21A mRNA CTD PMID:26456178 Mir21 Rat bis(2-ethylhexyl) phthalate decreases expression ISO RGD:1608349 6480464 Diethylhexyl Phthalate results in decreased expression of MIR21A CTD PMID:32642447 Mir21 Rat bisphenol A affects expression ISO RGD:1349265 6480464 bisphenol A affects the expression of MIR21 mRNA CTD PMID:20170705|PMID:22403704 Mir21 Rat bisphenol A multiple interactions ISO RGD:1608349 6480464 MAP2K3 protein inhibits the reaction [MIR21A mRNA inhibits the reaction [bisphenol A results in increased more ... CTD PMID:26996129 Mir21 Rat bisphenol A decreases expression ISO RGD:1608349 6480464 bisphenol A results in decreased expression of MIR21A mRNA CTD PMID:26996129 Mir21 Rat bisphenol A increases expression ISO RGD:1608349 6480464 bisphenol A results in increased expression of MIR21 mRNA CTD PMID:28774890 Mir21 Rat bisphenol A decreases expression ISO RGD:1349265 6480464 bisphenol A results in decreased expression of MIR21 mRNA CTD PMID:23629000 Mir21 Rat bisphenol A multiple interactions ISO RGD:1349265 6480464 4-(6-bromo-1,3-benzodioxol-5-yl)-3a,4,5,9b-3H-cyclopenta(c)quinoline inhibits the reaction [bisphenol A results in increased expression of MIR21 mRNA]; ESR1 protein more ... CTD PMID:22403704|PMID:37610061 Mir21 Rat bisphenol A increases expression ISO RGD:1349265 6480464 bisphenol A results in increased expression of MIR21 mRNA CTD PMID:20417706|PMID:37610061 Mir21 Rat bleomycin A2 increases expression EXP 6480464 Bleomycin results in increased expression of MIR21 mRNA CTD PMID:25933445 Mir21 Rat boric acid decreases expression ISO RGD:1349265 6480464 boric acid results in decreased expression of MIR21 mRNA CTD PMID:34175401 Mir21 Rat bortezomib increases expression ISO RGD:1349265 6480464 Bortezomib results in increased expression of MIR21 mRNA CTD PMID:20977926 Mir21 Rat cadmium atom decreases expression ISO RGD:1349265 6480464 Cadmium results in decreased expression of MIR21 mRNA CTD PMID:24376830 Mir21 Rat cadmium atom multiple interactions ISO RGD:1608349 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of MIR21A more ... CTD PMID:28892167 Mir21 Rat cadmium dichloride decreases expression ISO RGD:1349265 6480464 Cadmium Chloride results in decreased expression of MIR21 mRNA CTD PMID:20145152|PMID:26314618 Mir21 Rat cadmium dichloride multiple interactions ISO RGD:1608349 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of MIR21A more ... CTD PMID:28892167 Mir21 Rat cannabidiol multiple interactions ISO RGD:1608349 6480464 [lipopolysaccharide, E coli O55-B5 co-treated with Cannabidiol] results in increased expression of MIR21A mRNA CTD PMID:30742662 Mir21 Rat carbamazepine increases expression ISO RGD:1349265 6480464 Carbamazepine results in increased expression of MIR21 mRNA CTD PMID:29644860 Mir21 Rat carbon atom increases expression ISO RGD:1349265 6480464 Carbon results in increased expression of MIR21 mRNA CTD PMID:26068961 Mir21 Rat carbon atom multiple interactions ISO RGD:1349265 6480464 [Air Pollutants results in increased abundance of [Carbon co-treated with Particulate Matter]] which results in more ... CTD PMID:31268311 Mir21 Rat carbon monoxide multiple interactions ISO RGD:1349265 6480464 [Air Pollutants results in increased abundance of [Particulate Matter co-treated with Carbon co-treated with Sulfur more ... CTD PMID:31268311 Mir21 Rat chromium(6+) multiple interactions ISO RGD:1349265 6480464 Acetylcysteine inhibits the reaction [chromium hexavalent ion results in increased expression of MIR21 mRNA]; CAT more ... CTD PMID:27323401|PMID:27344173|PMID:28881718 Mir21 Rat chromium(6+) increases expression ISO RGD:1608349 6480464 chromium hexavalent ion results in increased expression of MIR21 mRNA CTD PMID:27323401 Mir21 Rat chromium(6+) increases response to substance ISO RGD:1349265 6480464 MIR21 mRNA results in increased susceptibility to chromium hexavalent ion CTD PMID:27344173 Mir21 Rat chromium(6+) increases expression ISO RGD:1349265 6480464 chromium hexavalent ion results in increased expression of MIR21 mRNA CTD PMID:27323401|PMID:27344173|PMID:28881718 Mir21 Rat cisplatin increases expression EXP 6480464 Cisplatin results in increased expression of MIR21 mRNA CTD PMID:24880025|PMID:36006825 Mir21 Rat cisplatin multiple interactions EXP 6480464 Melatonin inhibits the reaction [Cisplatin results in increased expression of MIR21 mRNA] CTD PMID:36006825 Mir21 Rat cisplatin multiple interactions ISO RGD:1349265 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [[MIR21 mRNA results in decreased susceptibility to Cisplatin] which results in more ... CTD PMID:23466500 Mir21 Rat cisplatin decreases response to substance ISO RGD:1349265 6480464 MIR21 mRNA results in decreased susceptibility to Cisplatin CTD PMID:23466500 Mir21 Rat cisplatin increases expression ISO RGD:1349265 6480464 Cisplatin results in increased expression of MIR21 mRNA CTD PMID:20145152 Mir21 Rat cobalt atom multiple interactions ISO RGD:1608349 6480464 [tungsten carbide analog co-treated with Cobalt analog] results in increased expression of MIR21 mRNA CTD PMID:23758151 Mir21 Rat copper atom decreases expression EXP 6480464 Copper results in decreased expression of MIR21 mRNA CTD PMID:30556269 Mir21 Rat copper(0) decreases expression EXP 6480464 Copper results in decreased expression of MIR21 mRNA CTD PMID:30556269 Mir21 Rat coumestrol multiple interactions ISO RGD:1349265 6480464 [Coumestrol co-treated with 2,3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of MIR21 mRNA CTD PMID:19167446 Mir21 Rat curcumin decreases expression ISO RGD:1349265 6480464 Curcumin results in decreased expression of MIR21 mRNA CTD PMID:29723631 Mir21 Rat cycloheximide multiple interactions ISO RGD:1349265 6480464 Cycloheximide inhibits the reaction [Dihydrotestosterone results in increased expression of MIR21 mRNA]; Cycloheximide inhibits the more ... CTD PMID:19264808|PMID:23052036 Mir21 Rat cycloheximide increases expression ISO RGD:1349265 6480464 Cycloheximide results in increased expression of MIR21 mRNA CTD PMID:23052036 Mir21 Rat cyclosporin A multiple interactions EXP 6480464 Cyclosporine inhibits the reaction [Thioctic Acid promotes the reaction [Acetic Acid results in increased expression more ... CTD PMID:26276312 Mir21 Rat cypermethrin increases expression EXP 6480464 cypermethrin results in increased expression of MIR21 CTD PMID:35512476 Mir21 Rat cypermethrin multiple interactions EXP 6480464 MIR21 promotes the reaction [cypermethrin results in decreased expression of HES1 protein]; MIR21 promotes the more ... CTD PMID:35512476 Mir21 Rat dapagliflozin multiple interactions EXP 6480464 dapagliflozin inhibits the reaction [Streptozocin results in increased expression of MIR21 mRNA] CTD PMID:37352119 Mir21 Rat daunorubicin decreases response to substance ISO RGD:1349265 6480464 MIR21 results in decreased susceptibility to Daunorubicin CTD PMID:21187093 Mir21 Rat DDT decreases expression ISO RGD:1349265 6480464 DDT results in decreased expression of MIR21 mRNA CTD PMID:22403704 Mir21 Rat DDT increases expression EXP 6480464 DDT results in increased expression of MIR21 mRNA CTD PMID:32508177 Mir21 Rat dehydroepiandrosterone increases expression ISO RGD:1349265 6480464 Dehydroepiandrosterone results in increased expression of MIR21 mRNA CTD PMID:25969534 Mir21 Rat dehydroepiandrosterone multiple interactions ISO RGD:1349265 6480464 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA]; 4-(6-bromo-1,3-benzodioxol-5-yl)-3a,4,5,9b-3H-cyclopenta(c)quinoline inhibits the more ... CTD PMID:25969534 Mir21 Rat diallyl trisulfide decreases expression ISO RGD:1349265 6480464 diallyl trisulfide results in decreased expression of MIR21 mRNA CTD PMID:23430952 Mir21 Rat diarsenic trioxide increases expression ISO RGD:1349265 6480464 Arsenic Trioxide results in increased expression of MIR21 mRNA CTD PMID:22072212|PMID:25395240 Mir21 Rat diarsenic trioxide decreases response to substance ISO RGD:1349265 6480464 MIR21 results in decreased susceptibility to Arsenic Trioxide CTD PMID:21187093 Mir21 Rat diarsenic trioxide increases expression EXP 6480464 Arsenic Trioxide results in increased expression of MIR21 mRNA CTD PMID:25395240 Mir21 Rat diarsenic trioxide multiple interactions ISO RGD:1349265 6480464 MIR21 mRNA promotes the reaction [Arsenic Trioxide results in decreased expression of KCNH2 protein]; MIR21 more ... CTD PMID:25395240 Mir21 Rat dioxygen increases expression EXP 6480464 Oxygen results in increased expression of MIR21 mRNA CTD PMID:22911455 Mir21 Rat dioxygen increases expression ISO RGD:1608349 6480464 Oxygen results in increased expression of MIR21 CTD PMID:35848756 Mir21 Rat diuron multiple interactions ISO RGD:1349265 6480464 MIR21 inhibits the reaction [Diuron results in decreased secretion of GZMB protein] CTD PMID:35967413 Mir21 Rat dorsomorphin multiple interactions ISO RGD:1349265 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Mir21 Rat doxorubicin increases expression ISO RGD:1349265 6480464 Doxorubicin results in increased expression of MIR21 mRNA CTD PMID:26842497|PMID:32505695 Mir21 Rat elemental carbon increases expression ISO RGD:1349265 6480464 Carbon results in increased expression of MIR21 mRNA CTD PMID:26068961 Mir21 Rat elemental carbon multiple interactions ISO RGD:1349265 6480464 [Air Pollutants results in increased abundance of [Carbon co-treated with Particulate Matter]] which results in more ... CTD PMID:31268311 Mir21 Rat Enterolactone multiple interactions ISO RGD:1349265 6480464 [Coumestrol co-treated with 2,3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of MIR21 mRNA CTD PMID:19167446 Mir21 Rat fenhexamid increases expression ISO RGD:1349265 6480464 N-(2,3-dichloro-4-hydroxyphenyl)-1-methylcyclohexanecarboxamide results in increased expression of MIR21 mRNA CTD PMID:23052036 Mir21 Rat fenhexamid multiple interactions ISO RGD:1349265 6480464 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [N-(2,3-dichloro-4-hydroxyphenyl)-1-methylcyclohexanecarboxamide results in increased expression of MIR21 mRNA]; bicalutamide inhibits the more ... CTD PMID:23052036 Mir21 Rat ferulic acid multiple interactions EXP 6480464 [Resveratrol co-treated with Phytic Acid co-treated with ferulic acid co-treated with Quercetin] results in increased more ... CTD PMID:21203465|PMID:32278740 Mir21 Rat ferulic acid increases expression EXP 6480464 ferulic acid results in increased expression of MIR21 mRNA CTD PMID:32278740 Mir21 Rat fludioxonil multiple interactions ISO RGD:1349265 6480464 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one inhibits the reaction [fludioxonil results in increased expression of MIR21 mRNA]; bicalutamide inhibits the more ... CTD PMID:23052036 Mir21 Rat fludioxonil increases expression ISO RGD:1349265 6480464 fludioxonil results in increased expression of MIR21 mRNA CTD PMID:23052036 Mir21 Rat formaldehyde decreases expression ISO RGD:1349265 6480464 Formaldehyde results in decreased expression of MIR21 mRNA CTD PMID:21147603 Mir21 Rat fulvestrant multiple interactions ISO RGD:1349265 6480464 4-(6-bromo-1,3-benzodioxol-5-yl)-3a,4,5,9b-3H-cyclopenta(c)quinoline