| 1587662 | Mmut | methylmalonyl-CoA mutase | ENCODES a protein that exhibits cobalamin binding (ortholog); GTPase activity (ortholog); identical protein binding (ortholog); INVOLVED IN homocysteine metabolic process (ortholog); positive regulation of GTPase activity (ortholog); post-embryonic development (ortholog); PARTICIPATES IN 3-hydroxy-3 -methylglutaryl-CoA lyase deficiency pathway; 3-hydroxyisobutyric aciduria pathway; 3-methylcrotonyl CoA carboxylase 1 deficiency pathway; ASSOCIATED WITH brain disease (ortholog); inherited metabolic disorder (ortholog); methylmalonic acidemia (ortholog); FOUND IN cytoplasm (ortholog); mitochondrial matrix (ortholog); mitochondrion (ortholog); INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 9 | 27425935 | 27454202 | Rat | 201 | symbol , old_gene_name , PhenoGen , name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 620045 | Mutyh | mutY DNA glycosylase | ENCODES a protein that exhibits DNA N-glycosylase activity; MutLalpha complex binding (ortholog); MutLbeta complex binding (ortholog); INVOLVED IN response to oxidative stress; negative regulation of necroptotic process (ort holog); PARTICIPATES IN base excision repair pathway; ASSOCIATED WITH breast cancer (ortholog); Breast Cancer, Familial (ortholog); breast carcinoma (ortholog); FOUND IN nucleoplasm (ortholog); INTERACTS WITH 1,2-dimethylhydrazine; 2,3,7,8-tetrachlorodibenzodioxine; ammonium chloride | 5 | 135510666 | 135522777 | Rat | 225 | symbol , old_gene_name , PhenoGen , name , description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 38599194 | Depdc5em1Kyo | DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant1, Kyo | ASSOCIATED WITH abnormal afterhyperpolarization; abnormal lateral ventricle morphology; abnormal neocortex morphology | | | | Rat | 5 | name , description | gene, allele |
| 38599195 | Depdc5em2Kyo | DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant2, Kyo | ASSOCIATED WITH abnormal afterhyperpolarization; abnormal lateral ventricle morphology; abnormal neocortex morphology | | | | Rat | 5 | name , description | gene, allele |
| 3312 | Pgam1 | phosphoglycerate mutase 1 | ENCODES a protein that exhibits phosphoglycerate mutase activity; bisphosphoglycerate mutase activity (ortholog); protein kinase binding (ortholog); INVOLVED IN canonical glycolysis (ortholog); gluconeogenesis (ortholog); PA RTICIPATES IN Fanconi syndrome pathway; fructose-1,6-bisphosphatase deficiency pathway; gluconeogenesis pathway; ASSOCIATED WITH adenocarcinoma (ortholog); Animal Mammary Neoplasms (ortholog); carcinoma (ortholog); FOUND IN neuronal cell body; nucleus; ooplasm; INTERACTS WITH (R,R,R)-alpha-tocopherol; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 1 | 250673152 | 250680762 | Rat | 250 | old_gene_name , name , description , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 3313 | Pgam2 | phosphoglycerate mutase 2 | ENCODES a protein that exhibits phosphoglycerate mutase activity; identical protein binding (ortholog); INVOLVED IN gluconeogenesis; response to mercury ion; spermatogenesis; PARTICIPATES IN gluconeogenesis pathway; Fanconi syndrome pathway; fructose-1,6-bisphos phatase deficiency pathway; ASSOCIATED WITH Dimauro Disease (ortholog); myoglobinuria (ortholog); Prostatic Neoplasms (ortholog); FOUND IN nucleus; ooplasm; cytosol (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 3-chloropropane-1,2-diol | 14 | 84895763 | 84897874 | Rat | 164 | old_gene_name , name , description , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 13782372 | Cacna1f csnb | calcium voltage-gated channel subunit alpha1 F; congenital stationary night blindness mutant | ASSOCIATED WITH abnormal b-wave amplitude; abnormal cone electrophysiology; abnormal mechanical nociception; ASSOCIATED WITH congenital stationary night blindness | | | | Rat | 10 | name , description | gene, allele |
| 13830868 | Dock8m1Ztm | dedicator of cytokinesis 8;mutant 1, Ztm | ASSOCIATED WITH type 1 diabetes mellitus | | | | Rat | 1 | name , description | gene, allele |
| 13451539 | Dusp5em1Mcwi | dual specificity phosphatase 5; ZFN induced mutant1, Mcwi | ASSOCIATED WITH decreased vasoconstriction | | | | Rat | 1 | name , description | gene, allele |
| 150519905 | Gfapem1Mes | glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 1,Mes | The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mut t:700;'>mutation in human Alexander disease. | | | | Rat | | name , description | gene, allele |
| 626467888 | Hspa8m1Kyo | heat shock protein family A (Hsp70) member 8; ENU induced mutant1, Kyo | This is an ENU induced mutation causing gait abnormality in KK rats (F344/NSlc background). The mutation is identified as a missense mutation (c.284T>A, p. V95E). | | | | Rat | | name , description | gene, allele |
| 11084926 | Jundem1Tja | JunD proto-oncogene, AP-1 transcription factor subunit; zinc finger nuclease induced mutant 1, Timothy Aitman | The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mut nt-weight:700;'>mutation. | | | | Rat | | name , description | gene, allele |
| 38599153 | Lpin1m1Hubr | lipin 1; ENU induced mutant 1, Hubr | ASSOCIATED WITH abnormal sciatic nerve morphology; dysmyelination; increased cell proliferation | | | | Rat | 5 | name , description | gene, allele |
| 38599156 | Themism1Adej | thymocyte selection associated; mutant1, Adej | ASSOCIATED WITH abnormal duodenum morphology; abnormal ileum morphology; abnormal jejunum morphology; ASSOCIATED WITH inflammatory bowel disease; T-Lymphocytopenia | | | | Rat | 12 | name , description | gene, allele |
| 1578788 | Birc3m1Mcwi | baculoviral IAP repeat-containing 3; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); W76G mutation is generated | | | | Rat | | name , description | gene, allele |
| 1578781 | Egln3m1Mcwi | egl-9 family hypoxia-inducible factor 3; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); E60G mutation is generated | | | | Rat | | name , description | gene, allele |
| 1578787 | Adipoqm1Mcwi | adiponectin, C1Q and collagen domain containing; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); Y162C mutation is generated | | | | Rat | | old_gene_name , name , description | gene, allele |
| 1578797 | Adipoqm2Mcwi | adiponectin, C1Q and collagen domain containing; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); I164N mutation is generated | | | | Rat | | old_gene_name , name , description | gene, allele |
| 1578792 | Adra1am1Mcwi | adrenoceptor alpha 1A; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); G393V mutation is generated | | | | Rat | | name , description | gene, allele |
| 1579889 | Bdkrb2m1Mcwi | bradykinin receptor B2; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); I214T mutation is generated | | | | Rat | | name , description | gene, allele |
| 1578801 | Desm1Mcwi | desmin; mutation 1, Medical College of Wisconsin | Mutation generated by ENU (N-ethyl-N-nitrourea); S25T mutation is generated. | | | | Rat | | name , description | gene, allele |
| 1578789 | Klf6m1Mcwi | KLF transcription factor 6; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); V135G mutation is generated | | | | Rat | | name , description | gene, allele |
| 1578796 | Maddm1Mcwi | MAP-kinase activating death domain; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); G120R mutation is generated | | | | Rat | | name , description | gene, allele |
| 1578790 | Procm1Mcwi | protein C, inactivator of coagulation factors Va and VIIIa; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); L312P mutation is generated | | | | Rat | | name , description | gene, allele |
| 1578785 | Tlr4m1Mcwi | toll-like receptor 4; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); V489A mutation is generated | | | | Rat | | name , description | gene, allele |
| 1306846 | Bloc1s5 | biogenesis of lysosomal organelles complex 1 subunit 5 | INVOLVED IN anterograde axonal transport (ortholog); anterograde synaptic vesicle transport (ortholog); developmental pigmentation (ortholog); ASSOCIATED WITH Hermansky-Pudlak syndrome (ortholog); Hermansky-Pudlak Syndrome 11 (ortholog); platelet storage pool deficiency (ortholog); FOUND IN BLOC-1 c omplex (ortholog); microvesicle (ortholog); transport vesicle (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; bisphenol A; dibutyl phthalate | 17 | 26377549 | 26402869 | Rat | 75 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1578795 | Nos1m1Mcwi | nitric oxide synthase 1; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); L72Stop mutation is generated. | | | | Rat | | name , description | gene, allele |