inhibits the reaction [fulvestrant results in increased expression of MIR21 mRNA]; fulvestrant inhibits the more ... CTD PMID:19264808|PMID:23052036|PMID:25969534 Mir21 Rat fulvestrant increases expression ISO RGD:1349265 6480464 fulvestrant results in increased expression of MIR21 mRNA CTD PMID:25969534 Mir21 Rat fumonisin B1 increases expression ISO RGD:1349265 6480464 fumonisin B1 results in increased expression of MIR21 mRNA CTD PMID:39414224 Mir21 Rat gallic acid increases expression EXP 6480464 Gallic Acid results in increased expression of MIR21 mRNA CTD PMID:32278740 Mir21 Rat gallic acid multiple interactions EXP 6480464 Gallic Acid inhibits the reaction [Thioacetamide results in increased expression of MIR21 mRNA] CTD PMID:32278740 Mir21 Rat geldanamycin increases expression ISO RGD:1349265 6480464 geldanamycin results in increased expression of MIR21 mRNA CTD PMID:26705709 Mir21 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of MIR21 mRNA CTD PMID:22705808|PMID:24863737 Mir21 Rat glycidol affects expression EXP 6480464 glycidol affects the expression of MIR21 mRNA CTD PMID:34461274 Mir21 Rat graphene oxide affects expression ISO RGD:1349265 6480464 graphene oxide affects the expression of MIR21 mRNA CTD PMID:32070776 Mir21 Rat halothane affects expression ISO RGD:1608349 6480464 Halothane affects the expression of MIR21A mRNA CTD PMID:24598351 Mir21 Rat hydrogen peroxide multiple interactions ISO RGD:1349265 6480464 CAT protein inhibits the reaction [Hydrogen Peroxide results in increased expression of MIR21 mRNA] CTD PMID:22387281 Mir21 Rat hydrogen peroxide affects expression ISO RGD:1349265 6480464 Hydrogen Peroxide affects the expression of MIR21 mRNA CTD PMID:26339600 Mir21 Rat hydrogen peroxide increases expression ISO RGD:1349265 6480464 Hydrogen Peroxide results in increased expression of MIR21 mRNA CTD PMID:22387281|PMID:25460656 Mir21 Rat icariin increases expression ISO RGD:1608349 6480464 icariin results in increased expression of MIR21A mRNA CTD PMID:30533443 Mir21 Rat isoprenaline increases expression EXP 6480464 Isoproterenol results in increased expression of MIR21 mRNA CTD PMID:28526319|PMID:29355689 Mir21 Rat lamotrigine increases expression ISO RGD:1349265 6480464 lamotrigine results in increased expression of MIR21 mRNA CTD PMID:29644860 Mir21 Rat lipoic acid multiple interactions EXP 6480464 Cyclosporine inhibits the reaction [Thioctic Acid promotes the reaction [Acetic Acid results in increased expression more ... CTD PMID:26276312 Mir21 Rat lithium atom multiple interactions EXP 6480464 [Lithium Carbonate results in increased abundance of Lithium] which results in increased expression of MIR21 more ... CTD PMID:31928237 Mir21 Rat lithium carbonate multiple interactions EXP 6480464 [Lithium Carbonate results in increased abundance of Lithium] which results in increased expression of MIR21 more ... CTD PMID:31928237 Mir21 Rat lithium hydride multiple interactions EXP 6480464 [Lithium Carbonate results in increased abundance of Lithium] which results in increased expression of MIR21 more ... CTD PMID:31928237 Mir21 Rat LY294002 decreases expression ISO RGD:1349265 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one results in decreased expression of MIR21 mRNA CTD PMID:23272133 Mir21 Rat LY294002 multiple interactions ISO RGD:1349265 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [[MIR21 mRNA results in decreased susceptibility to Cisplatin] which results in more ... CTD PMID:23466500 Mir21 Rat mechlorethamine increases expression EXP 6480464 Mechlorethamine results in increased expression of MIR21 mRNA CTD PMID:33971176 Mir21 Rat medroxyprogesterone acetate increases expression ISO RGD:1349265 6480464 Medroxyprogesterone Acetate results in increased expression of MIR21 mRNA CTD PMID:22543862 Mir21 Rat melatonin multiple interactions EXP 6480464 Melatonin inhibits the reaction [Cisplatin results in increased expression of MIR21 mRNA] CTD PMID:36006825 Mir21 Rat mercaptopurine increases expression EXP 6480464 Mercaptopurine results in increased expression of MIR21 mRNA CTD PMID:23358152 Mir21 Rat methanol increases expression ISO RGD:1608349 6480464 Methanol results in increased expression of MIR21 CTD PMID:36780935 Mir21 Rat methanol decreases expression ISO RGD:1608349 6480464 Methanol results in decreased expression of MIR21 CTD PMID:36780935 Mir21 Rat methapyrilene increases expression EXP 6480464 Methapyrilene results in increased expression of MIR21 mRNA CTD PMID:24880025 Mir21 Rat methyl beta-cyclodextrin multiple interactions ISO RGD:1349265 6480464 methyl-beta-cyclodextrin inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA] CTD PMID:25969534 Mir21 Rat methylmercury chloride increases expression ISO RGD:1349265 6480464 methylmercuric chloride results in increased expression of MIR21 mRNA CTD PMID:28001369 Mir21 Rat morphine decreases expression ISO RGD:1349265 6480464 Morphine results in decreased expression of MIR21 CTD PMID:20564181 Mir21 Rat myo-inositol hexakisphosphate multiple interactions EXP 6480464 [resveratrol co-treated with Phytic Acid co-treated with ferulic acid co-treated with Quercetin] results in increased more ... CTD PMID:21203465 Mir21 Rat N-acetyl-L-cysteine multiple interactions ISO RGD:1349265 6480464 Acetylcysteine inhibits the reaction [chromium hexavalent ion results in increased expression of MIR21 mRNA]; Acetylcysteine more ... CTD PMID:23584289|PMID:27323401 Mir21 Rat N-acetyl-L-cysteine multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [[Lithium Carbonate results in increased abundance of Lithium] which results in more ... CTD PMID:31928237 Mir21 Rat N-methyl-N'-nitro-N-nitrosoguanidine increases expression ISO RGD:1349265 6480464 Methylnitronitrosoguanidine results in increased expression of MIR21 mRNA CTD PMID:24821435 Mir21 Rat nickel atom increases expression ISO RGD:1349265 6480464 Nickel results in increased expression of MIR21 mRNA CTD PMID:23195993 Mir21 Rat nickel dichloride multiple interactions ISO RGD:1349265 6480464 3-(4-methylphenylsulfonyl)-2-propenenitrile inhibits the reaction [nickel chloride results in increased expression of MIR21 mRNA]; 4-((3-bromophenyl)amino)-6,7-dimethoxyquinazoline inhibits more ... CTD PMID:26026961 Mir21 Rat nickel dichloride increases expression ISO RGD:1349265 6480464 nickel chloride results in increased expression of MIR21 mRNA CTD PMID:26026961 Mir21 Rat nickel sulfate increases expression ISO RGD:1349265 6480464 nickel sulfate results in increased expression of MIR21 mRNA CTD PMID:22714537 Mir21 Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of MIR21 mRNA CTD PMID:26720608 Mir21 Rat notoginsenoside R1 multiple interactions ISO RGD:1608349 6480464 notoginsenoside R1 inhibits the reaction [APOE gene mutant form results in increased expression of MIR21A more ... CTD PMID:24933211 Mir21 Rat ochratoxin A decreases expression ISO RGD:1349265 6480464 ochratoxin A results in decreased expression of MIR21 mRNA CTD PMID:30559759 Mir21 Rat ochratoxin A increases expression ISO RGD:1608349 6480464 ochratoxin A results in increased expression of MIR21A mRNA CTD PMID:28710020 Mir21 Rat ozone increases expression ISO RGD:1608349 6480464 Ozone results in increased expression of MIR21A CTD PMID:35201360 Mir21 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of MIR21 mRNA CTD PMID:27397436 Mir21 Rat paracetamol multiple interactions ISO RGD:1608349 6480464 [MIR21 gene mutant form results in increased expression of PPARG protein] which results in decreased more ... CTD PMID:38180883 Mir21 Rat paracetamol decreases response to substance ISO RGD:1608349 6480464 MIR21 gene mutant form results in decreased susceptibility to Acetaminophen CTD PMID:38180883 Mir21 Rat paracetamol affects expression ISO RGD:1608349 6480464 Acetaminophen affects the expression of MIR21A mRNA CTD PMID:19246379 Mir21 Rat paracetamol increases expression ISO RGD:1349265 6480464 Acetaminophen results in increased expression of MIR21 mRNA CTD PMID:25092309|PMID:28545106 Mir21 Rat paraquat multiple interactions ISO RGD:1608349 6480464 plant extract, Puerariae Radix inhibits the reaction [Paraquat results in increased expression of MIR21 mRNA] CTD PMID:26758514 Mir21 Rat paraquat multiple interactions EXP 6480464 Thalidomide inhibits the reaction [Paraquat results in decreased expression of MIR21] CTD PMID:33015978 Mir21 Rat paraquat decreases expression EXP 6480464 Paraquat results in decreased expression of MIR21 CTD PMID:33015978 Mir21 Rat paraquat increases expression ISO RGD:1608349 6480464 Paraquat results in increased expression of MIR21 mRNA CTD PMID:26758514 Mir21 Rat perfluorooctane-1-sulfonic acid increases expression EXP 6480464 perfluorooctane sulfonic acid results in increased expression of MIR21 mRNA CTD PMID:24420840 Mir21 Rat phenylephrine increases expression EXP 6480464 Phenylephrine results in increased expression of MIR21 mRNA CTD PMID:17525252 Mir21 Rat phenylmercury acetate increases expression ISO RGD:1349265 6480464 Phenylmercuric Acetate results in increased expression of MIR21 mRNA CTD PMID:26272509 Mir21 Rat phenylmercury acetate multiple interactions ISO RGD:1349265 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Mir21 Rat PhIP decreases expression ISO RGD:1349265 6480464 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine results in decreased expression of MIR21 mRNA CTD PMID:24877718 Mir21 Rat piperacillin increases expression ISO RGD:1349265 6480464 Piperacillin results in increased expression of MIR21 mRNA CTD PMID:29644860 Mir21 Rat potassium bromate increases expression ISO RGD:1349265 6480464 potassium bromate results in increased expression of MIR21 mRNA CTD PMID:30559759 Mir21 Rat progesterone increases expression ISO RGD:1349265 6480464 Progesterone results in increased expression of MIR21 mRNA CTD PMID:30328349 Mir21 Rat purine-6-thiol increases expression EXP 6480464 Mercaptopurine results in increased expression of MIR21 mRNA CTD PMID:23358152 Mir21 Rat quercetin multiple interactions EXP 6480464 [resveratrol co-treated with Phytic Acid co-treated with ferulic acid co-treated with Quercetin] results in increased more ... CTD PMID:21203465 Mir21 Rat quercetin decreases expression EXP 6480464 Quercetin results in decreased expression of MIR21 mRNA CTD PMID:26432773 Mir21 Rat quercetin increases expression ISO RGD:1349265 6480464 Quercetin results in increased expression of MIR21 mRNA CTD PMID:25380086 Mir21 Rat quercetin multiple interactions ISO RGD:1349265 6480464 [Quercetin co-treated with hyperoside] results in decreased expression of MIR21 mRNA; arctigenin inhibits the reaction more ... CTD PMID:25354548|PMID:25380086|PMID:27344173|PMID:28881718 Mir21 Rat quercetin 3-O-beta-D-galactopyranoside multiple interactions ISO RGD:1349265 6480464 [Quercetin co-treated with hyperoside] results in decreased expression of MIR21 mRNA; MIR21 mRNA inhibits the more ... CTD PMID:25354548 Mir21 Rat rac-lactic acid increases expression ISO RGD:1349265 6480464 Lactic Acid results in increased expression of MIR21 mRNA CTD PMID:30851411 Mir21 Rat resveratrol