| 2702 | Glo1 | glyoxalase 1 | ENCODES a protein that exhibits lactoylglutathione lyase activity; zinc ion binding (ortholog); INVOLVED IN glutathione metabolic process; methylglyoxal metabolic process; negative regulation of apoptotic process (ortholog); PARTICIPATES IN glyoxalase metabolic pathway; Leigh disease pathway; primar y hyperoxaluria type 2 pathway; ASSOCIATED WITH Kidney Reperfusion Injury; anxiety disorder (ortholog); autistic disorder (ortholog); FOUND IN cytosol (ortholog); nucleoplasm (ortholog); plasma membrane (ortholog); INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; 3-chloropropane-1,2-diol | 20 | 8665061 | 8683095 | Rat | 247 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 12792941 | Abcc2TR- | ATP binding cassette subfamily C member 2;transport deficient mutant , | ASSOCIATED WITH increased circulating bilirubin level | | | | Rat | 1 | name , description | gene, allele |
| 10413848 | Abcc6em4Qlju | ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li | ASSOCIATED WITH pseudoxanthoma elasticum | | | | Rat | 1 | name , description | gene, allele |
| 10413849 | Abcc6em5Qlju | ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 5, Qiaoli Li | This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp delet ion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. | | | | Rat | | name , description | gene, allele |
| 19165365 | Adcy3em2Mcwi | adenylate cyclase 3; CRISPR/Cas9 induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Adcy3 gene of WKY/Ncrl rat embryos. The resulting mutation is a 3-bp deletion in the exon 2 of the targeted gene. | | | | Rat | | name , description | gene, allele |
| 1579887 | Adipoqm3Mcwi | adiponectin, C1Q and collagen domain containing; mutation 3, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); L119P mutation is generated from the codon change CTG/CCG | | | | Rat | | name , description | gene, allele |
| 1581476 | Adora2am1Mcwi | adenosine A2a receptor; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); C249S mutation is generated from the codon change TGT/AGT | | | | Rat | | name , description | gene, allele |
| 1599561 | Adora2am2Mcwi | adenosine A2a receptor; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); Q310L mutation is generated from the codon change CAG/CTG | | | | Rat | | name , description | gene, allele |
| 1642070 | Adora2am3Mcwi | adenosine A2a receptor; mutation 3, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); E207K mutation is generated from the codon change GAG/AAG | | | | Rat | | name , description | gene, allele |
| 1578784 | Agtr1bm1Mcwi | angiotensin II receptor, type 1b; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); a 3bp deletion generates a mutation at TTC (del251F) | | | | Rat | | old_gene_name , name , description | gene, allele |
| 5143963 | Agtrapem4Mcwi | angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157844-165157927) | | | | Rat | | name , description | gene, allele |
| 5143970 | Agtrapem8Mcwi | angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 8, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157761-165157860) | | | | Rat | | name , description | gene, allele |
| 150520190 | Apoeem1Ejt | apolipoprotein E; TALEN induced mutant 1, Ejt | ASSOCIATED WITH abnormal aorta morphology; increased systemic arterial blood pressure; ASSOCIATED WITH familial hypercholesterolemia | | | | Rat | 3 | name , description | gene, allele |
| 12880022 | Apoeem1Sage | apolipoprotein E; endonuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal aorta morphology; increased systemic arterial blood pressure; ASSOCIATED WITH familial hypercholesterolemia | | | | Rat | 3 | name , description | gene, allele |
| 14394519 | Arid1bem1Mcwi | AT-rich interaction domain 1B; CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4. | | | | Rat | | name , description | gene, allele |
| 13793377 | Avpr2em4Mcwi | arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 4, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. | | | | Rat | | name , description | gene, allele |
| 13793379 | Avpr2em5Mcwi | arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 5, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2. | | | | Rat | | name , description | gene, allele |
| 1599568 | Bdkrb2m2Mcwi | bradykinin receptor B2; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); E178V mutation is generated from the codon change GAA/GTA | | | | Rat | | name , description | gene, allele |
| 1642178 | Birc3m2Mcwi | baculoviral IAP repeat-containing 3; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); K170E mutation is generated from the codon change AAG/GAG | | | | Rat | | name , description | gene, allele |
| 10054305 | Btg2em7Mcwi | BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin | The Btg2 mutation was generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44- bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. | | | | Rat | | name , description | gene, allele |
| 19165134 | C3em1Linf | complement C3; CRISPR/Cas9 system induced mutant 1, Linf | ASSOCIATED WITH increased mechanical nociceptive threshold | | | | Rat | 2 | name , description | gene, allele |
| 1642168 | Cacna1gm1Mcwi | calcium voltage-gated channel subunit alpha1 G; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); S490T mutation is generated from the codon change TCT/ACT | | | | Rat | | name , description | gene, allele |
| 150521525 | Ccdc39em1Jgn | coiled-coil domain containing 39; CRISPR/Cas9 induced mutant 1, Jgn | ASSOCIATED WITH abnormal cerebrospinal fluid flow; abnormal glymphatic system physiology; dilated lateral ventricle; ASSOCIATED WITH hydrocephalus; Ventriculomegaly | | | | Rat | 14 | name , description | gene, allele |
| 1579888 | Ccr2m1Mcwi | C-C motif chemokine receptor 2; mutation 1, Medical College of Wisconsin | Mutation generated by ENU (N-ethyl-N-nitrourea); N117S mutation is generated from the codon change AAT/AGT. | | | | Rat | | name , description | gene, allele |
| 1642356 | Ccr2m2Mcwi | C-C motif chemokine receptor 2; mutation 2, Medical College of Wisconsin | Mutation generated by ENU (N-ethyl-N-nitrourea); I99T mutation is generated from the codon change ATC/ACC. | | | | Rat | | name , description | gene, allele |
| 1581492 | Ccr4m1Mcwi | C-C motif chemokine receptor 4; mutation 1, Medical College of Wisconsin | Mutation generated by ENU (N-ethyl-N-nitrourea); I133V mutation is generated from the codon change ATA/GTA. | | | | Rat | | name , description | gene, allele |
| 1581494 | Cebpem1Mcwi | CCAAT/enhancer binding protein epsilon; mutation 1, Medical College of Wisconsin | Mutation generated by ENU (N-ethyl-N-nitrourea); E37G mutation is generated from the codon change GAG/GGG. | | | | Rat | | name , description | gene, allele |
| 13207489 | Chrnb4em5Mcwi | cholinergic receptor nicotinic beta 4 subunit;CRISPR/Cas9 system induced mutant 5, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene. | | | | Rat | | name , description | gene, allele |
| 1642174 | Cpt2m1Mcwi | carnitine palmitoyltransferase 2; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); F475L mutation is generated from the codon change TTC/CTC | | | | Rat | | name , description | gene, allele |
| 38676462 | Cryba1Hiser | crystallin, beta A1; HiSER mutant | ASSOCIATED WITH abnormal ciliary body morphology; abnormal lens morphology; abnormal retina ganglion layer morphology | | | | Rat | 3 | name , description | gene, allele |
| 126925758 | Cryba1Nuc1Dbsa | crystallin, beta A1;Nuc1 mutant, Dbsa | ASSOCIATED WITH abnormal astrocyte morphology; abnormal autophagy; abnormal retina ganglion layer morphology; ASSOCIATED WITH cataract; microphthalmia; Reticular Dystrophy of Retinal Pigment Epithelium | | | | Rat | 14 | name , description | gene, allele |
| 124713545 | Cyp27b1em1Thka | cytochrome P450, family 27, subfamily b, polypeptide 1; CRISPR/Cas9 induced mutant 1, Thka | ASSOCIATED WITH abnormal cartilage morphology; abnormal femur morphology; abnormal survival; ASSOCIATED WITH vitamin D-dependent rickets type 1A | | | | Rat | 10 | name , description | gene, allele |
| 12880032 | Dmdem1Ang | dystrophin; TALEN-induced mutant1, Ang | ASSOCIATED WITH abnormal heart echocardiography feature; decreased body length; decreased body mass index; ASSOCIATED WITH Cardiac Fibrosis; dilated cardiomyopathy; Duchenne muscular dystrophy | | | | Rat | 13 | name , description | gene, allele |
| 150340622 | Dnd1ter | DND microRNA-mediated repression inhibitor 1, ter mutant | ASSOCIATED WITH abnormal spermatogenesis; absent germ cells; decreased ovary weight; ASSOCIATED WITH teratocarcinoma | | | | Rat | 8 | name , description | gene, allele |
| 12792942 | Dpp4DPPIV | dipeptidylpeptidase 4; DPPIV mutant | ASSOCIATED WITH decreased anxiety-related response; decreased circulating adrenocorticotropin level; decreased circulating alanine transaminase level | | | | Rat | 23 | name , description | gene, allele |
| 126925213 | Drd1m1Hubr | dopamine receptor D1; ENU induced mutant 1, Hubr | ASSOCIATED WITH abnormal response to social novelty; abnormal social investigation; abnormal vocalization | | | | Rat | 5 | name , description | gene, allele |
| 150521603 | Dsg4hr | desmoglein 4; hairless mutant | ASSOCIATED WITH alopecia; ASSOCIATED WITH hypotrichosis | | | | Rat | 2 | name , description | gene, allele |
| 14398765 | EdaraddswhKyo | EDAR-associated death domain;swh Kyo mutant | ASSOCIATED WITH abnormal awl hair morphology; abnormal hair texture; abnormal mammary gland alveolus morphology; ASSOCIATED WITH hypohidrotic ectodermal dysplasia | | | | Rat | 16 | name , description | gene, allele |
| 25394529 | Ephx2em2Mcwi | epoxide hydrolase 2;CRISPR/Cas9 induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. | | | | Rat | | name , description | gene, allele |
| 1578783 | F10m1Mcwi | coagulation factor X; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); V453G mutation is generated from the codon change GTC/GGC | | | | Rat | | name , description | gene, allele |
| 1579886 | F10m2Mcwi | coagulation factor X; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); C388Stop mutation is generated from the codon change TGC/TGA | | | | Rat | | name , description | gene, allele |
| 2314903 | F8m1Ycb | coagulation factor VIII, procoagulant component; mutation 1, Ycb | ASSOCIATED WITH decreased erythrocyte cell number; decreased hematocrit; decreased hemoglobin content; ASSOCIATED WITH factor VIII deficiency | | | | Rat | 4 | name , description | gene, allele |
| 14398829 | Fahem10Dlli-/- | fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 10, Dlli | ASSOCIATED WITH tyrosinemia type I | | | | Rat | 1 | name , description | gene, allele |
| 14398826 | Fahem15Dlli-/- | fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 15, Dlli | ASSOCIATED WITH decreased body weight; increased circulating tyrosine level; moribund; ASSOCIATED WITH liver cirrhosis; tyrosinemia type I | | | | Rat | 6 | name , description | gene, allele |
| 1579885 | Fgl2m1Mcwi | fibrinogen-like 2; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); A301S mutation is generated from the codon change GCA/TCA | | | | Rat | | name , description | gene, allele |
| 1642181 | Fgl2m2Mcwi | fibrinogen-like 2; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); K129N mutation is generated from the codon change AAG/AAT | | | | Rat | | name , description | gene, allele |
| 1642355 | Fgl2m3Mcwi | fibrinogen-like 2; mutation 3, Medical College of Wisconsin | Mutation generated by ENU (N-ethyl-N-nitrourea); N353H mutation is generated from the codon change AAT/CAT. | | | | Rat | | name , description | gene, allele |
| 1642354 | Fgl2m4Mcwi | fibrinogen-like 2; mutation 4, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); H338P mutation is generated from the codon change CAT/CCT | | | | Rat | | name , description | gene, allele |
| 155631280 | Flnaem1Ang | filamin A; CRISPRs/Cas9 induced mutant 1, Ang | This mutant allele was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene. | | | | Rat | | name , description | gene, allele |
| 124715480 | Fmr1em1Mzhe | FMRP translational regulator 1; CRISPR/Cas9 induced mutant1, Mzhe | ASSOCIATED WITH abnormal response to social novelty; abnormal temporal memory; enlarged testis; ASSOCIATED WITH fragile X syndrome | | | | Rat | 5 | name , description | gene, allele |
| 1578794 | Ghsrm1Mcwi | growth hormone secretagogue receptor; mutation 1, Medical College of Wisconsin | ASSOCIATED WITH abnormal gastrointestinal motility; abnormal locomotor behavior; abnormal locomotor response to cocaine | | | | Rat | 7 | name , description | gene, allele |
| 1642180 | Ghsrm2Mcwi | growth hormone secretagogue receptor; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); S342P mutation is generated from the codon change TCC/CCC | | | | Rat | | name , description | gene, allele |
| 1642357 | Ghsrm3Mcwi | growth hormone secretagogue receptor; mutation 3, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); N26K mutation is generated from the codon change AAC/AAA | | | | Rat | | name , description | gene, allele |
| 12880435 | Ghsrem1Ottc | growth hormone secretagogue receptor;CRISPR induced mutant 1, Ottc | ASSOCIATED WITH decreased body weight; decreased food intake; increased brown adipose tissue amount | | | | Rat | 4 | name , description | gene, allele |
| 13524999 | Gja8m1Cas | gap junction protein, alpha 8; mutant 1 Cas | ASSOCIATED WITH cataract | | | | Rat | 1 | name , description | gene, allele |
| 12791992 | Gja8m1Cub | gap junction protein, alpha 8; mutant 1 Cub | ASSOCIATED WITH abnormal lens capsule morphology; abnormal lens development; abnormal lens epithelium morphology; ASSOCIATED WITH cataract; cataract 1 multiple types; microphthalmia | | | | Rat | 31 | name , description | gene, allele |
| 14394517 | Grin2bem1Mcwi | glutamate ionotropic receptor NMDA type subunit 2B; CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3. | | | | Rat | | name , description | gene, allele |
| 126848761 | Gulood | gulonolactone (L-) oxidase; osteogenic discorder mutant | A point mutation (from G to A) at 182 nucelotide was identified in the cDNA isolated from ODS wistar rat. This mutation altered the 61st amino acid Cys to Tyr and resulted in the low gulonolactone (L-) oxidase activity in th e ODS rat. | | | | Rat | | name , description | gene, allele |
| 1581493 | Hand1m1Mcwi | heart and neural crest derivatives expressed 1; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); S109G mutation is generated from the codon change AGC/GGC | | | | Rat | | name , description | gene, allele |
| 1581477 | Has1m1Mcwi | hyaluronan synthase 1; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); F55L mutation is generated from the codon change TTT/TTG | | | | Rat | | name , description | gene, allele |
| 1642171 | Has1m2Mcwi | hyaluronan synthase 1; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); V155L mutation is generated from the codon change GTC/CTC | | | | Rat | | name , description | gene, allele |
| 1642359 | Has1m3Mcwi | hyaluronan synthase 1; mutation 4, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); D167D mutation is generated from the codon change GAT/GAC | | | | Rat | | name , description | gene, allele |
| 1599566 | Has2m1Mcwi | hyaluronan synthase 2; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); Y344Stop mutation is generated from the codon change TAT/TAA | | | | Rat | | name , description | gene, allele |
| 1599564 | Hps6m1Mcwi | HPS6, biogenesis of lysosomal organelles complex 2 subunit 3; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); L67R mutation is generated from the codon change CTG/CGG | | | | Rat | | name , description | gene, allele |
| 626467889 | Hspa8em1Opu | heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA a nd PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. | | | | Rat | | name , description | gene, allele |
| 626467891 | Hspa8em2Opu | heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequence s are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). | | | | Rat | | name , description | gene, allele |
| 1581496 | Htr1am1Mcwi | 5-hydroxytryptamine receptor 1A; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); C266Y mutation is generated from the codon change TGT/TAT | | | | Rat | | name , description | gene, allele |
| 1599562 | Htr1am2Mcwi | 5-hydroxytryptamine receptor 1A; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); G76R mutation is generated from the codon change GGC/CGC | | | | Rat | | name , description | gene, allele |
| 13464264 | Il2rgem1Iexas | interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, Iexas | This mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was perfo rmed by electroporation. This resulting mutation was 5-bp deletion in Il2rg gene on X chromosome. | | | | Rat | | name , description | gene, allele |
| 1642177 | Kcna5m1Mcwi | potassium voltage-gated channel subfamily A member 5; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); N152K mutation is generated from the codon change AAT/AAA | | | | Rat | | name , description | gene, allele |