increases expression EXP 6480464 resveratrol results in increased expression of MIR21 mRNA CTD PMID:21203465 Mir21 Rat resveratrol affects expression EXP 6480464 resveratrol affects the expression of MIR21 mRNA CTD PMID:22050707|PMID:24447120 Mir21 Rat resveratrol affects response to substance ISO RGD:1349265 6480464 MIR21 mRNA affects the susceptibility to resveratrol CTD PMID:23272133 Mir21 Rat resveratrol decreases response to substance ISO RGD:1349265 6480464 resveratrol results in decreased susceptibility to MIR21 mRNA CTD PMID:23359184 Mir21 Rat resveratrol decreases expression ISO RGD:1349265 6480464 resveratrol results in decreased expression of MIR21 mRNA CTD PMID:20637737|PMID:23272133|PMID:23359184|PMID:24535223 Mir21 Rat resveratrol multiple interactions ISO RGD:1349265 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of MIR21 mRNA; MIR21 mRNA inhibits more ... CTD PMID:23359184|PMID:23557933|PMID:24535223 Mir21 Rat resveratrol multiple interactions EXP 6480464 [resveratrol co-treated with Phytic Acid co-treated with ferulic acid co-treated with Quercetin] results in increased more ... CTD PMID:21203465 Mir21 Rat rifampicin increases expression ISO RGD:1349265 6480464 Rifampin results in increased expression of MIR21 mRNA CTD PMID:24552687 Mir21 Rat SB 431542 multiple interactions ISO RGD:1349265 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Mir21 Rat sodium arsenate multiple interactions ISO RGD:1349265 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of MIR21 more ... CTD PMID:32525701 Mir21 Rat sodium arsenite multiple interactions ISO RGD:1349265 6480464 3-(4-methylphenylsulfonyl)-2-propenenitrile inhibits the reaction [sodium arsenite results in increased expression of MIR21 mRNA]; [sodium arsenite more ... CTD PMID:24004609|PMID:26101800|PMID:27107786|PMID:35298964 Mir21 Rat sodium arsenite increases expression ISO RGD:1349265 6480464 sodium arsenite results in increased expression of MIR21 mRNA CTD PMID:26101800|PMID:27054085|PMID:27107786|PMID:35298964 Mir21 Rat sodium fluoride multiple interactions ISO RGD:1349265 6480464 CTNNB1 protein affects the reaction [Sodium Fluoride results in increased expression of MIR21 mRNA]; MIR21 more ... CTD PMID:34942272 Mir21 Rat sodium fluoride increases expression ISO RGD:1349265 6480464 Sodium Fluoride results in increased expression of MIR21 mRNA CTD PMID:34942272 Mir21 Rat solasodine decreases expression ISO RGD:1349265 6480464 solasodine results in decreased expression of MIR21; solasodine results in decreased expression of MIR21 mRNA CTD PMID:28283413|PMID:37121296 Mir21 Rat sporidesmin A multiple interactions ISO RGD:1349265 6480464 MIR21 mRNA affects the reaction [sporidesmin affects the expression of CYP2C8 mRNA]; MIR21 mRNA affects more ... CTD PMID:28193462 Mir21 Rat sporidesmin A increases expression ISO RGD:1349265 6480464 sporidesmin results in increased expression of MIR21 mRNA CTD PMID:28193462 Mir21 Rat stattic multiple interactions ISO RGD:1349265 6480464 stattic affects the reaction [arsenic trichloride affects the expression of MIR21 mRNA] CTD PMID:24434654 Mir21 Rat stattic affects expression ISO RGD:1349265 6480464 stattic affects the expression of MIR21 mRNA CTD PMID:24434654 Mir21 Rat streptozocin increases expression EXP 6480464 Streptozocin results in increased expression of MIR21 mRNA CTD PMID:37352119 Mir21 Rat streptozocin multiple interactions EXP 6480464 dapagliflozin inhibits the reaction [Streptozocin results in increased expression of MIR21 mRNA] CTD PMID:37352119 Mir21 Rat sulfamethoxazole increases expression ISO RGD:1349265 6480464 Sulfamethoxazole results in increased expression of MIR21 mRNA CTD PMID:29644860 Mir21 Rat sulfur dioxide multiple interactions ISO RGD:1349265 6480464 [Air Pollutants results in increased abundance of [Particulate Matter co-treated with Carbon co-treated with Sulfur more ... CTD PMID:31268311 Mir21 Rat tacrolimus hydrate increases expression ISO RGD:1608349 6480464 Tacrolimus results in increased expression of MIR21A mRNA CTD PMID:29362864 Mir21 Rat Tanshinone I multiple interactions ISO RGD:1349265 6480464 tanshinone inhibits the reaction [Particulate Matter results in increased expression of MIR21 protein] CTD PMID:35304817 Mir21 Rat tetrachloromethane affects expression EXP 6480464 Carbon Tetrachloride affects the expression of MIR21 mRNA CTD PMID:27397436 Mir21 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of MIR21 mRNA CTD PMID:22112502 Mir21 Rat thalidomide multiple interactions EXP 6480464 Thalidomide inhibits the reaction [Paraquat results in decreased expression of MIR21] CTD PMID:33015978 Mir21 Rat thioacetamide multiple interactions EXP 6480464 ferulic acid inhibits the reaction [Thioacetamide results in increased expression of MIR21 mRNA]; Gallic Acid more ... CTD PMID:32278740 Mir21 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of MIR21 mRNA CTD PMID:32278740 Mir21 Rat titanium dioxide increases expression ISO RGD:1608349 6480464 titanium dioxide results in increased expression of MIR21 mRNA CTD PMID:21259345 Mir21 Rat trichostatin A increases expression ISO RGD:1349265 6480464 trichostatin A results in increased expression of MIR21 mRNA CTD PMID:24935251 Mir21 Rat Tungsten carbide multiple interactions ISO RGD:1608349 6480464 [tungsten carbide analog co-treated with Cobalt analog] results in increased expression of MIR21 mRNA CTD PMID:23758151 Mir21 Rat tyrphostin AG 1478 multiple interactions ISO RGD:1349265 6480464 RTKI cpd inhibits the reaction [1-(4-(6-bromobenzo(1,3)dioxol-5-yl)-3a,4,5,9b-tetrahydro-3H-cyclopenta(c)quinolin-8-yl)ethanone results in increased expression of MIR21 mRNA]; RTKI cpd more ... CTD PMID:25969534 Mir21 Rat ursodeoxycholic acid increases expression ISO RGD:1349265 6480464 Ursodeoxycholic Acid results in increased expression of MIR21 mRNA CTD PMID:20689055 Mir21 Rat ursodeoxycholic acid increases expression EXP 6480464 Ursodeoxycholic Acid results in increased expression of MIR21 mRNA CTD PMID:20689055 Mir21 Rat valproic acid decreases expression ISO RGD:1349265 6480464 Valproic Acid results in decreased expression of MIR21 mRNA CTD PMID:29154799 Mir21 Rat valproic acid multiple interactions ISO RGD:1349265 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Mir21 Rat valproic acid increases expression ISO RGD:1349265 6480464 Valproic Acid results in increased expression of MIR21 mRNA CTD PMID:26272509|PMID:28001369 Mir21 Rat wortmannin multiple interactions ISO RGD:1349265 6480464 wortmannin inhibits the reaction [Dehydroepiandrosterone results in increased expression of MIR21 mRNA]; wortmannin inhibits the more ... CTD PMID:23052036|PMID:25969534 Mir21 Rat zinc atom increases expression EXP 6480464 Zinc deficiency results in increased expression of MIR21 mRNA CTD PMID:22689922 Mir21 Rat zinc atom multiple interactions EXP 6480464 Zinc inhibits the reaction [Zinc deficiency results in increased expression of MIR21 mRNA] CTD PMID:22689922 Mir21 Rat zinc(0) increases expression EXP 6480464 Zinc deficiency results in increased expression of MIR21 mRNA CTD PMID:22689922 Mir21 Rat zinc(0) multiple interactions EXP 6480464 Zinc inhibits the reaction [Zinc deficiency results in increased expression of MIR21 mRNA] CTD PMID:22689922
Biological Process
Only show annotations with direct experimental evidence (0 objects hidden)
Mir21 Rat BMP signaling pathway involved_in ISO RGD:1349265 1624291 PMID:18548003 RGD PMID:18548003 Mir21 Rat cellular response to angiotensin IEP 41404711 RGD Mir21 Rat cellular response to decreased oxygen levels acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:19147652 RGD PMID:19147652 Mir21 Rat cellular response to dexamethasone stimulus acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:24391219 RGD PMID:24391219 Mir21 Rat cellular response to gamma radiation involved_in ISO RGD:1349265 1624291 PMID:19826040 RGD PMID:19826040 Mir21 Rat cellular response to glucose stimulus IEP 41410820 RGD Mir21 Rat cellular response to granulocyte macrophage colony-stimulating factor stimulus acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:24391219 RGD PMID:24391219 Mir21 Rat cellular response to hydrogen peroxide IEP 41404719 RGD Mir21 Rat cellular response to interleukin-6 acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:24391219 RGD PMID:24391219 Mir21 Rat cellular response to ionizing radiation involved_in ISO RGD:1349265 1624291 PMID:22836756 RGD PMID:22836756 Mir21 Rat cellular response to leukemia inhibitory factor acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:20439489 RGD PMID:20439489 Mir21 Rat cellular response to lipopolysaccharide IEP 41410885 RGD Mir21 Rat cellular response to lipopolysaccharide involved_in ISO RGD:1349265 1624291 PMID:19946272, PMID:29039542 RGD PMID:19946272|PMID:29039542 Mir21 Rat cellular response to mechanical stimulus IEP 41404703 RGD Mir21 Rat cellular response to reactive oxygen species IMP 152025267 RGD Mir21 Rat cellular response to transforming growth factor beta stimulus acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:24391219 RGD PMID:24391219 Mir21 Rat endothelial tube morphogenesis involved_in ISO RGD:1349265 1624291 PMID:21347332 RGD PMID:21347332 Mir21 Rat epithelial to mesenchymal transition involved in cardiac fibroblast development involved_in ISO RGD:1349265 1624291 PMID:23441172 RGD PMID:23441172 Mir21 Rat female pregnancy acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:18556655 RGD PMID:18556655 Mir21 Rat inflammatory response to antigenic stimulus acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:22517757 RGD PMID:22517757 Mir21 Rat miRNA-mediated gene silencing by inhibition of translation involved_in ISO RGD:1349265 1624291 PMID:17363372, PMID:18372920, PMID:18384814, PMID:19013014, PMID:20826792, PMID:21078976, PMID:21328460, PMID:21562928, PMID:21636785, PMID:21817107, PMID:22034194, PMID:23578931, PMID:25327529, more ... RGD PMID:17363372|PMID:18372920|PMID:18384814|PMID:19013014|PMID:20826792|PMID:21078976|PMID:21328460|PMID:21562928|PMID:21636785|PMID:21817107|PMID:22034194|PMID:23578931|PMID:25327529|PMID:27895788|PMID:28270521 Mir21 Rat miRNA-mediated post-transcriptional gene silencing involved_in ISO RGD:1349265 1624291 PMID:16762633, PMID:17968323, PMID:18270520, PMID:18548003, PMID:18556655, PMID:18591254, PMID:18829576, PMID:19013014, PMID:19136465, PMID:19253296, PMID:19302977, PMID:19546886, PMID:19559015, more ... RGD PMID:16762633|PMID:17968323|PMID:18270520|PMID:18548003|PMID:18556655|PMID:18591254|PMID:18829576|PMID:19013014|PMID:19136465|PMID:19253296|PMID:19302977|PMID:19546886|PMID:19559015|PMID:19578724|PMID:19816956|PMID:19826040|PMID:20371612|PMID:20460403|PMID:20483747|PMID:20533548|PMID:20693317|PMID:21131358|PMID:21170291|PMID:21219636|PMID:21317927|PMID:21347332|PMID:21820586|PMID:22001440|PMID:22158624|PMID:22286305|PMID:22316494|PMID:22387553|PMID:22573493|PMID:22618231|PMID:22836756|PMID:22879939|PMID:23239100|PMID:23441172|PMID:23442323|PMID:23496142|PMID:23633945|PMID:23657402|PMID:24012640|PMID:24098708|PMID:24112539|PMID:24155920|PMID:24237305|PMID:24327270|PMID:24577233|PMID:24699315|PMID:24887517|PMID:24895913|PMID:25107449|PMID:25118289|PMID:25327529|PMID:26208095|PMID:27571873|PMID:27708252|PMID:28522568|PMID:28798470|PMID:29039542|PMID:29696468|PMID:30106099|PMID:31611175 