| 13207498 | Kcnj13em1Mcwi | potassium inwardly-rectifying channel, subfamily J, member 13; CRISPR/Cas9 induced mutant1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene. | | | | Rat | | name , description | gene, allele |
| 1599569 | Klf4m1Mcwi | KLF transcription factor 4; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); V243I mutation is generated from the codon change GTC/ATC | | | | Rat | | name , description | gene, allele |
| 1599559 | Klf4m2Mcwi | KLF transcription factor 4; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); I150N mutation is generated from the codon change ATC/AAC | | | | Rat | | name , description | gene, allele |
| 1642179 | Klf4m3Mcwi | KLF transcription factor 4; mutation 3, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); H344L mutation is generated from the codon change CAT/CTT | | | | Rat | | name , description | gene, allele |
| 19165363 | Krtcap3em3Mcwi | keratinocyte associated protein 3; CRISPR/Cas9 induced mutant 3, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/Ncrlrat embryos. The resulting mutation is a net 2-bp deletion in the exon 2 of the targeted gene. | | | | Rat | | name , description | gene, allele |
| 13703121 | Lamp2em1 | lysosomal-associated membrane protein 2; TALEN induced mutant1 | ASSOCIATED WITH abnormal learning/memory/conditioning; abnormal locomotor behavior; abnormal mitophagy; ASSOCIATED WITH cholestasis; chronic conjunctivitis; cognitive disorder | | | | Rat | 20 | name , description | gene, allele |
| 1578793 | Lcatm1Mcwi | lecithin cholesterol acyltransferase; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); H353L mutation is generated from the codon change CAC/CTC | | | | Rat | | name , description | gene, allele |
| 1599570 | Lcatm2Mcwi | lecithin cholesterol acyltransferase; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); D359E mutation is generated from the codon change GAC/GAG | | | | Rat | | name , description | gene, allele |
| 1642175 | Lcatm3Mcwi | lecithin cholesterol acyltransferase; mutation 3, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); H316N mutation is generated from the codon change CAC/AAC | | | | Rat | | name , description | gene, allele |
| 1642358 | Lcatm4Mcwi | lecithin cholesterol acyltransferase; mutation 4, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); Y336N mutation is generated from the codon change TAT/AAT | | | | Rat | | name , description | gene, allele |
| 1642438 | Lcatm5Mcwi | lecithin cholesterol acyltransferase; mutation 5, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); Y297Stop mutation is generated from the codon change TAC/TAA | | | | Rat | | name , description | gene, allele |
| 13432153 | Leprfa | leptin receptor; fa mutant | ASSOCIATED WITH abnormal calcium ion homeostasis; abnormal glucose tolerance; abnormal insulin secretion; ASSOCIATED WITH Hyperphagia; Insulin Resistance; obesity | | | | Rat | 40 | name , description | gene, allele |
| 1581495 | Lipem1Mcwi | lipase E, hormone sensitive type; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); L347P mutation is generated from the codon change CTA/CCA | | | | Rat | | name , description | gene, allele |
| 1642169 | Lipem2Mcwi | lipase E, hormone sensitive type; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); Q52L mutation is generated from the codon change CTG/CAG | | | | Rat | | name , description | gene, allele |
| 13825200 | Mc4rm1Hubr | melanocortin 4 receptor; ENU induced mutation 1, Hubr | ASSOCIATED WITH decreased heart rate; decreased locomotor activity; decreased mean systemic arterial blood pressure; ASSOCIATED WITH Insulin Resistance; obesity | | | | Rat | 32 | name , description | gene, allele |
| 152600899 | Mir146bem1Mcwi | microRNA 146b; CRISPR/Cas9 induced mutant 1, Mcwi | ASSOCIATED WITH renal fibrosis | | | | Rat | 1 | name , description | gene, allele |
| 12793071 | Mrs2dmyKyo | MRS2 magnesium transporter; demyelination mutant, Kyo | ASSOCIATED WITH demyelinating disease | | | | Rat | 1 | name , description | gene, allele |
| 150573819 | Nkx3-1em1Pjhak | NK3 homeobox 1; TALEN induced mutant 1, Pjhak | ASSOCIATED WITH abnormal copulatory plug deposition; decreased litter size; decreased prostate gland weight | | | | Rat | 5 | name , description | gene, allele |
| 13207502 | Nlrp10em2Mcwi | NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant2, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene. | | | | Rat | | name , description | gene, allele |
| 13207504 | Nlrp10em3Mcwi | NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant3, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene. | | | | Rat | | name , description | gene, allele |
| 13207508 | Nlrp12em1Mcwi | NLR family, pyrin domain containing 12; CRISPR/Cas9 induced mutant1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene. | | | | Rat | | name , description | gene, allele |
| 13800850 | Nlrp3em1Mcwi | NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene. | | | | Rat | | name , description | gene, allele |
| 1578798 | Nr0b2m1Mcwi | nuclear receptor subfamily 0, group B, member 2; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); G96R mutation is generated from the codon change GGC/CGC | | | | Rat | | name , description | gene, allele |
| 1578791 | Nr4a1m1Mcwi | nuclear receptor subfamily 4, group A, member 1; mutation 1, Medical College of Wisconsin | ASSOCIATED WITH abnormal involuntary movement; abnormal substantia nigra pars compacta morphology; decreased body weight; ASSOCIATED WITH Albuminuria; chronic kidney disease; Dyskinesias | | | | Rat | 16 | name , description | gene, allele |
| 1642173 | Oxtrm1Mcwi | oxytocin receptor; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); F225Y mutation is generated from the codon change TTC/TAC | | | | Rat | | name , description | gene, allele |
| 13207510 | P2rx1em7Mcwi | purinergic receptor P2X 1; CRISPR/Cas9 induced mutant7, Medical College of Wisconsin | CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene. | | | | Rat | | name , description | gene, allele |
| 13792805 | P2rx7em10Mcwi | purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 10, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2. | | | | Rat | | name , description | gene, allele |
| 13792806 | P2rx7em13Mcwi | purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 13, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2 | | | | Rat | | name , description | gene, allele |
| 14394507 | P2ry2em5Mcwi | purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 5, Mcwi | CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3 | | | | Rat | | name , description | gene, allele |
| 13800870 | P2ry2em6Mcwi | purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 6, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene. | | | | Rat | | name , description | gene, allele |
| 13800873 | P2ry2em7Mcwi | purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 7, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene. | | | | Rat | | name , description | gene, allele |
| 12802346 | Plp1md | proteolipid protein 1; Myelin-deficient | ASSOCIATED WITH premature death; seizures; tremors; ASSOCIATED WITH epilepsy | | | | Rat | 4 | description | gene, allele |
| 1642176 | Podxlm1Mcwi | podocalyxin-like; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); T154A mutation is generated from the codon change ACA/GCA | | | | Rat | | name , description | gene, allele |
| 41457453 | Prdm14em10Nips | PR/SET domain 14; CRISPR/Cas9 system induced mutant 1, Nips | Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm 14 knocked-out rats have the germ cell-deficient phenotype. | | | | Rat | | name , description | gene, allele |
| 40818256 | Prr5em1Mcwi | proline rich 5;CRISPR/Cas9 system induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. | | | | Rat | | name , description | gene, allele |
| 40818255 | Prr5em2Mcwi | proline rich 5;CRISPR/Cas9 system induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. | | | | Rat | | name , description | gene, allele |
| 11568063 | Ptenem1Sage | phosphatase and tensin homolog; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten. | | | | Rat | | name , description | gene, allele |
| 13208843 | Ptgs2em1Mcwi | prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. | | | | Rat | | name , description | gene, allele |