Mir21 Rat miRNA-mediated post-transcriptional gene silencing involved_in ISO RGD:1608349 1624291 PMID:29925839 RGD PMID:29925839 Mir21 Rat miRNA-mediated post-transcriptional gene silencing acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:19147652 RGD PMID:19147652 Mir21 Rat negative regulation of angiogenesis IMP 41404718 RGD Mir21 Rat negative regulation of aortic smooth muscle cell differentiation involved_in ISO RGD:1349265 1624291 PMID:22034194 RGD PMID:22034194 Mir21 Rat negative regulation of apoptotic process IMP 152025267 RGD Mir21 Rat negative regulation of apoptotic process involved_in ISO RGD:1349265 1624291 PMID:16762633, PMID:20371612, PMID:21376256 RGD PMID:16762633|PMID:20371612|PMID:21376256 Mir21 Rat negative regulation of canonical NF-kappaB signal transduction acts_upstream_of ISO RGD:1349265 1624291 UniProtKB:P01584 PMID:25327529 RGD PMID:25327529 Mir21 Rat negative regulation of cardiac muscle cell apoptotic process IMP 41404719 RGD Mir21 Rat negative regulation of cartilage development involved_in ISO RGD:1349265 1624291 PMID:24577233 RGD PMID:24577233 Mir21 Rat negative regulation of cell migration involved_in ISO RGD:1349265 1624291 PMID:20489163 RGD PMID:20489163 Mir21 Rat negative regulation of cell population proliferation involved_in ISO RGD:1349265 1624291 PMID:24098708 RGD PMID:24098708 Mir21 Rat negative regulation of chondrocyte proliferation involved_in ISO RGD:1349265 1624291 PMID:24577233 RGD PMID:24577233 Mir21 Rat negative regulation of cytokine-mediated signaling pathway involved_in ISO RGD:1349265 1624291 PMID:30106099 RGD PMID:30106099 Mir21 Rat negative regulation of endothelial cell migration involved_in ISO RGD:1349265 1624291 PMID:21347332 RGD PMID:21347332 Mir21 Rat negative regulation of endothelial cell proliferation involved_in ISO RGD:1349265 1624291 PMID:21347332, PMID:23496142 RGD PMID:21347332|PMID:23496142 Mir21 Rat negative regulation of ERK1 and ERK2 cascade involved_in ISO RGD:1349265 1624291 PMID:20483747 RGD PMID:20483747 Mir21 Rat negative regulation of fibroblast apoptotic process IDA 41404715 RGD Mir21 Rat negative regulation of gene expression acts_upstream_of ISO RGD:1349265 1624291 UniProtKB:P01584 PMID:21562928, PMID:25327529 RGD PMID:21562928|PMID:25327529 Mir21 Rat negative regulation of gene expression acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:19147652 RGD PMID:19147652 Mir21 Rat negative regulation of gene expression involved_in ISO RGD:1349265 1624291 PMID:17072344, PMID:20489163, PMID:23684551 RGD PMID:17072344|PMID:20489163|PMID:23684551 Mir21 Rat negative regulation of hepatocyte apoptotic process IMP 41410824 RNA:increased expression:liver RGD Mir21 Rat negative regulation of hydrogen peroxide-mediated programmed cell death IMP 41404719 RGD Mir21 Rat negative regulation of hydrogen sulfide biosynthetic process involved_in ISO RGD:1349265 1624291 PMID:22034194 RGD PMID:22034194 Mir21 Rat negative regulation of innate immune response involved_in ISO RGD:1349265 1624291 PMID:22286305 RGD PMID:22286305 Mir21 Rat negative regulation of interleukin-1-mediated signaling pathway acts_upstream_of_or_within ISO RGD:1349265 1624291 UniProtKB:P01584 PMID:25327529 RGD PMID:25327529 Mir21 Rat negative regulation of interleukin-12 production acts_upstream_of ISO RGD:1349265 1624291 PMID:30106099 RGD PMID:30106099 Mir21 Rat negative regulation of interleukin-12 production involved_in ISO RGD:1349265 1624291 PMID:27571873, PMID:30106099 RGD PMID:27571873|PMID:30106099 Mir21 Rat negative regulation of interleukin-21 production involved_in ISO RGD:1349265 1624291 PMID:28798470 RGD PMID:28798470 Mir21 Rat negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator involved_in ISO RGD:1349265 1624291 PMID:18829576 RGD PMID:18829576 Mir21 Rat negative regulation of mitotic cell cycle acts_upstream_of ISO RGD:1349265 1624291 PMID:19826040 RGD PMID:19826040 Mir21 Rat negative regulation of myofibroblast cell apoptotic process IMP 41404712 RGD Mir21 Rat negative regulation of neuron apoptotic process IDA 151893491 RGD Mir21 Rat negative regulation of neuron apoptotic process IMP 41410884 RGD Mir21 Rat negative regulation of neuron apoptotic process IMP 41410823 RGD Mir21 Rat negative regulation of non-canonical NF-kappaB signal transduction involved_in ISO RGD:1349265 1624291 PMID:19946272 RGD PMID:19946272 Mir21 Rat negative regulation of Rac protein signal transduction involved_in ISO RGD:1349265 1624291 PMID:22158624 RGD PMID:22158624 Mir21 Rat negative regulation of regulatory T cell differentiation involved_in ISO RGD:1349265 1624291 RNAcentral:URS0000338542_9606 PMID:22387553 RGD PMID:22387553 Mir21 Rat negative regulation of Rho protein signal transduction involved_in ISO RGD:1349265 1624291 PMID:21347332 RGD PMID:21347332 Mir21 Rat negative regulation of stress fiber assembly involved_in ISO RGD:1349265 1624291 PMID:21347332 RGD PMID:21347332 Mir21 Rat negative regulation of transcription by RNA polymerase II IDA 152025267 Akap8, Bard1 RGD Mir21 Rat negative regulation of type I interferon production involved_in ISO RGD:1349265 1624291 PMID:23633945 RGD PMID:23633945 Mir21 Rat negative regulation of type I interferon-mediated signaling pathway involved_in ISO RGD:1349265 1624291 PMID:23633945 RGD PMID:23633945 Mir21 Rat negative regulation of vascular associated smooth muscle cell apoptotic process involved_in ISO RGD:1349265 1624291 PMID:28522568 RGD PMID:28522568 Mir21 Rat negative regulation of vascular associated smooth muscle cell migration involved_in ISO RGD:1349265 1624291 PMID:22158624 RGD PMID:22158624 Mir21 Rat phenotypic switching involved_in ISO RGD:1349265 1624291 PMID:23441172 RGD PMID:23441172 Mir21 Rat positive regulation of activated T cell proliferation involved_in ISO RGD:1349265 1624291 RNAcentral:URS00005165DA_9606 PMID:22387553 RGD PMID:22387553 Mir21 Rat positive regulation of angiogenesis involved_in ISO RGD:1349265 1624291 PMID:24356956, PMID:27708252 RGD PMID:24356956|PMID:27708252 Mir21 Rat positive regulation of apoptotic process involved_in ISO RGD:1349265 1624291 PMID:24098708 RGD PMID:24098708 Mir21 Rat positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis acts_upstream_of ISO RGD:1349265 1624291 PMID:30106099 RGD PMID:30106099 Mir21 Rat positive regulation of cell growth acts_upstream_of_or_within ISO RGD:1608349 1624291 MGI:2676840 PMID:24391219 RGD PMID:24391219 Mir21 Rat positive regulation of cell migration involved_in ISO RGD:1349265 1624291 PMID:18591254, PMID:20460403, PMID:21219636, PMID:23442323 RGD PMID:18591254|PMID:20460403|PMID:21219636|PMID:23442323 Mir21 Rat positive regulation of cell population proliferation involved_in ISO RGD:1349265 1624291 PMID:16762633, PMID:18384814, PMID:21219636, PMID:21376256 RGD PMID:16762633|PMID:18384814|PMID:21219636|PMID:21376256 Mir21 Rat positive regulation of collagen biosynthetic process IDA 41404715 RGD Mir21 Rat positive regulation of cytokine production acts_upstream_of ISO RGD:1349265 1624291 PMID:30106099 RGD PMID:30106099 Mir21 Rat positive regulation of endothelial cell apoptotic process IMP 41410819 RGD Mir21 Rat positive regulation of endothelial cell differentiation involved_in ISO RGD:1349265 1624291 PMID:24356956 RGD PMID:24356956 Mir21 Rat positive regulation of endothelial cell migration involved_in ISO RGD:1349265 1624291 PMID:23578931 RGD PMID:23578931 Mir21 Rat positive regulation of endothelial tube morphogenesis IMP 41410819 RGD Mir21 Rat positive regulation of epithelial to mesenchymal transition involved_in ISO RGD:1349265 1624291 PMID:24887517 RGD PMID:24887517 Mir21 Rat positive regulation of ERK1 and ERK2 cascade involved_in ISO RGD:1349265 1624291 PMID:23239100 RGD PMID:23239100 Mir21 Rat positive regulation of fat cell differentiation involved_in ISO RGD:1349265 1624291 PMID:19816956, PMID:23239100 RGD PMID:19816956|PMID:23239100 Mir21 Rat positive regulation of gene expression involved_in ISO RGD:1349265 1624291 PMID:21376256, PMID:27708252 RGD PMID:21376256|PMID:27708252 Mir21 Rat positive regulation of inflammatory response involved_in ISO RGD:1349265 1624291 PMID:21636785 RGD PMID:21636785 Mir21 Rat positive regulation of keratinocyte proliferation involved_in ISO RGD:1349265 1624291 PMID:21328460 RGD PMID:21328460 Mir21 Rat positive regulation of leukocyte adhesion to vascular endothelial cell involved_in ISO RGD:1349265 1624291 PMID:21636785 RGD PMID:21636785 Mir21 Rat positive regulation of myofibroblast differentiation IMP 41404703 RGD Mir21 Rat positive regulation of myofibroblast differentiation involved_in ISO RGD:1349265 1624291 PMID:20533548 RGD PMID:20533548 Mir21 Rat positive regulation of NLRP3 inflammasome complex assembly IDA 41404715 RGD Mir21 Rat positive regulation of osteoblast differentiation involved_in ISO RGD:1349265 1624291 PMID:23239100 RGD PMID:23239100 Mir21 Rat positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction acts_upstream_of ISO RGD:1349265 1624291 PMID:16762633, PMID:22879939 RGD PMID:16762633|PMID:22879939 Mir21 Rat positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction IMP 41410819 RGD Mir21 Rat positive regulation of potassium ion export across plasma membrane involved_in ISO RGD:1349265 1624291 PMID:21170291 RGD PMID:21170291 Mir21 Rat positive regulation of replicative senescence involved_in ISO RGD:1349265 1624291 PMID:23496142 RGD PMID:23496142 Mir21 Rat positive regulation of transforming growth factor beta receptor signaling pathway acts_upstream_of ISO RGD:1349265 1624291 PMID:31611175 RGD PMID:31611175 Mir21 Rat positive regulation of type II interferon production acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:22517757 RGD PMID:22517757 Mir21 Rat positive regulation of vascular associated smooth muscle cell differentiation involved_in ISO RGD:1349265 1624291 PMID:18548003 RGD PMID:18548003 Mir21 Rat positive regulation of vascular associated smooth muscle cell migration involved_in ISO RGD:1349265 1624291 PMID:20693317, PMID:21817107 RGD PMID:20693317|PMID:21817107 Mir21 Rat positive regulation of vascular associated smooth muscle cell proliferation involved_in ISO RGD:1349265 1624291 PMID:20693317, PMID:21817107, PMID:22034194, PMID:26208095, PMID:28522568 RGD PMID:20693317|PMID:21817107|PMID:22034194|PMID:26208095|PMID:28522568 Mir21 Rat positive regulation of vascular associated smooth muscle contraction involved_in ISO RGD:1349265 1624291 PMID:22158624 RGD PMID:22158624 Mir21 Rat positive regulation of vascular endothelial cell proliferation involved_in ISO RGD:1349265 1624291 PMID:27708252 RGD PMID:27708252 Mir21 Rat positive regulation of vascular endothelial growth factor signaling pathway acts_upstream_of ISO RGD:1349265 1624291 PMID:30106099 RGD PMID:30106099 Mir21 Rat positive regulation of wound healing IMP 41404703 RGD Mir21 Rat regulation of calcium ion transmembrane transport via high voltage-gated calcium channel involved_in ISO RGD:1349265 1624291 PMID:25107449 RGD PMID:25107449 Mir21 Rat regulation of cell migration involved_in ISO RGD:1349265 1624291 UniProtKB:P62745 PMID:20460403 RGD PMID:20460403 Mir21 Rat regulation of cell shape involved_in ISO RGD:1349265 1624291 PMID:21817107 RGD PMID:21817107 Mir21 Rat regulation of epidermal growth factor receptor signaling pathway involved_in ISO RGD:1349265 1624291 PMID:24012640 RGD PMID:24012640 Mir21 Rat regulation of extracellular matrix organization acts_upstream_of ISO RGD:1349265 1624291 PMID:18591254 RGD PMID:18591254 Mir21 Rat regulation of gene expression acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:18556655 RGD PMID:18556655 Mir21 Rat regulation of mesenchymal stem cell differentiation IMP 41404703 RGD Mir21 Rat regulation of reactive oxygen species metabolic process involved_in ISO RGD:1349265 1624291 PMID:22836756 RGD PMID:22836756 Mir21 Rat response to bacterium acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:24205035 RGD PMID:24205035 Mir21 Rat response to hypoxia IEP 41404713 RGD Mir21 Rat response to muscle activity acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:20086200 RGD PMID:20086200 Mir21 Rat response to oxygen levels acts_upstream_of_or_within ISO RGD:1608349 1624291 PMID:18723672 RGD PMID:18723672
Molecular Function
Only show annotations with direct experimental evidence (0 objects hidden)
Mir21 Rat mRNA 3'-UTR binding enables ISO RGD:1349265 1624291 PMID:19578724, PMID:21376256, PMID:21562928, PMID:31611175 RGD PMID:19578724|PMID:21376256|PMID:21562928|PMID:31611175 Mir21 Rat mRNA 3'-UTR binding enables ISO RGD:1608349 1624291 PMID:25504627 RGD PMID:25504627 Mir21 Rat mRNA base-pairing post-transcriptional repressor activity enables ISO RGD:1349265 1624291 PMID:16762633, PMID:17363372, PMID:17968323, PMID:18270520, PMID:18372920, PMID:18384814, PMID:18591254, PMID:18829576, PMID:19013014, PMID:19253296, PMID:19302977, PMID:19546886, PMID:19559015, more ... RGD PMID:16762633|PMID:17363372|PMID:17968323|PMID:18270520|PMID:18372920|PMID:18384814|PMID:18591254|PMID:18829576|PMID:19013014|PMID:19253296|PMID:19302977|PMID:19546886|PMID:19559015|PMID:19578724|PMID:19816956|PMID:19826040|PMID:20371612|PMID:20460403|PMID:20483747|PMID:20533548|PMID:20693317|PMID:20826792|PMID:21078976|PMID:21131358|PMID:21170291|PMID:21219636|PMID:21317927|PMID:21328460|PMID:21347332|PMID:21562928|PMID:21636785|PMID:21817107|PMID:21820586|PMID:22001440|PMID:22034194|PMID:22158624|PMID:22286305|PMID:22316494|PMID:22387553|PMID:22573493|PMID:22618231|PMID:22836756|PMID:22879939|PMID:23239100|PMID:23442323|PMID:23496142|PMID:23633945|PMID:23657402|PMID:24012640|PMID:24098708|PMID:24112539|PMID:24155920|PMID:24237305|PMID:24327270|PMID:24577233|PMID:24699315|PMID:24895913|PMID:25107449|PMID:25118289|PMID:25327529|PMID:27571873|PMID:27708252|PMID:27895788|PMID:28798470|PMID:29039542|PMID:29696468|PMID:30106099|PMID:31611175
(-)-Arctigenin (ISO) (R)-lipoic acid (EXP) 1,2-dichloroethane (ISO) 17beta-estradiol (EXP,ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,3-bis(4-hydroxyphenyl)propionitrile (ISO) 2,5-hexanedione (EXP) 2-acetamidofluorene (EXP) 2-hydroxypropanoic acid (ISO) 3,7-dihydropurine-6-thione (EXP) 3-chloropropane-1,2-diol (EXP) 4-(N-nitrosomethylamino)-1-(3-pyridyl)butan-1-one (ISO) 6-propyl-2-thiouracil (EXP) acetic acid (EXP) actinomycin D (ISO) afimoxifene (ISO) aflatoxin B1 (EXP) alcohol (ISO) all-trans-retinoic acid (ISO) Allylamine (EXP) aluminium atom (ISO) aluminium(0) (ISO) anthra[1,9-cd]pyrazol-6(2H)-one (ISO) antigen (ISO) antirheumatic drug (ISO) aristolochic acid A (EXP) arsane (ISO) arsenic atom (ISO) arsenic trichloride (ISO) arsenite(3-) (ISO) arsenous acid (EXP,ISO) baicalein (ISO) Bandrowski's base (ISO) benomyl (EXP) benzene-1,2,4-triol (ISO) berberine (ISO) bicalutamide (ISO) biphenyl-4-amine (ISO) bis(2-chloroethyl) sulfide (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (ISO) bleomycin A2 (EXP) boric acid (ISO) bortezomib (ISO) cadmium atom (ISO) cadmium dichloride (ISO) cannabidiol (ISO) carbamazepine (ISO) carbon atom (ISO) carbon monoxide (ISO) chromium(6+) (ISO) cisplatin (EXP,ISO) cobalt atom (ISO) copper atom (EXP) copper(0) (EXP) coumestrol (ISO) curcumin (ISO) cycloheximide (ISO) cyclosporin A (EXP) cypermethrin (EXP) dapagliflozin (EXP) daunorubicin (ISO) DDT (EXP,ISO) dehydroepiandrosterone (ISO) diallyl trisulfide (ISO) diarsenic trioxide (EXP,ISO) dioxygen (EXP,ISO) diuron (ISO) dorsomorphin (ISO) doxorubicin (ISO) elemental carbon (ISO) Enterolactone (ISO) fenhexamid (ISO) ferulic acid (EXP) fludioxonil (ISO) formaldehyde (ISO) fulvestrant (ISO) fumonisin B1 (ISO) gallic acid (EXP) geldanamycin (ISO) gentamycin (EXP) glycidol (EXP) graphene oxide (ISO) halothane (ISO) hydrogen peroxide (ISO) icariin (ISO) isoprenaline (EXP) lamotrigine (ISO) lipoic acid (EXP) lithium atom (EXP) lithium carbonate (EXP) lithium hydride (EXP) LY294002 (ISO) mechlorethamine (EXP) medroxyprogesterone acetate (ISO) melatonin (EXP) mercaptopurine (EXP) methanol (ISO) methapyrilene (EXP) methyl beta-cyclodextrin (ISO) methylmercury chloride (ISO) morphine (ISO) myo-inositol hexakisphosphate (EXP) N-acetyl-L-cysteine (EXP,ISO) N-methyl-N'-nitro-N-nitrosoguanidine (ISO) nickel atom (ISO) nickel dichloride (ISO) nickel sulfate (ISO) nitrofen (EXP) notoginsenoside R1 (ISO) ochratoxin A (ISO) ozone (ISO) paracetamol (EXP,ISO) paraquat (EXP,ISO) perfluorooctane-1-sulfonic acid (EXP) phenylephrine (EXP) phenylmercury acetate (ISO) PhIP (ISO) piperacillin (ISO) potassium bromate (ISO) progesterone (ISO) purine-6-thiol (EXP) quercetin (EXP,ISO) quercetin 3-O-beta-D-galactopyranoside (ISO) rac-lactic acid (ISO) resveratrol (EXP,ISO) rifampicin (ISO) SB 431542 (ISO) sodium arsenate (ISO) sodium arsenite (ISO) sodium fluoride (ISO) solasodine (ISO) sporidesmin A (ISO) stattic (ISO) streptozocin (EXP) sulfamethoxazole (ISO) sulfur dioxide (ISO) tacrolimus hydrate (ISO) Tanshinone I (ISO) tetrachloromethane (EXP) thalidomide (EXP) thioacetamide (EXP) titanium dioxide (ISO) trichostatin A (ISO) Tungsten carbide (ISO) tyrphostin AG 1478 (ISO) ursodeoxycholic acid (EXP,ISO) valproic acid (ISO) wortmannin (ISO) zinc atom (EXP) zinc(0) (EXP)
1.
Two-stage genome-wide methylation profiling in childhood-onset Crohn's Disease implicates epigenetic alterations at the VMP1/MIR21 and HLA loci.
Adams AT, etal., Inflamm Bowel Dis. 2014 Oct;20(10):1784-93. doi: 10.1097/MIB.0000000000000179.
2.
Anti-inflammatory effects of miR-21 in the macrophage response to peritonitis.
Barnett RE, etal., J Leukoc Biol. 2016 Feb;99(2):361-71. doi: 10.1189/jlb.4A1014-489R. Epub 2015 Sep 17.
3.
MicroRNA-21 protects neurons from ischemic death.
Buller B, etal., FEBS J. 2010 Oct;277(20):4299-307. doi: 10.1111/j.1742-4658.2010.07818.x. Epub 2010 Sep 14.
4.
Up-Regulation of miR-21 Is Associated with Cervicitis and Human Papillomavirus Infection in Cervical Tissues.
Bumrungthai S, etal., PLoS One. 2015 May 26;10(5):e0127109. doi: 10.1371/journal.pone.0127109. eCollection 2015.
5.
Dual Role of MiR-21-Mediated Signaling in HUVECs and Rat Surgical Flap under Normoxia and Hypoxia Condition.
Chang CH, etal., Int J Mol Sci. 2017 Sep 7;18(9). pii: ijms18091917. doi: 10.3390/ijms18091917.
6.
MiR-320a contributes to atherogenesis by augmenting multiple risk factors and down-regulating SRF.
Chen C, etal., J Cell Mol Med. 2015 May;19(5):970-85. doi: 10.1111/jcmm.12483. Epub 2015 Feb 27.
7.
Overexpression of IL-9 induced by STAT3 phosphorylation is mediated by miR-155 and miR-21 in chronic lymphocytic leukemia.
Chen N, etal., Oncol Rep. 2018 Jun;39(6):3064-3072. doi: 10.3892/or.2018.6367. Epub 2018 Apr 12.
8.
MicroRNA-21 protects against the H(2)O(2)-induced injury on cardiac myocytes via its target gene PDCD4.
Cheng Y, etal., J Mol Cell Cardiol. 2009 Jul;47(1):5-14. doi: 10.1016/j.yjmcc.2009.01.008. Epub 2009 Jan 27.
9.
MicroRNA-21 regulates peroxisome proliferator-activated receptor alpha, a molecular mechanism of cardiac pathology in Cardiorenal Syndrome Type 4.
Chuppa S, etal., Kidney Int. 2018 Feb;93(2):375-389. doi: 10.1016/j.kint.2017.05.014. Epub 2017 Jul 29.
10.
Activation of the oncogenic miR-21-5p promotes HCV replication and steatosis induced by the viral core 3a protein.
Clément S, etal., Liver Int. 2019 Jul;39(7):1226-1236. doi: 10.1111/liv.14112. Epub 2019 Apr 16.
11.
Circulating Plasma Levels of MicroRNA-21 and MicroRNA-221 Are Potential Diagnostic Markers for Primary Intrahepatic Cholangiocarcinoma.
Correa-Gallego C, etal., PLoS One. 2016 Sep 29;11(9):e0163699. doi: 10.1371/journal.pone.0163699. eCollection 2016.
12.
Upregulation of miR-21 by Ras in vivo and its role in tumor growth.
Frezzetti D, etal., Oncogene. 2011 Jan 20;30(3):275-86. doi: 10.1038/onc.2010.416. Epub 2010 Oct 18.
13.
miR-21 Expression Determines the Early Vaccine Immunity Induced by LdCen-/- Immunization.
Gannavaram S, etal., Front Immunol. 2019 Sep 24;10:2273. doi: 10.3389/fimmu.2019.02273. eCollection 2019.
14.
MicroRNA-21 contributes to high glucose-induced fibrosis in peritoneal mesothelial cells in rat models by activation of the Ras-MAPK signaling pathway via Sprouty-1.
Gao Q, etal., J Cell Physiol. 2019 May;234(5):5915-5925. doi: 10.1002/jcp.26941. Epub 2018 Dec 4.
15.
CCL20 Displays Antimicrobial Activity Against Cryptosporidium parvum, but Its Expression Is Reduced During Infection in the Intestine of Neonatal Mice.
Guesdon W, etal., J Infect Dis. 2015 Oct 15;212(8):1332-40. doi: 10.1093/infdis/jiv206. Epub 2015 Apr 2.
16.
MiR-21 confers resistance against CVB3-induced myocarditis by inhibiting PDCD4-mediated apoptosis.
He J, etal., Clin Invest Med. 2013 Apr 1;36(2):E103-11. doi: 10.25011/cim.v36i2.19573.
17.
Methyl helicterte ameliorates liver fibrosis by regulating miR-21-mediated ERK and TGF-β1/Smads pathways.
Huang Q, etal., Int Immunopharmacol. 2019 Jan;66:41-51. doi: 10.1016/j.intimp.2018.11.006. Epub 2018 Nov 9.
18.
Circulating MicroRNAs in Extracellular Vesicles as Potential Biomarkers of Alcohol-Induced Neuroinflammation in Adolescence: Gender Differences.
Ibáñez F, etal., Int J Mol Sci. 2020 Sep 14;21(18):6730. doi: 10.3390/ijms21186730.
19.
Prognostic Significance of MicroRNA-21 Expression in Patients with Unresectable Metastatic Colon Cancer.
Iseki Y, etal., Anticancer Res. 2016 Oct;36(10):5145-5151. doi: 10.21873/anticanres.11084.
20.
MicroRNA-21 Is Required for Local and Remote Ischemic Preconditioning in Multiple Organ Protection Against Sepsis.
Jia P, etal., Crit Care Med. 2017 Jul;45(7):e703-e710. doi: 10.1097/CCM.0000000000002363.
21.
Serum miR-21 and miR-26a Levels Negatively Correlate with Severity of Cirrhosis in Patients with Chronic Hepatitis B.
Jiang S, etal., Microrna. 2019;8(1):86-92. doi: 10.2174/2211536607666180821162850.
22.
Expression and clinicopathological significance of microRNA-21 and programmed cell death 4 in malignant melanoma.
Jiao J, etal., J Int Med Res. 2015 Oct;43(5):672-8. doi: 10.1177/0300060515583707. Epub 2015 Jul 6.
23.
MicroRNA-21 Limits Uptake of Listeria monocytogenes by Macrophages to Reduce the Intracellular Niche and Control Infection.