| 13208845 | Ptgs2em2Mcwi | prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant2, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 4 in the Ptgs2 gene. | | | | Rat | | name , description | gene, allele |
| 13792810 | Ptk2bem1Mcwi | protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2. | | | | Rat | | name , description | gene, allele |
| 13792812 | Ptk2bem3Mcwi | protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 3, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a12-bp deletion in exon 2. | | | | Rat | | name , description | gene, allele |
| 38599191 | Rag2em1Iexas | recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas | This mutation was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by elect roporation. This resulting mutation was 1-bp insertion in Rag2 gene on chromosome 3. | | | | Rat | | name , description | gene, allele |
| 126781694 | Sall1em1Nips | spalt-like transcription factor 1; CRISPR/Cas9 induced mutant 1, Nips | Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1. | | | | Rat | | name , description | gene, allele |
| 1642167 | Serpina5m1Mcwi | serpin family A member 5; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); H24R mutation is generated from the codon change CAT/CGT | | | | Rat | | name , description | gene, allele |
| 41404706 | Shank3em1Bux | SH3 and multiple ankyrin repeat domains 3; ZFN induced mutant 1, Bux | ASSOCIATED WITH Phelan-McDermid syndrome | | | | Rat | 1 | name , description | gene, allele |
| 1642170 | Slc27a5m2Mcwi | solute carrier family 27 member 5; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); K160E mutation is generated from the codon change AAA/GAA | | | | Rat | | name , description | gene, allele |
| 1578786 | Slc8a2m1Mcwi | solute carrier family 8 member A2; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); Y213Stop mutation is generated from the codon change TAT/TAA | | | | Rat | | name , description | gene, allele |
| 1599567 | Sod3m1Mcwi | superoxide dismutase 3; mutation 1, Medical College of Wisconsin | INVOLVED IN blood vessel diameter maintenance; ASSOCIATED WITH abnormal vasodilation; decreased superoxide dismutase level; decreased vasodilation; ASSOCIATED WITH Pulmonary Arterial Hypertension | | | | Rat | 21 | name , description | gene, allele |
| 4139864 | Sorcs1em1Mcwi | sortilin-related VPS10 domain containing receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH proteinuria | | | | Rat | 1 | name , description | gene, allele |
| 13792814 | Spp1em2Mcwi | secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene. | | | | Rat | | name , description | gene, allele |
| 13207528 | spp1em3Mcwi | secreted phosphoprotein 1; CRISPR/Cas9 induced mutant3, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 3 of the Spp1 gene. | | | | Rat | | name , description | gene, allele |
| 13207530 | Spp1em4Mcwi | secreted phosphoprotein 1; CRISPR/Cas9 induced mutant4, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. | | | | Rat | | name , description | gene, allele |
| 13207523 | Tertem3Mcwi | telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin | CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of Crl:SD rat embryos. The resulting mutation is a 17-bp deletion of exon1 in Tert gene. | | | | Rat | | name , description | gene, allele |
| 12879860 | Tgrdw | thyroglobulin; rdw mutant | ASSOCIATED WITH abnormal endoplasmic reticulum morphology; decreased body weight; decreased circulating levels of thyroid hormone; ASSOCIATED WITH Dwarfism; hypothyroidism; isolated growth hormone deficiency | | | | Rat | 15 | name , description | gene, allele |
| 1578800 | Tgfbr2m1Mcwi | transforming growth factor, beta receptor 2; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); T289M mutation is generated from the codon change ACG/ATG | | | | Rat | | name , description | gene, allele |
| 1578782 | Tgfbr2m2Mcwi | transforming growth factor, beta receptor 2; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); E311K mutation is generated from the codon change GAG/AAG | | | | Rat | | name , description | gene, allele |
| 1642182 | Thbdm1Mcwi | thrombomodulin; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); N256K mutation is generated from the codon change AAC/AAA | | | | Rat | | name , description | gene, allele |
| 13793373 | Tlr4em1Mcwi | toll-like receptor 4; CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2. | | | | Rat | | name , description | gene, allele |
| 14995943 | Tmem67wpk | transmembrane protein 67; wpk mutant | INVOLVED IN head development; ASSOCIATED WITH abnormal blood-cerebrospinal fluid barrier function; abnormal cerebrospinal fluid flow; abnormal ciliary body morphology; ASSOCIATED WITH autosomal recessive polycystic kidney disease; communicating hydrocephalus; hydrocephalus | | | | Rat | 33 | name , description | gene, allele |
| 13208230 | Tph1em1Mcwi | tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant1, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. | | | | Rat | | name , description | gene, allele |
| 13208232 | Tph1em3Mcwi | tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant3, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene. | | | | Rat | | name , description | gene, allele |
| 13793375 | Tph1em4Mcwi | tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant4, Mcwi | CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4. | | | | Rat | | name , description | gene, allele |
| 620937 | Mlh1 | mutL homolog 1 | ENCODES a protein that exhibits chromatin binding (ortholog); enzyme activator activity (ortholog); enzyme binding (ortholog); INVOLVED IN response to hypoxia; response to toxic substance; response to xenobiotic stimulus; PARTICIPATES IN altered mismatch repair pathway; colorectal cancer pathway; en dometrial cancer pathway; ASSOCIATED WITH lung carcinoma; bile duct cancer (ortholog); breast cancer (ortholog); FOUND IN synaptonemal complex; chiasma (ortholog); chromosome (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene; 4-hydroperoxycyclophosphamide | 8 | 120074871 | 120112109 | Rat | 500 | old_gene_name , name | gene, protein-coding, VALIDATED [RefSeq] |
| 1309227 | Mlh3 | mutL homolog 3 | ENCODES a protein that exhibits centromeric DNA binding (ortholog); chromatin binding (ortholog); INVOLVED IN DNA damage response (ortholog); female meiosis I (ortholog); intracellular protein localization (ortholog); PARTICIPATES IN mismatch repair pathway; ASSOCIATED WITH breast cancer (ortholog); Breast Cancer, Familial (ortholog); breast carcinoma (ortholog); FOUND IN chiasma (ortholog); condensed chromosome (ortholog); condensed nuclear chromosome (ortholog); INTERACTS WITH 2,4-dinitrotoluene; 2,6-dinitrotoluene; 4,4'-sulfonyldiphenol | 6 | 110612535 | 110649408 | Rat | 124 | old_gene_name , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 620786 | Msh2 | mutS homolog 2 | ENCODES a protein that exhibits ADP binding (ortholog); ATP binding (ortholog); ATP hydrolysis activity (ortholog); INVOLVED IN response to amino acid; response to quercetin; response to xenobiotic stimulus; PARTICIPATES IN altered mismatch repair pathway; colorectal cancer pathway; mismatch repair pathway; ASSOCIATED WITH colitis; Experimental Seizures; ascending colon cancer (ortholog); FOUND IN MutSalpha complex (ortholog); MutSbeta complex (ortholog); nucleoplasm (ortholog); INTERACTS WITH 1,2-dimethylhydrazine; 1-[3-(dimethylamino)propyl]-1-(4-fluorophenyl)-1,3-dihydro-2-benzofuran-5-carbonitrile; 17alpha-ethynylestradiol | 6 | 12567368 | 12626534 | Rat | 697 | old_gene_name , name , description | gene, protein-coding, VALIDATED [RefSeq] |
| 1563954 | Msh3 | mutS homolog 3 | ENCODES a protein that exhibits centromeric DNA binding (ortholog); damaged DNA binding (ortholog); dinucleotide insertion or deletion binding (ortholog); INVOLVED IN spermatogenesis; DNA repair (ortholog); maintenance of DNA repeat elements (ortholog); PARTICIPATES IN mismatch repair pathway; color ectal cancer pathway; ASSOCIATED WITH colorectal carcinoma (ortholog); Digestive System Neoplasms (ortholog); endometrial cancer (ortholog); FOUND IN MutSbeta complex (ortholog); nucleus (ortholog); INTERACTS WITH (+)-schisandrin B; 1-[3-(dimethylamino)propyl]-1-(4-fluorophenyl)-1,3-dihydro-2-benzofuran-5-carbonitrile; acetamide | 2 | 25179400 | 25320857 | Rat | 128 | old_gene_name , name , description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1309190 | Msh4 | mutS homolog 4 | ENCODES a protein that exhibits ATP binding (inferred); ATP-dependent DNA damage sensor activity (inferred); DNA binding (inferred); INVOLVED IN female gamete generation (ortholog); homologous chromosome pairing at meiosis (ortholog); meiotic cell cycle (ortholog); ASSOCIATED WITH genetic disease (o rtholog); hereditary breast ovarian cancer syndrome (ortholog); oligospermia (ortholog); FOUND IN chromosome (ortholog); condensed chromosome (ortholog); condensed nuclear chromosome (ortholog); INTERACTS WITH 2,3,7,8-Tetrachlorodibenzofuran; bisphenol A; dimethylarsinic acid | 2 | 245445118 | 245504493 | Rat | 80 | old_gene_name , name | gene, protein-coding, VALIDATED [RefSeq] |