Johnston DGW, etal., Front Cell Infect Microbiol. 2017 May 23;7:201. doi: 10.3389/fcimb.2017.00201. eCollection 2017.
24.
Correlation of the Levels of microRNA with Cell Composition of Axillary Lymph Node in Wistar Rats with Breast Cancer.
Kabakov AV, etal., Bull Exp Biol Med. 2020 Feb;168(4):500-502. doi: 10.1007/s10517-020-04740-w. Epub 2020 Mar 10.
25.
Systemic delivery of microRNA-21 antisense oligonucleotides to the brain using T7-peptide decorated exosomes.
Kim G, etal., J Control Release. 2020 Jan 10;317:273-281. doi: 10.1016/j.jconrel.2019.11.009. Epub 2019 Nov 12.
26.
Therapeutic efficacy of modified anti-miR21 in metastatic prostate cancer.
Kim K, etal., Biochem Biophys Res Commun. 2020 Aug 27;529(3):707-713. doi: 10.1016/j.bbrc.2020.05.215. Epub 2020 Jul 18.
27.
MicroRNA-21 drives severe, steroid-insensitive experimental asthma by amplifying phosphoinositide 3-kinase-mediated suppression of histone deacetylase 2.
Kim RY, etal., J Allergy Clin Immunol. 2017 Feb;139(2):519-532. doi: 10.1016/j.jaci.2016.04.038. Epub 2016 Jun 10.
28.
Associations Between miRNAs and Two Different Cancers: Breast and Colon.
Kundaktepe BP, etal., Cancer Manag Res. 2020 Feb 7;12:871-879. doi: 10.2147/CMAR.S227628. eCollection 2020.
29.
MicroRNA-21 in cancer-associated fibroblasts supports lung adenocarcinoma progression.
Kunita A, etal., Sci Rep. 2018 Jun 11;8(1):8838. doi: 10.1038/s41598-018-27128-3.
30.
MicroRNA-21 preserves the fibrotic mechanical memory of mesenchymal stem cells.
Li CX, etal., Nat Mater. 2017 Mar;16(3):379-389. doi: 10.1038/nmat4780. Epub 2016 Oct 31.
31.
Circulating MicroRNA-21, MicroRNA-23a, and MicroRNA-125b as Biomarkers for Diagnosis and Prognosis of Burkitt Lymphoma in Children.
Li J, etal., Med Sci Monit. 2016 Dec 19;22:4992-5002. doi: 10.12659/msm.897417.
32.
MicroRNA-21-Mediated Inhibition of Mast Cell Degranulation Involved in the Protective Effect of Berberine on 2,4-Dinitrofluorobenzene-Induced Allergic Contact Dermatitis in Rats via p38 Pathway.
Li W, etal., Inflammation. 2018 Mar;41(2):689-699. doi: 10.1007/s10753-017-0723-1.
33.
LncRNA RUNX1-IT1 is Downregulated in Endometrial Cancer and Binds to miR-21 Precursor to Suppress Its Maturation.
Liang M, etal., Cancer Manag Res. 2020 Dec 30;12:13451-13459. doi: 10.2147/CMAR.S272165. eCollection 2020.
34.
Serum Exosomal MicroRNA-21, MicroRNA-126, and PTEN Are Novel Biomarkers for Diagnosis of Acute Coronary Syndrome.
Ling H, etal., Front Physiol. 2020 Jun 11;11:654. doi: 10.3389/fphys.2020.00654. eCollection 2020.
35.
MicroRNA-21 acts as an oncomir through multiple targets in human hepatocellular carcinoma.
Liu C, etal., J Hepatol. 2010 Jul;53(1):98-107. doi: 10.1016/j.jhep.2010.02.021. Epub 2010 Apr 4.
36.
Correlation between miR-21 and miR-145 and the incidence and prognosis of colorectal cancer.
Liu Q, etal., J BUON. 2018 Jan-Feb;23(1):29-35.
37.
Diagnostic and prognostic values of serum exosomal microRNA-21 in children with hepatoblastoma: a Chinese population-based study.
Liu W, etal., Pediatr Surg Int. 2016 Nov;32(11):1059-1065. doi: 10.1007/s00383-016-3960-8. Epub 2016 Sep 6.
38.
MicroRNA-21 and -146b are involved in the pathogenesis of murine viral myocarditis by regulating TH-17 differentiation.
Liu YL, etal., Arch Virol. 2013 Sep;158(9):1953-63. doi: 10.1007/s00705-013-1695-6. Epub 2013 Apr 16.
39.
MicroRNA-21 (miR-21) expression promotes growth, metastasis, and chemo- or radioresistance in non-small cell lung cancer cells by targeting PTEN.
Liu ZL, etal., Mol Cell Biochem. 2013 Jan;372(1-2):35-45. doi: 10.1007/s11010-012-1443-3. Epub 2012 Sep 6.
40.
Liver microRNA-21 is overexpressed in non-alcoholic steatohepatitis and contributes to the disease in experimental models by inhibiting PPARα expression.
Loyer X, etal., Gut. 2016 Nov;65(11):1882-1894. doi: 10.1136/gutjnl-2014-308883. Epub 2015 Sep 3.
41.
Repression of microRNA-21 inhibits retinal vascular endothelial cell growth and angiogenesis via PTEN dependent-PI3K/Akt/VEGF signaling pathway in diabetic retinopathy.
Lu JM, etal., Exp Eye Res. 2020 Jan;190:107886. doi: 10.1016/j.exer.2019.107886. Epub 2019 Nov 21.
42.
MicroRNA-21-Regulated Activation of the Akt Pathway Participates in the Protective Effects of H2S against Liver Ischemia-Reperfusion Injury.
Lu M, etal., Biol Pharm Bull. 2018 Feb 1;41(2):229-238. doi: 10.1248/bpb.b17-00769. Epub 2017 Nov 30.
43.
Berberine regulates the microRNA-21-ITGΒ4-PDCD4 axis and inhibits colon cancer viability.
Lü Y, etal., Oncol Lett. 2018 Apr;15(4):5971-5976. doi: 10.3892/ol.2018.7997. Epub 2018 Feb 8.
44.
Loss of the miR-21 allele elevates the expression of its target genes and reduces tumorigenesis.
Ma X, etal., Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10144-9. doi: 10.1073/pnas.1103735108. Epub 2011 Jun 6.
45.
Correlation between microRNA expression levels and clinical parameters associated with chronic hepatitis C viral infection in humans.
Marquez RT, etal., Lab Invest. 2010 Dec;90(12):1727-36. doi: 10.1038/labinvest.2010.126. Epub 2010 Jul 12.
46.
MicroRNA MIR21 and T Cells in Colorectal Cancer.
Mima K, etal., Cancer Immunol Res. 2016 Jan;4(1):33-40. doi: 10.1158/2326-6066.CIR-15-0084. Epub 2015 Sep 29.
47.
MicroRNA MIR21 (miR-21) and PTGS2 Expression in Colorectal Cancer and Patient Survival.
Mima K, etal., Clin Cancer Res. 2016 Aug 1;22(15):3841-8. doi: 10.1158/1078-0432.CCR-15-2173. Epub 2016 Mar 8.
48.
NOS2 enhances KRAS-induced lung carcinogenesis, inflammation and microRNA-21 expression.
Okayama H, etal., Int J Cancer. 2013 Jan 1;132(1):9-18. doi: 10.1002/ijc.27644. Epub 2012 Jun 13.
49.
Dysregulated Serum MiRNA Profile and Promising Biomarkers in Dengue-infected Patients.
Ouyang X, etal., Int J Med Sci. 2016 Feb 18;13(3):195-205. doi: 10.7150/ijms.13996. eCollection 2016.
50.
Induction of specific microRNAs inhibits cutaneous wound healing.
Pastar I, etal., J Biol Chem. 2012 Aug 24;287(35):29324-35. doi: 10.1074/jbc.M112.382135. Epub 2012 Jul 6.
51.
MicroRNA-320 is involved in the regulation of cardiac ischemia/reperfusion injury by targeting heat-shock protein 20.
Ren XP, etal., Circulation. 2009 May 5;119(17):2357-2366. doi: 10.1161/CIRCULATIONAHA.108.814145. Epub 2009 Apr 20.
52.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
53.
Neurotrophin-3 mRNA a putative target of miR21 following status epilepticus.
Risbud RM, etal., Brain Res. 2011 Nov 18;1424:53-9. doi: 10.1016/j.brainres.2011.09.039. Epub 2011 Sep 24.
54.
Protein Deimination Signatures in Plasma and Plasma-EVs and Protein Deimination in the Brain Vasculature in a Rat Model of Pre-Motor Parkinson's Disease.
Sancandi M, etal., Int J Mol Sci. 2020 Apr 15;21(8). pii: ijms21082743. doi: 10.3390/ijms21082743.
55.
miR-21 enhances the protective effect of loperamide on rat cardiomyocytes against hypoxia/reoxygenation, reactive oxygen species production and apoptosis via regulating Akap8 and Bard1 expression.
Shen H, etal., Exp Ther Med. 2019 Feb;17(2):1312-1320. doi: 10.3892/etm.2018.7047. Epub 2018 Dec 5.
56.
MicroRNA-21 knockout improve the survival rate in DSS induced fatal colitis through protecting against inflammation and tissue injury.
Shi C, etal., PLoS One. 2013 Jun 24;8(6):e66814. doi: 10.1371/journal.pone.0066814. Print 2013.
57.
Adenovirus-mediated down-regulation of miR-21-5p alleviates experimental autoimmune uveoretinitis in mice.
Shi L, etal., Int Immunopharmacol. 2019 Sep;74:105698. doi: 10.1016/j.intimp.2019.105698. Epub 2019 Jun 19.
58.
[Effects of microRNA-21 inhibitor on apoptosis of type II alveolar epithelial cells in rats with hyperoxia-induced acute lung injury].
Shi L, etal., Zhonghua Wei Zhong Bing Ji Jiu Yi Xue. 2017 Mar;29(3):244-248. doi: 10.3760/cma.j.issn.2095-4352.2017.03.010.
59.
Urinary microRNA-192 and microRNA-21 as potential indicators for liver fluke-associated cholangiocarcinoma risk group.
Silakit R, etal., Parasitol Int. 2017 Aug;66(4):479-485. doi: 10.1016/j.parint.2015.10.001. Epub 2015 Oct 9.
60.
Integrating DNA methylation and microRNA biomarkers in sputum for lung cancer detection.
Su Y, etal., Clin Epigenetics. 2016 Oct 19;8:109. doi: 10.1186/s13148-016-0275-5. eCollection 2016.
61.
Comparison of Serum MicroRNA21 and Tumor Markers in Diagnosis of Early Non-Small Cell Lung Cancer.
Sun M, etal., Dis Markers. 2016;2016:3823121. doi: 10.1155/2016/3823121. Epub 2016 Jan 11.
62.
Mir-21 Mediates the Inhibitory Effect of Ang (1-7) on AngII-induced NLRP3 Inflammasome Activation by Targeting Spry1 in lung fibroblasts.
Sun NN, etal., Sci Rep. 2017 Oct 30;7(1):14369. doi: 10.1038/s41598-017-13305-3.
63.
MicroRNA-21 is associated with fibrosis in a rat model of nonalcoholic steatohepatitis and serves as a plasma biomarker for fibrotic liver disease.
Takeuchi-Yorimoto A, etal., Toxicol Lett. 2016 Sep 6;258:159-167. doi: 10.1016/j.toxlet.2016.06.012. Epub 2016 Jun 15.
64.
Targeting of microRNA-21-5p protects against seizure damage in a kainic acid-induced status epilepticus model via PTEN-mTOR.
Tang C, etal., Epilepsy Res. 2018 Aug;144:34-42. doi: 10.1016/j.eplepsyres.2018.05.001. Epub 2018 May 4.
65.
MicroRNA-21 promotes cell metastasis in cervical cancer through modulating epithelial-mesenchymal transition.
Tang Y, etal., Oncol Lett. 2020 Apr;19(4):3289-3295. doi: 10.3892/ol.2020.11438. Epub 2020 Mar 3.
66.
MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts.
Thum T, etal., Nature. 2008 Dec 18;456(7224):980-4. doi: 10.1038/nature07511. Epub 2008 Nov 30.
67.
Induction of microRNA-21 with exogenous hydrogen sulfide attenuates myocardial ischemic and inflammatory injury in mice.
Toldo S, etal., Circ Cardiovasc Genet. 2014 Jun;7(3):311-20. doi: 10.1161/CIRCGENETICS.113.000381. Epub 2014 May 13.
68.
Circulating microRNA-21 as a novel biomarker for hepatocellular carcinoma.
Tomimaru Y, etal., J Hepatol. 2012 Jan;56(1):167-75. doi: 10.1016/j.jhep.2011.04.026. Epub 2011 Jul 13.
69.
The expression and clinical significance of circulating microRNA-21 in serum of five solid tumors.
Wang B and Zhang Q, J Cancer Res Clin Oncol. 2012 Oct;138(10):1659-66. doi: 10.1007/s00432-012-1244-9. Epub 2012 May 26.
70.
Expression of serum exosomal microRNA-21 in human hepatocellular carcinoma.
Wang H, etal., Biomed Res Int. 2014;2014:864894. doi: 10.1155/2014/864894. Epub 2014 May 18.
71.
MicroRNA-223 and microRNA-21 in peripheral blood B cells associated with progression of primary biliary cholangitis patients.
Wang X, etal., PLoS One. 2017 Sep 8;12(9):e0184292. doi: 10.1371/journal.pone.0184292. eCollection 2017.
72.
Ski-related novel protein suppresses the development of diabetic nephropathy by modulating transforming growth factor-β signaling and microRNA-21 expression.
Wang Y, etal., J Cell Physiol. 2019 Aug;234(10):17925-17936. doi: 10.1002/jcp.28425. Epub 2019 Mar 7.
73.
The association between microRNA-21 and hypertension-induced cardiac remodeling.
Watanabe K, etal., PLoS One. 2020 Feb 10;15(2):e0226053. doi: 10.1371/journal.pone.0226053. eCollection 2020.
74.
Evaluation of miR-21 and miR-375 as prognostic biomarkers in esophageal cancer.
Winther M, etal., Acta Oncol. 2015;54(9):1582-91. doi: 10.3109/0284186X.2015.1064161.
75.
MicroRNA-21 promotes cell proliferation, migration, and resistance to apoptosis through PTEN/PI3K/AKT signaling pathway in esophageal cancer.
Wu YR, etal., Tumour Biol. 2016 Sep;37(9):12061-12070. doi: 10.1007/s13277-016-5074-2. Epub 2016 May 17.
76.
miR-21 promotes NLRP3 inflammasome activation to mediate pyroptosis and endotoxic shock.
Xue Z, etal., Cell Death Dis. 2019 Jun 12;10(6):461. doi: 10.1038/s41419-019-1713-z.
77.
MicroRNA-21 promotes glioblastoma tumorigenesis by down-regulating insulin-like growth factor-binding protein-3 (IGFBP3).
Yang CH, etal., J Biol Chem. 2014 Sep 5;289(36):25079-87. doi: 10.1074/jbc.M114.593863. Epub 2014 Jul 24.
78.
Effect of Corilagin on the miR-21/smad7/ERK signaling pathway in a schistosomiasis-induced hepatic fibrosis mouse model.
Yang F, etal., Parasitol Int. 2016 Aug;65(4):308-15. doi: 10.1016/j.parint.2016.03.001. Epub 2016 Mar 2.
79.
Downregulation of microRNA-21 expression restrains non-small cell lung cancer cell proliferation and migration through upregulation of programmed cell death 4.
Yang Y, etal., Cancer Gene Ther. 2015 Jan;22(1):23-9. doi: 10.1038/cgt.2014.66. Epub 2014 Dec 5.
80.
Fusobacterium nucleatum Increases Proliferation of Colorectal Cancer Cells and Tumor Development in Mice by Activating Toll-Like Receptor 4 Signaling to Nuclear Factor-κB, and Up-regulating Expression of MicroRNA-21.
Yang Y, etal., Gastroenterology. 2017 Mar;152(4):851-866.e24. doi: 10.1053/j.gastro.2016.11.018. Epub 2016 Nov 19.
81.
Osthole attenuates pulmonary arterial hypertension by the regulation of sphingosine 1-phosphate in rats.
Yao L, etal., Chin J Nat Med. 2020 Apr;18(4):308-320. doi: 10.1016/S1875-5364(20)30038-8.
82.
CircRNA circ_0026344 as a prognostic biomarker suppresses colorectal cancer progression via microRNA-21 and microRNA-31.
Yuan Y, etal., Biochem Biophys Res Commun. 2018 Sep 5;503(2):870-875. doi: 10.1016/j.bbrc.2018.06.089. Epub 2018 Jun 23.
83.
Circular RNA circ_0001287 inhibits the proliferation, metastasis, and radiosensitivity of non-small cell lung cancer cells by sponging microRNA miR-21 and up-regulating phosphatase and tensin homolog expression.
Zhang CC, etal., Bioengineered. 2021 Dec;12(1):414-425. doi: 10.1080/21655979.2021.1872191.
84.
MicroRNA-21 (miR-21) represses tumor suppressor PTEN and promotes growth and invasion in non-small cell lung cancer (NSCLC).
Zhang JG, etal., Clin Chim Acta. 2010 Jun 3;411(11-12):846-52. doi: 10.1016/j.cca.2010.02.074. Epub 2010 Mar 16.
85.
Beneficial effects of tolvaptan on atrial remodeling induced by chronic intermittent hypoxia in rats.
Zhang K, etal., Cardiovasc Ther. 2018 Dec;36(6):e12466. doi: 10.1111/1755-5922.12466. Epub 2018 Sep 29.
86.
MicroRNA-21 is upregulated during intestinal barrier dysfunction induced by ischemia reperfusion.
Zhang L, etal., Kaohsiung J Med Sci. 2018 Oct;34(10):556-563. doi: 10.1016/j.kjms.2018.05.006. Epub 2018 Jun 7.
87.
[Effect of overexpression of microRNA-21-5p on early apoptosis of type II alveolar epithelial cells in rats with hyperoxic acute lung injury].
Zhang W, etal., Zhonghua Wei Zhong Bing Ji Jiu Yi Xue. 2019 Aug;31(8):978-982. doi: 10.3760/cma.j.issn.2095-4352.2019.08.013.
88.
[Clinicopathological significance of microRNA-21 and miR-125 expression in colorectal cancer].
Zhang Y, etal., Zhonghua Wei Chang Wai Ke Za Zhi. 2009 Nov;12(6):623-6.
89.
MiR-21 and miR-222 inhibit apoptosis of adult dorsal root ganglion neurons by repressing TIMP3 following sciatic nerve injury.
Zhou S, etal., Neurosci Lett. 2015 Jan 23;586:43-9. doi: 10.1016/j.neulet.2014.12.006. Epub 2014 Dec 4.
90.
Mesenchymal stem cell derived EVs mediate neuroprotection after spinal cord injury in rats via the microRNA-21-5p/FasL gene axis.
Zhou X, etal., Biomed Pharmacother. 2019 Jul;115:108818. doi: 10.1016/j.biopha.2019.108818. Epub 2019 May 16.
91.
Inflammation-Related MicroRNAs Are Associated with Plaque Stability Calculated by IVUS in Coronary Heart Disease Patients.
Zhu GF, etal., J Interv Cardiol. 2019 Dec 1;2019:9723129. doi: 10.1155/2019/9723129. eCollection 2019.
92.
Role of HIF-1α in Cold Ischemia Injury of Rat Donor Heart Via the miR-21/PDCD4 Pathway.
Zhu L, etal., Transplant Proc. 2020 Jan - Feb;52(1):383-391. doi: 10.1016/j.transproceed.2019.11.001. Epub 2020 Jan 17.
93.
MicroRNA-21 targets tumor suppressor genes in invasion and metastasis.
Zhu S, etal., Cell Res. 2008 Mar;18(3):350-9. doi: 10.1038/cr.2008.24.
94.
MicroRNA-21 inhibits lipopolysaccharide-induced acute lung injury by targeting nuclear factor-κB.
Zhu WD, etal., Exp Ther Med. 2018 Dec;16(6):4616-4622. doi: 10.3892/etm.2018.6789. Epub 2018 Sep 24.
Mir21 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 71,902,600 - 71,902,691 (-) NCBI GRCr8 mRatBN7.2 10 71,405,257 - 71,405,348 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 71,405,257 - 71,405,348 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 76,026,707 - 76,026,798 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 75,531,582 - 75,531,673 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 70,996,132 - 70,996,223 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 73,902,210 - 73,902,301 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 73,902,210 - 73,902,301 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 76,197,081 - 76,197,172 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 10 70,326,375 - 70,326,466 (-) NCBI Celera Cytogenetic Map 10 q26 NCBI
MIR21 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 59,841,266 - 59,841,337 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 59,841,266 - 59,841,337 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 57,918,627 - 57,918,698 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 55,273,408 - 55,273,479 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 17 54,382,140 - 54,382,211 (+) NCBI Celera Cytogenetic Map 17 q23.1 NCBI HuRef 17 53,291,116 - 53,291,187 (+) NCBI HuRef CHM1_1 17 57,982,648 - 57,982,719 (+) NCBI CHM1_1 T2T-CHM13v2.0 17 60,710,020 - 60,710,091 (+) NCBI T2T-CHM13v2.0
Mir21a Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 86,474,893 - 86,474,984 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 86,474,893 - 86,474,984 (-) Ensembl GRCm39 Ensembl GRCm38 11 86,584,067 - 86,584,158 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 86,584,067 - 86,584,158 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 86,397,569 - 86,397,660 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 11 96,199,974 - 96,200,065 (-) NCBI Celera Cytogenetic Map 11 C NCBI cM Map 11 51.82 NCBI
MIR21 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 34,340,550 - 34,340,609 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 34,340,533 - 34,340,624 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 33,572,293 - 33,572,352 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 35,150,885 - 35,150,944 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 35,150,868 - 35,150,959 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 33,934,637 - 33,934,696 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 34,220,122 - 34,220,181 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 34,306,261 - 34,306,320 (+) NCBI UU_Cfam_GSD_1.0
MIR21 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 36,065,267 - 36,065,358 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 36,065,267 - 36,065,358 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 37,340,385 - 37,340,476 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Confirmed Targets
Pdcd4 rno-miR-21-5p Mirtarbase external_info Luciferase reporter assay//Western blot Functional MTI 19158092 Pdcd4 rno-miR-21-5p Mirtarbase external_info Western blot//qRT-PCR//GFP reporter assay//Lucifer Functional MTI 19336275 Pdcd4 rno-miR-21-5p Mirtarbase external_info Western blot Functional MTI 19167416 Pdcd4 rno-miR-21-5p Mirtarbase external_info qRT-PCR//Western blot Functional MTI 21154462 Pdcd4 rno-miR-21-5p Mirtarbase external_info Immunocytochemistry//Immunofluorescence//Luciferas Functional MTI 22565856 Tpm1 rno-miR-21-5p Mirtarbase external_info Microarray Functional MTI (Weak) 18258830 Pten rno-miR-21-5p Mirtarbase external_info Microarray//qRT-PCR//Western blot Functional MTI 17478730 Faslg rno-miR-21-5p Mirtarbase external_info Immunofluorescence//In situ hybridization//Lucifer Functional MTI 20840605 Elavl4 rno-miR-21-5p Mirtarbase external_info qRT-PCR Functional MTI (Weak) 20584986
Predicted Targets
Count of predictions: 6874 Count of gene targets: 4588 Count of transcripts: 4943 Interacting mature miRNAs: rno-miR-21-3p, rno-miR-21-5p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
1549846 Scl47 Serum cholesterol level QTL 47 3.6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 10 50574707 95574707 Rat 1578779 Tcas10 Tongue tumor susceptibility QTL 10 3.12 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 10 31297439 76297439 Rat 631565 Hcuc4 Hepatic copper content QTL 4 4.15 liver copper amount (VT:0003065) liver copper weight to liver dry weight ratio (CMO:0001512) 10 66941813 73452992 Rat 1298069 Bp168 Blood pressure QTL 168 5.5 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 10 26521957 98003205 Rat 2293669 Bmd33 Bone mineral density QTL 33 4.5 0.0001 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 10 49444551 81709989 Rat 152025224 Bw193 Body weight QTL 193 6.47 body mass (VT:0001259) 10 51663405 75085664 Rat 631552 Vetf2 Vascular elastic tissue fragility QTL 2 4.5 0.0002 aorta elastic tissue integrity trait (VT:0010556) artery internal elastic lamina non-tumorous lesion count (CMO:0001913) 10 41142633 86142633 Rat 61449 Ciaa2 CIA Autoantibody QTL 2 7.1 blood autoantibody amount (VT:0003725) calculated serum anti-type 2 collagen antibody titer (CMO:0001279) 10 63221094 107211142 Rat 12903245 Cm110 Cardiac mass QTL 110 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 10 71115217 72606468 Rat 12903246 Cm111 Cardiac mass QTL 111 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 10 71115217 72606468 Rat 12903247 Cm112 Cardiac mass QTL 112 0.001 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 10 71115217 72606468 Rat 631557 Bp136 Blood pressure QTL 136 0.003 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 30632053 75632053 Rat 61325 Aia5 Adjuvant induced arthritis QTL 5 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 1298078 Stresp5 Stress response QTL 5 2.99 0.00025 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 10 42045676 104670812 Rat 2293679 Bmd30 Bone mineral density QTL 30 3.5 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 10 49444551 81709989 Rat 1549831 Bss6 Bone structure and strength QTL 6 4 lumbar vertebra strength trait (VT:0010574) vertebra ultimate force (CMO:0001678) 10 57576521 102576521 Rat 12902615 Bw185 Body weight QTL 185 0.01 body mass (VT:0001259) body weight (CMO:0000012) 10 71115217 72606468 Rat 12903248 Am14 Aortic mass QTL 14 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 10 71115217 72606468 Rat 70164 Bw21 Body weight QTL 21 4.36 0.00005 body mass (VT:0001259) body