| 1303008 | Msh5 | mutS homolog 5 | ENCODES a protein that exhibits ATP binding (inferred); ATP-dependent DNA damage sensor activity (inferred); DNA binding (inferred); INVOLVED IN female gamete generation (ortholog); homologous chromosome pairing at meiosis (ortholog); meiosis I (ortholog); ASSOCIATED WITH hepatocellular carcinoma (o rtholog); hereditary breast ovarian cancer syndrome (ortholog); lung non-small cell carcinoma (ortholog); FOUND IN synaptonemal complex (ortholog); INTERACTS WITH 2,2',4,4'-Tetrabromodiphenyl ether; 2,3,7,8-tetrachlorodibenzodioxine; 4-amino-2,6-dinitrotoluene | 20 | 3779180 | 3797996 | Rat | 92 | old_gene_name , name | gene, protein-coding, VALIDATED [RefSeq] |
| 2322311 | Msh6 | mutS homolog 6 | ENCODES a protein that exhibits ADP binding (ortholog); ATP binding (ortholog); ATP-dependent activity, acting on DNA (ortholog); INVOLVED IN mismatch repair; spermatogenesis; determination of adult lifespan (ortholog); PARTICIPATES IN altered mismatch repair pathway; colorectal cancer pathway; endo metrial cancer pathway; ASSOCIATED WITH increased tumor incidence; premature death; ASSOCIATED WITH hereditary nonpolyposis colorectal cancer type 5; Microsatellite Instability; ataxia telangiectasia (ortholog); FOUND IN chromatin (ortholog); MutSalpha complex (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; amphetamine; gentamycin | 6 | 12316190 | 12333505 | Rat | 436 | old_gene_name , name , description | gene, protein-coding, INFERRED [RefSeq] |
| 1311186 | Fuom | fucose mutarotase | ENCODES a protein that exhibits fucose binding (ortholog); L-fucose mutarotase activity (ortholog); racemase and epimerase activity, acting on carbohydrates and derivatives (ortholog); INVOLVED IN female mating behavior (ortholog); fucose metabolic process (orth olog); GDP-L-fucose salvage (ortholog); FOUND IN cytosol (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3-chloropropane-1,2-diol; 6-propyl-2-thiouracil | 1 | 204318180 | 204322690 | Rat | 93 | old_gene_name , name , description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1359459 | Galm | galactose mutarotase | ENCODES a protein that exhibits aldose 1-epimerase activity (ortholog); protein homodimerization activity (ortholog); INVOLVED IN carbohydrate metabolic process (ortholog); galactose catabolic process via UDP-galactose, Leloir pathway (ortholog); galactose metabolic process (ortholog); PARTICIPATES IN Fanconi syndrome pathway; fructose-1,6-bisphosphatase deficiency pathway; gluconeogenesis pathway; ASSOCIATED WITH galactosemia 4 (ortholog); genetic disease (ortholog); FOUND IN cytoplasm (inferred); INTERACTS WITH (+)-schisandrin B; 17alpha-ethynylestradiol; 17beta-estradiol | 6 | 20589775 | 20641516 | Rat | 175 | old_gene_name , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1305221 | Pgm3 | phosphoglucomutase 3 | ENCODES a protein that exhibits phosphoacetylglucosamine mutase activity (ortholog); INVOLVED IN hemopoiesis (ortholog); protein N-linked glycosylation (ortholog); protein O-linked glycosylation (ortholog); PARTICIPATES IN amino sugar metabolic pathway; french t ype sialuria pathway; glycogen biosynthetic pathway; ASSOCIATED WITH cervical cancer (ortholog); genetic disease (ortholog); hyper IgE syndrome (ortholog); INTERACTS WITH 2,6-dinitrotoluene; 6-propyl-2-thiouracil; acrylamide | 8 | 96398331 | 96416045 | Rat | 166 | old_gene_name , name , description | gene, protein-coding, VALIDATED [RefSeq] |
| 150404269 | Myo15aci2 | myosin XVA; ci2 mutant | ASSOCIATED WITH abnormal a-wave implicit time; abnormal b-wave implicit time; abnormal vision; ASSOCIATED WITH blindness | | | | Rat | 6 | name , description | gene, allele |
| 13207345 | TyrsiaKyo | tyrosinase; sia mutant | A spontaneous missense mutation in exon 1 of the tyrosinase gene, S79P, was responsible for siamese phenotype in American fancy rat colony. | | | | Rat | | name , description | gene, allele |
| 40902832 | Atrnzi | attractin;zitter mutant | An 8-bp deletion at the splice donor site of intron 12 was identified in ZI/Kyo rats, which was expected to result in aberrant and unstable transcripts. | | | | Rat | | name | gene, allele |
| 597538481 | Eml1tish | EMAP like 1, tish mutant | ASSOCIATED WITH abnormal forebrain development; abnormal neocortex morphology; abnormal neuron polarity; ASSOCIATED WITH epilepsy; subcortical band heterotopia | | | | Rat | 10 | name , description | gene, allele |
| 42721971 | Myo5am1Stc | myosin VA; mutant 1, Stc | Point mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker rats | | | | Rat | | name , description | gene, allele |
| 735018 | Bpgm | bisphosphoglycerate mutase | ENCODES a protein that exhibits bisphosphoglycerate mutase activity (ortholog); INVOLVED IN erythrocyte development; cellular response to stress (ortholog); defense response to protozoan (ortholog); PARTICIPATES IN Fanconi syndrome pathway; fructose-1,6-bisphosp hatase deficiency pathway; gluconeogenesis pathway; ASSOCIATED WITH familial erythrocytosis 8 (ortholog); INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; acrylamide | 4 | 64106809 | 64135749 | Rat | 143 | old_gene_name , name , description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 12792967 | ArsbMPR | arylsulfatase B; MPR mutant | ASSOCIATED WITH mucopolysaccharidosis VI | | | | Rat | 1 | name , description | gene, allele |
| 12792963 | Lepm1Kyo | leptin; ENU induced mutant1, Kyo | ASSOCIATED WITH increased circulating cholesterol level; increased circulating triglyceride level; increased liver triglyceride level; ASSOCIATED WITH Insulin Resistance; obesity | | | | Rat | 5 | name , description | gene, allele |
| 12738467 | Asipm1 | agouti signaling protein, mutant1 | This allele is a Spontaneous mutation of agouti (Asip) gene with resultant black coat color. | | | | Rat | | name , description | gene, allele |
| 27095886 | Renem2Mcwi | renin; ZFN induced mutant 2, MCWi | This mutant allele was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Hmgc23)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5. | | | | Rat | | name , description | gene, allele |
| 150429617 | Add3em1Mcwi | adducin 3; ZFN induced mutant1, Mcwi | ASSOCIATED WITH decreased tubuloglomerular feedback response; decreased vasoconstriction | | | | Rat | 2 | name | gene, allele |
| 150429619 | Add3em2Mcwi | adducin 3; ZFN induced mutant2, Mcwi | ASSOCIATED WITH decreased tubuloglomerular feedback response; decreased vasoconstriction | | | | Rat | 2 | name | gene, allele |
| 40902835 | Atrnmv | attractin; myelin vacuolation mutant | This allele is a spontaneous tremor mutant identified in an outbred colony of Sprague-Dawley rats. A genomic deletion of rat Atrn gene, including exon 1 was identified in the MV/Opu rats (RGD:1559043)' This is a null mutatio n where no Atrn transcript was detected. | | | | Rat | | name , description | gene, allele |
| 13210580 | Lepem1 | leptin; CRISPR/Cas9 induced mutant 1 | This allele possesses a 3 bp deletion resulting in the deletion of isoleucine at position 14. | | | | Rat | | name | gene, allele |
| 151347430 | Mstnem1Cqin | myostatin; ZFN induced mutant 1, Cqin | ASSOCIATED WITH increased body weight | | | | Rat | 1 | name , description | gene, allele |
| 737688 | Pax6Sey | paired box gene 6, small eye mutation | ASSOCIATED WITH abnormal eye physiology; abnormal nose morphology | | | | Rat | 2 | name , description | gene, allele |
| 42721975 | Nek8lpkArc | NIMA-related kinase 8; lpk mutant, Arc | ASSOCIATED WITH increased kidney epithelial cell primary cilium length; ASSOCIATED WITH nephronophthisis 9 | | | | Rat | 2 | old_gene_name , name , description | gene, allele |
| 329333021 | Spon2em1Holi | spondin 2; TALEN induced mutant1, Holi | ASSOCIATED WITH abnormal vascular wound healing; ASSOCIATED WITH Neointima | | | | Rat | 2 | name , description | gene, allele |
| 12792972 | Tyrem1Kyo | tyrosinase; TALEN induced mutant1, Kyo | ASSOCIATED WITH absent coat pigmentation; ASSOCIATED WITH Albinism | | | | Rat | 2 | name | gene, allele |