weight (CMO:0000012) 10 53797494 98952626 Rat 12903249 Kidm68 Kidney mass QTL 68 0.02 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 10 71115217 72606468 Rat 1579918 Bp279 Blood pressure QTL 279 0.01 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 71115217 72606468 Rat 61463 Bp12 Blood pressure QTL 12 6.3 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 41333258 86333258 Rat 8694173 Bw149 Body weight QTL 149 4.38 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 10 44441699 89441699 Rat 2300218 Hpcl2 Hepatic cholesterol level QTL 2 liver cholesterol amount (VT:0010498) liver cholesterol level (CMO:0001597) 10 45029650 95600334 Rat 1554317 Bmd4 Bone mineral density QTL 4 9.4 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 10 19816042 99406971 Rat 70171 Cari1 Carrageenan-induced inflammation QTL 1 4.9 0.0005 hypodermis integrity trait (VT:0010550) inflammatory exudate volume (CMO:0001429) 10 53797385 107211142 Rat 724527 Bp148 Blood pressure QTL 148 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 28453136 73453136 Rat 2300171 Bmd58 Bone mineral density QTL 58 4.9 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 10 26944628 71944628 Rat 61354 Pia10 Pristane induced arthritis QTL 10 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 2301967 Cm73 Cardiac mass QTL 73 4.55 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 10 14487011 89062041 Rat 2313103 Bss80 Bone structure and strength QTL 80 2 0.0001 tibia strength trait (VT:1000284) tibia midshaft endosteal cross-sectional area (CMO:0001716) 10 62057807 107057807 Rat 2293646 Bss25 Bone structure and strength QTL 25 10.96 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 10 69738412 107211142 Rat 2303118 Mamtr7 Mammary tumor resistance QTL 7 0.003 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 10 9658275 104670812 Rat 70188 BpQTLcluster1 Blood pressure QTL cluster 1 4.864 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 42323132 87323132 Rat 2300172 Bmd57 Bone mineral density QTL 57 9.8 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 10 69738412 107211142 Rat 2313105 Bss79 Bone structure and strength QTL 79 1.8 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 10 62057807 107057807 Rat 9589030 Epfw9 Epididymal fat weight QTL 9 19.24 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 10 44441699 89441699 Rat 1357344 Bp249 Blood pressure QTL 249 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 66743655 98003205 Rat 10402859 Bp381 Blood pressure QTL 381 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 27606468 72606468 Rat 2316949 Gluco60 Glucose level QTL 60 3.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 14487011 107057807 Rat 2293652 Bmd22 Bone mineral density QTL 22 4.9 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 10 49444551 81709989 Rat 70198 BpQTLcluster9 Blood pressure QTL cluster 9 2.94 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 42323132 87323132 Rat 2306970 Anxrr22 Anxiety related response QTL 22 5.95 fear/anxiety-related behavior trait (VT:1000241) number of periods of voluntary immobility (CMO:0001045) 10 61345276 98211570 Rat 1359017 Hrtrt21 Heart rate QTL 21 2.4 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 10 51772940 96772940 Rat 2293663 Bss33 Bone structure and strength QTL 33 9.34 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 10 69738412 107211142 Rat 7387312 Bw125 Body weight QTL 125 3 0.0047 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight (CMO:0000356) 10 64890616 107211142 Rat 2312672 Insul15 Insulin level QTL 15 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 10 57134272 102134272 Rat 2317029 Aia19 Adjuvant induced arthritis QTL 19 2.98 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 66978955 107211142 Rat 724556 Pur2 Proteinuria QTL 2 5.5 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 10 22427500 90627625 Rat 8662860 Vetf10 Vascular elastic tissue fragility QTL 10 artery integrity trait (VT:0010639) number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562) 10 6154182 73453136 Rat 61387 Bp1 Blood pressure QTL 1 5.1 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 51770177 107211142 Rat 2317039 Aia6 Adjuvant induced arthritis QTL 6 4.31 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 66978955 107211142 Rat 70223 Bp57 Blood pressure QTL 57 5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 1 80676123 Rat 2317043 Aia7 Adjuvant induced arthritis QTL 7 3.82 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 37565079 82565079 Rat 2317042 Aia20 Adjuvant induced arthritis QTL 20 3.38 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 37565079 82565079 Rat 2298481 Eau9 Experimental allergic uveoretinitis QTL 9 0.0169 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 10 65927233 82565079 Rat 61396 Bp9 Blood pressure QTL 9 4.8 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68420376 107211142 Rat 70363 Bp71 Blood pressure QTL 71 0.04 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 61345276 81714865 Rat 61402 Niddm3 Non-insulin dependent diabetes mellitus QTL 3 4.58 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 61345413 82564856 Rat 1331791 Cm31 Cardiac mass QTL 31 3.84606 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 29299504 107211142 Rat 10450500 Bp385 Blood pressure QTL 385 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 71115217 71966743 Rat 70364 Bp72 Blood pressure QTL 72 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 51121100 96121100 Rat 10450498 Bp384 Blood pressure QTL 384 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 67750049 107211142 Rat 6893366 Bw106 Body weight QTL 106 0.3 0.47 body mass (VT:0001259) body weight (CMO:0000012) 10 70199100 107211142 Rat 2293698 Bss43 Bone structure and strength QTL 43 5.33 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 10 59209888 104209888 Rat 631530 Tls3 T-lymphoma susceptibility QTL 3 0 0.0001 thymus integrity trait (VT:0010555) percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911) 10 51774612 95600334 Rat 2289985 Bp305 Blood pressure QTL 305 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 67502108 73579767 Rat 1354608 Cm33 Cardiac mass QTL 33 2.8 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 10 54809292 99809292 Rat 1558643 Cm44 Cardiac mass QTL 44 4.8 0.0000368 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 61345276 99703528 Rat 631535 Cm51 Cardiac mass QTL 51 3 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 10 51786282 91669536 Rat 1576319 Cia29 Collagen induced arthritis QTL 29 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 33973921 78973921 Rat 8552805 Bw145 Body weight QTL 145 2.2 body mass (VT:0001259) change in body weight to body weight ratio (CMO:0002216) 10 41944526 78307017 Rat 631267 Cia20 Collagen induced arthritis QTL 20 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 2293705 Bmd25 Bone mineral density QTL 25 7.1 0.0001 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 10 49444551 81709989 Rat 1576308 Schws1 Schwannoma susceptibility QTL 1 0.0041 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 10 40035094 102359817 Rat 631269 Cia22 Collagen induced arthritis QTL 22 8.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 631268 Cia21 Collagen induced arthritis QTL 21 3.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 14487011 104060283 Rat 7207811 Bmd90 Bone mineral density QTL 90 5.2 femur size trait (VT:1000369) femoral neck cross-sectional area (CMO:0001697) 10 49444551 81709989 Rat 1576311 Pia26 Pristane induced arthritis QTL 26 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 31224026 75632053 Rat 631270 Cia23 Collagen induced arthritis QTL 23 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 7411614 Foco18 Food consumption QTL 18 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 10 44441699 89441699 Rat 6893336 Cm75 Cardiac mass QTL 75 0.1 0.87 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 10 61345276 99703528 Rat 631547 Bp87 Blood pressure QTL 87 4.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 47369470 92369470 Rat 61427 Cia16 Collagen induced arthritis QTL 16 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 6357896 96121100 Rat 2312662 Slep8 Serum leptin concentration QTL 8 0.05 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 10 57134272 102134272 Rat 2292439 Bp309 Blood pressure QTL 309 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 71115217 71966743 Rat 6893342 Cm78 Cardiac mass QTL 78 0.1 0.88 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 10 42876766 79813922 Rat 2292441 Bp308 Blood pressure QTL 308 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 27606468 72606468 Rat 1642980 Bp300 Blood pressure QTL 300 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68383129 107211142 Rat 631542 Bp82 Blood pressure QTL 82 6.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 26521957 98952741 Rat 2312668 Scl65 Serum cholesterol level QTL 65 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 10 57134272 102134272 Rat
AI787464
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 71,406,200 - 71,406,306 (+) MAPPER mRatBN7.2 mRatBN7.2 1 195,875,222 - 195,875,328 (+) MAPPER mRatBN7.2 Rnor_6.0 1 213,546,690 - 213,546,795 NCBI Rnor6.0 Rnor_6.0 10 73,903,154 - 73,903,259 NCBI Rnor6.0 Rnor_5.0 10 76,196,123 - 76,196,228 UniSTS Rnor5.0 Rnor_5.0 1 220,441,627 - 220,441,732 UniSTS Rnor5.0 RGSC_v3.4 1 200,953,414 - 200,953,519 UniSTS RGSC3.4 RGSC_v3.4 10 74,865,444 - 74,865,549 UniSTS RGSC3.4 Celera 10 70,327,319 - 70,327,424 UniSTS Celera 1 193,519,273 - 193,519,378 UniSTS Cytogenetic Map 1 q41 UniSTS Cytogenetic Map 10 q26 UniSTS
RH133657
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 2 182,788,905 - 182,789,088 (+) MAPPER mRatBN7.2 mRatBN7.2 10 71,405,085 - 71,405,261 (+) MAPPER mRatBN7.2 mRatBN7.2 10 71,405,078 - 71,405,261 (+) MAPPER mRatBN7.2 mRatBN7.2 2 182,788,912 - 182,789,088 (+) MAPPER mRatBN7.2 Rnor_6.0 2 196,386,053 - 196,386,235 NCBI Rnor6.0 Rnor_6.0 10 73,902,032 - 73,902,214 NCBI Rnor6.0 Rnor_5.0 10 76,197,168 - 76,197,350 UniSTS Rnor5.0 Rnor_5.0 2 215,882,523 - 215,882,705 UniSTS Rnor5.0 RGSC_v3.4 2 190,121,004 - 190,121,186 UniSTS RGSC3.4 RGSC_v3.4 10 74,864,322 - 74,864,504 UniSTS RGSC3.4 Celera 10 70,326,197 - 70,326,379 UniSTS Celera 2 175,322,649 - 175,322,831 UniSTS
AA859070
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 195,875,497 - 195,875,652 (+) MAPPER mRatBN7.2 mRatBN7.2 10 71,405,948 - 71,406,103 (+) MAPPER mRatBN7.2 Rnor_6.0 10 73,902,902 - 73,903,056 NCBI Rnor6.0 Rnor_6.0 1 213,546,965 - 213,547,119 NCBI Rnor6.0 Rnor_5.0 10 76,196,326 - 76,196,480 UniSTS Rnor5.0 Rnor_5.0 1 220,441,902 - 220,442,056 UniSTS Rnor5.0 RGSC_v3.4 1 200,953,689 - 200,953,843 UniSTS RGSC3.4 RGSC_v3.4 10 74,865,192 - 74,865,346 UniSTS RGSC3.4 Celera 10 70,327,067 - 70,327,221 UniSTS Celera 1 193,519,550 - 193,519,704 UniSTS Cytogenetic Map 10 q26 UniSTS
RH137097
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 71,405,555 - 71,405,714 (+) MAPPER mRatBN7.2 Rnor_6.0 10 73,902,509 - 73,902,667 NCBI Rnor6.0 Rnor_5.0 10 76,196,715 - 76,196,873 UniSTS Rnor5.0 RGSC_v3.4 10 74,864,799 - 74,864,957 UniSTS RGSC3.4 Celera 10 70,326,674 - 70,326,832 UniSTS Cytogenetic Map 10 q26 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
9
40
93
60
59
29
24
29
6
156
84
73
27
44
30
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000053603
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 71,405,257 - 71,405,348 (-) Ensembl Rnor_6.0 Ensembl 10 73,902,210 - 73,902,301 (-) Ensembl
RefSeq Acc Id:
NR_031823
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 71,902,600 - 71,902,691 (-) NCBI mRatBN7.2 10 71,405,257 - 71,405,348 (-) NCBI Rnor_6.0 10 73,902,210 - 73,902,301 (-) NCBI Rnor_5.0 10 76,197,081 - 76,197,172 (+) NCBI Celera 10 70,326,375 - 70,326,466 (-) NCBI
Sequence:
TGTACCACCTTGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACAGCAGTCGATGGGCTGTCTGACATTTTGGTATC
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2013-08-14
Mir21
microRNA 21
Mir21
microRNA mir-21
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2010-06-02
Mir21
microRNA mir-21
Symbol and Name status set to provisional
70820 PROVISIONAL