| 12802353 | Unc5chob | unc-5 netrin receptor C; hobble mutant | ASSOCIATED WITH absent cerebellum vermis | | | | Rat | 1 | name | gene, allele |
| 12910515 | Leprem1 | leptin receptor; TALEN induced mutant 1 | This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion. | | | | Rat | | name , description | gene, allele |
| 12910518 | Leprem2 | leptin receptor; TALEN induced mutant 2 | ASSOCIATED WITH obesity | | | | Rat | 1 | name , description | gene, allele |
| 12910546 | Leprem3 | leptin receptor; TALEN induced mutant 3 | ASSOCIATED WITH impaired glucose tolerance; increased circulating alanine transaminase level; increased circulating aspartate transaminase level; ASSOCIATED WITH obesity | | | | Rat | 7 | name , description | gene, allele |
| 12790970 | Pax6Sey2 | paired box gene 6, small eye mutation 2 | ASSOCIATED WITH abnormal abducens nerve morphology; abnormal behavioral response to light; abnormal hypoglossal nerve morphology | | | | Rat | 9 | name , description | gene, allele |
| 1587449 | Pgam1-ps1 | phosphoglycerate mutase 1, pseudogene 1 | | 10 | 107010021 | 107011724 | Rat | | name | gene, pseudo, MODEL [RefSeq] |
| 6501114 | Pgam1-ps2 | phosphoglycerate mutase 1, pseudogene 2 | | 6 | 49194159 | 49194892 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 7558326 | Pgam1-ps3 | phosphoglycerate mutase 1, pseudogene 3 | | 10 | 65622497 | 65629638 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 41108340 | Pgam1-ps4 | phosphoglycerate mutase 1, pseudogene 4 | | 7 | 93376441 | 93377086 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 41145206 | Pgam1-ps5 | phosphoglycerate mutase 1, pseudogene 5 | | 17 | 51925503 | 51927669 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 41170419 | Pgam1-ps6 | phosphoglycerate mutase 1, pseudogene 6 | | 5 | 104732068 | 104749165 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 7702239 | Pgam1-ps7 | phosphoglycerate mutase 1, pseudogene 7 | | 6 | 14068759 | 14071615 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 9455316 | Pgam1-ps8 | phosphoglycerate mutase 1, pseudogene 8 | | 5 | 64388768 | 64389653 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 1563314 | Pgam1-ps9 | phosphoglycerate mutase 1, pseudogene 9 | INTERACTS WITH ammonium chloride | 2 | 175322636 | 175323755 | Rat | 1 | name | gene, pseudo, MODEL [RefSeq] |
| 127284884 | Aqp4em1Hrt | aquaporin 4; TALEN induced mutant 1, Hrt | ASSOCIATED WITH abnormal glymphatic system physiology; ASSOCIATED WITH Subarachnoid Hemorrhage | | | | Rat | 2 | name | gene, allele |
| 149735372 | C3em1Kyo | complement C3; ZFN induced mutant 1, Kyo | ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The pups wer e identified by primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'--AATAGAGGCCACCAATGCAC-3'). This mutant allele revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg). | | | | Rat | | name , description | gene, allele |
| 1592057 | Pgam1-ps10 | phosphoglycerate mutase 1, pseudogene 10 | | 2 | 159132184 | 159133137 | Rat | | name | gene, pseudo, MODEL [RefSeq] |
| 1563963 | Pgam1-ps11 | phosphoglycerate mutase 1, pseudogene 11 | INTERACTS WITH poly(I:C) | 10 | 51948181 | 51979610 | Rat | 1 | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 1561575 | Pgam1-ps12 | phosphoglycerate mutase 1, pseudogene 12 | | X | 5925645 | 5926408 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 1597367 | Pgam1-ps13 | phosphoglycerate mutase 1, pseudogene 13 | | 8 | 59477671 | 59480112 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 126925166 | Ubdem1 | ubiquitin D; CRISPR/Cas9 induced mutant1 | ASSOCIATED WITH cardiac interstitial fibrosis; decreased cardiac muscle contractility; increased cardiomyocyte apoptosis; ASSOCIATED WITH myocardial infarction | | | | Rat | 5 | name | gene, allele |
| 13209000 | CybamesSdi | cytochrome b-245 alpha chain;mutant 1,Sdi | ASSOCIATED WITH absent otoliths; decreased NAD(P)H oxidase activity; ASSOCIATED WITH Eosinophilia | | | | Rat | 3 | name | gene, allele |
| 126781696 | Prdm14tm1(H2BVenus)Nips | PR/SET domain 14; targeted mutant 1, Nips | Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by Lipofectamin 2000. Founder animals were backcrossed to Crlj:WI. Homozygous Prdm14 knocked-i n rats have the germ cell-deficient phenotype | | | | Rat | | name | gene, allele |
| 11564344 | Aspaem31Kyo | aspartoacylase;TALEN induced mutant 31,Kyo | TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. | | | | Rat | | name | gene, allele |
| 11564348 | Aspaem34Kyo | aspartoacylase;TALEN induced mutant 34,Kyo | ASSOCIATED WITH brain vacuoles; dysmyelination; ASSOCIATED WITH essential tremor; Tremor | | | | Rat | 4 | name | gene, allele |
| 14398461 | Cd40em1Uthal | CD40 molecule; ZFN induced mutant 1, Uthal | ASSOCIATED WITH decreased circulating creatinine level; decreased collagen level; decreased urine protein level | | | | Rat | 4 | name | gene, allele |
| 13792797 | Fhem1 | fumarate hydratase; TALEN induced mutant 1 | ASSOCIATED WITH abnormal kidney morphology; abnormal lymphocyte morphology; decreased blood uric acid level | | | | Rat | 13 | name , description | gene, allele |
| 12910491 | Il15em1Soar | interleukin 15; ZFN induced mutant 1, Soar | ASSOCIATED WITH abnormal placenta junctional zone morphology; abnormal uterine spiral artery morphology; decreased NK cell number | | | | Rat | 4 | name | gene, allele |
| 126848738 | Msh6m1Hubr | mutS homolog 6; ENU induced mutant 1, Hubr | ASSOCIATED WITH increased tumor incidence; premature death; ASSOCIATED WITH hereditary nonpolyposis colorectal cancer type 5; Microsatellite Instability | | | | Rat | 4 | name , description | gene, allele |
| 152999004 | Fxn em1Fara | frataxin; CRISPR/Cas9 induced mutant 1,Fara | Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 | | | | Rat | | name | gene, allele |
| 152999006 | Fxn em2Fara | frataxin; CRISPR/Cas9 induced mutant 2,Fara | Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system | | | | Rat | | name | gene, allele |
| 150519893 | Lipam1Hyo | lipase A, lysosomal acid type; mutant1, Hyo | This spontaneous mutant allele was identified in the ALD/Hyo rat which is a rat model for Wolman's disease.The Wolman rat Lipa cDNA had the same sequence as the wild type cDNA from the 5'-untranslated region to nt 1101, followed by a 60 bp replacement from nt 11 02 to nt 1161 with poly A signal and a 3' 1.8 kb deletion. | | | | Rat | | name , description | gene, allele |
| 9835400 | Leprm1Rll | leptin receptor; mutant 1, Rudolph L. Leibel | This allele was found in F2 progeny of BNx13M and WKYx13M; substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 | | | | Rat | | name | gene, allele |
| 12792955 | Tp53m1Kyo | tumor protein p53; ENU induced mutant1, Kyo, | A missense mutation R271C in the rat Tp53 was induced by ethylnitrosourea (ENU) mutagenesis in F344/Nslc. | | | | Rat | | name , description | gene, allele |
| 598099555 | Lystbg | lysosomal trafficking regulator; beige mutant | This Lyst gene mutation was identified in 1985 in DA rats maintained at Hamamatsu University School of Medicine since 1980. The mutant beige protein was frameshift and prematured truncated at the 2594th amino acids due to 57 8 bp deletion (positions 7742-8319) caused by recombination between LINE1s (Long Interspersed Nuclear Element 1) | | | | Rat | | name , description | gene, allele |
| 13204705 | Myo7atnd/Hubr | myosin VIIA; ENU induced tornado mutant, Hubr | ASSOCIATED WITH abnormal auditory brainstem response; abnormal cochlear hair cell stereociliary bundle morphology; abnormal vestibular system physiology | | | | Rat | 5 | name | gene, allele |
| 38599148 | Aireem1Ang | autoimmune regulator; ZFN induced mutant1, Ang | ASSOCIATED WITH abnormal NK cell number; abnormal thymus morphology; alopecia; ASSOCIATED WITH autoimmune polyendocrine syndrome | | | | Rat | 10 | name , description | gene, allele |
| 127285405 | Cfbem1Tja | complement factor B, ZFN induced mutant 1, Tja | ASSOCIATED WITH decreased brown adipose tissue amount; decreased circulating aldosterone level; decreased circulating cholesterol level | | | | Rat | 13 | name , description | gene, allele |
| 12910954 | Csf1tl | colony stimulating factor 1; tooth less mutant | ASSOCIATED WITH abnormal bone marrow cavity morphology; abnormal long bone morphology; absent teeth; ASSOCIATED WITH Edentulous Mouth; osteopetrosis | | | | Rat | 7 | name , description | gene, allele |
| 12904898 | Tp53em1Sage | tumor protein p53; ZFN induced mutant 1, Sage | ASSOCIATED WITH abnormal vacuole morphology; decreased body weight; decreased testis weight; ASSOCIATED WITH Hypogonadism and Testicular Atrophy | | | | Rat | 9 | name | gene, allele |
| 150429831 | Tspoem1Vpl | translocator protein; ZFN induced mutant1, Vpl | ASSOCIATED WITH abnormal adrenal gland secretion; decreased circulating corticosterone level; decreased circulating testosterone level; ASSOCIATED WITH cholesterol ester storage disease | | | | Rat | 4 | name , description | gene, allele |
| 150429832 | Tspoem2Vpl | translocator protein; ZFN induced mutant2, Vpl | ASSOCIATED WITH abnormal adrenal gland secretion; decreased circulating corticosterone level; decreased circulating testosterone level; ASSOCIATED WITH cholesterol ester storage disease | | | | Rat | 4 | name , description | gene, allele |
| 150429966 | Apoa4em1Bcgen | apolipoprotein A4; TALEN induced mutant 1, Bcgn | ASSOCIATED WITH decreased circulating glucose level; hepatic steatosis | | | | Rat | 2 | name | gene, allele |
| 13627261 | Avpdi | arginine vasopressin; diabetes insipidus mutant | ASSOCIATED WITH polyuria; ASSOCIATED WITH diabetes insipidus; Polyuria; type 1 diabetes mellitus | | | | Rat | 9 | name | gene, allele |
| 13792720 | Cd59em1Ask | CD59 molecule; CRISPR/Cas9 induced mutant1, Ask | ASSOCIATED WITH decreased erythrocyte cell number; increased red blood cell distribution width; increased susceptibility to type III hypersensitivity reaction; ASSOCIATED WITH neuromyelitis optica | | | | Rat | 5 | name , description | gene, allele |
| 38501062 | Cpem1Ang | ceruloplasmin; CRISPR/Cas9 induced mutant1, Ang | ASSOCIATED WITH decreased circulating ceruloplasmin level; decreased circulating copper level; decreased circulating iron level | | | | Rat | 7 | name , description | gene, allele |
| 12910736 | Esr1em1Soar | estrogen receptor 1; ZFN induced mutant 1, Soar | ASSOCIATED WITH abnormal body size; abnormal female reproductive system morphology; abnormal male reproductive system morphology; ASSOCIATED WITH infertility | | | | Rat | 9 | name | gene, allele |
| 40902840 | Esr2em1Soar | estrogen receptor 2; ZFN induced mutant 1, Soar | ASSOCIATED WITH abnormal circulating androgen level; abnormal proestrus; absent corpus luteum; ASSOCIATED WITH Female Infertility | | | | Rat | 17 | name | gene, allele |
| 149735565 | Ngly1em1Ta | N-glycanase 1; CRISPR/Cas9 induced mutant 1, Ta | ASSOCIATED WITH abnormal sciatic nerve morphology; abnormal thalamus morphology; axonal dystrophy; ASSOCIATED WITH congenital disorder of deglycosylation 1 | | | | Rat | 21 | name , description | gene, allele |
| 13782129 | Pde4bem1Sage | phosphodiesterase 4B; ZFN induced mutant1, Sage | These gene was generated using a pair of zinc finger nucleases targeting exon 1 of the rat PDE4B gene, and the 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 was verified by genomic DNA sequencing. | | | | Rat | | name | gene, allele |
| 150521540 | Uoxem1Cya | urate oxidase; CRISPR/Cas9 induced mutant1, Cya | ASSOCIATED WITH increased blood urea nitrogen level; increased blood uric acid level; tubulointerstitial nephritis; ASSOCIATED WITH hyperuricemia | | | | Rat | 4 | name , description | gene, allele |
| 150429961 | Wwoxlde | WW domain-containing oxidoreductase; lde mutant | ASSOCIATED WITH abnormal gonadotroph morphology; abnormal Leydig cell morphology; audiogenic seizures; ASSOCIATED WITH Dwarfism; epilepsy; Gait Ataxia | | | | Rat | 32 | name , description | gene, allele |
| 626419691 | Lgals3em1Dfult | galectin 3; endonuclease induced mutant 1, Dfult | CRISPR technology was used on the Sprague-Dawley background (Sage) to edit Lgals3 genome. CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue | | | | Rat | | name | gene, allele |
| 127284866 | Nppcem1Kyo | natriuretic peptide C; ZFN induced mutant 1, Kyo | Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 an d 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1). | | | | Rat | | name | gene, allele |
| 127284871 | Nppcem3Kyo | natriuretic peptide C; ZFN induced mutant 3, Kyo | ASSOCIATED WITH decreased body length; decreased body weight; decreased cranium length | | | | Rat | 10 | name | gene, allele |
| 127284873 | Nppcem4Kyo | natriuretic peptide C; ZFN induced mutant 4, Kyo | ASSOCIATED WITH decreased body length; decreased body weight; decreased cranium length | | | | Rat | 8 | name , description | gene, allele |
| 127284869 | Nppcem2Kyo | natriuretic peptide C; ZFN induced mutant 2 , Kyo | Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 9) was deduced to generate one amino-acid substitution (a. a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194, NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc | | | | Rat | | name | gene, allele |
| 124715481 | Pon1em1Lizh | paraoxonase 1; CRISPR/Cas9 induced mutant 1, Lizh | ASSOCIATED WITH arrested T cell differentiation; decreased B cell number; decreased T cell number | | | | Rat | 9 | name | gene, allele |
| 626469800 | Admem1Soar | adrenomedullin; CRISPR/Cas9 induced mutant 1, Soar | Crispr/Cas9 mediated 206 bp deletion associated with Exon 2 and the second intron of the Adm gene | | | | Rat | | name | gene, allele |
| 13799347 | Cgnl1em1Mcwi | cingulin-like 1; CRISPR/Cas9 induced mutant1, Mcwi | CRISPR/Cas9 system was used to introduce a 80-bp deletion of exon 2 of SS/JrHsdMcwi embryos | | | | Rat | | name | gene, allele |
| 13799349 | Cgnl1em2Mcwi | cingulin-like 1; CRISPR/Cas9 induced mutant2, Mcwi | | | | | Rat | | name | gene, allele |
| 38599011 | Defb23em1Mlit | defensin beta 23;CRISPR/Cas9 induced mutant1, Mlit | CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2. | | | | Rat | | name , description | gene, allele |
| 407450416 | Il6em1Yona | interleukin 6; CRISPR/Cas9 induced mutant 1, Yona | ASSOCIATED WITH pulmonary hypertension; Pulmonary Hypertension, Hypoxia-Induced | | | | Rat | 2 | name | gene, allele |
| 12904927 | Lepem1Sage | leptin; zinc finger nuclease induced mutant1, Sage | ASSOCIATED WITH abnormal interferon level; decreased T cell number; increased body weight; ASSOCIATED WITH glucose intolerance; Hypercholesterolemia; hyperinsulinism | | | | Rat | 11 | name | gene, allele |
| 41404724 | Ncf1W | neutrophil cytosolic factor 1, wistar mutant , Rhd | The Wistar Ncf1 (Ncf1W) allele identified with M153T missense mutation. | | | | Rat | | name , description | gene, allele |
| 12792252 | Apcm1Kyo | APC, WNT signaling pathway regulator; mutant 1, Kyo | ASSOCIATED WITH colon cancer | | | | Rat | 1 | old_gene_name , name , description | gene, allele |
| 13451133 | Crb1m1 | crumbs 1, cell polarity complex component, mutant 1 | ASSOCIATED WITH abnormal Muller cell morphology; abnormal retina pigmentation; disorganized retina outer nuclear layer; ASSOCIATED WITH Idiopathic Juxtafoveal Retinal Telangiectasia | | | | Rat | 4 | old_gene_name , name , description | gene, allele |
| 38599012 | Defb26em1Mlit | defensin beta 26; CRISPR/Cas9 induced mutant1, Mlit | CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2. | | | | Rat | | name , description | gene, allele |
| 38599013 | Defb42em1Mlit | defensin beta 42; CRISPR/Cas9 induced mutant1, Mlit | CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2. | | | | Rat | | name , description | gene, allele |
| 405855878 | Foxo4em1Soar | forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar | ASSOCIATED WITH abnormal placenta junctional zone morphology; increased placenta weight; increased placental labyrinth size | | | | Rat | 3 | name , description | gene, allele |
| 21079476 | Leprem4Lizh | leptin receptor; CRISPR/Cas9 induced mutant 4, Lizh | ASSOCIATED WITH decreased bone mineral density; decreased trabecular bone volume; expanded mesangial matrix; ASSOCIATED WITH Dyslipidemias; glucose intolerance; hyperglycemia | | | | Rat | 17 | name , description | gene, allele |
| 13781891 | Rnaset2em1Sage | ribonuclease T2; CRISPR/Cas9 induced mutant 1, Sage | ASSOCIATED WITH brain inflammation; decreased exploration in new environment | | | | Rat | 2 | name | gene, allele |
| 626469576 | Thbdem1Soar | thrombomodulin; CRISPR/Cas 9 induced mutant 1, Soar | 1316 bp deletion of the coding region of the Thbd gene | | | | Rat | | name | gene, allele |
| 7257661 | Tlr4em1Geh | toll-like receptor 4; mutation 1, Gregg E. Homanics | ASSOCIATED WITH decreased tumor necrosis factor secretion | | | | Rat | 1 | name | gene, allele |
| 12910834 | Zbtb16Lx | zinc finger and BTB domain containing 16, Lx mutant | ASSOCIATED WITH preaxial polydactyly; ASSOCIATED WITH polydactyly | | | | Rat | 2 | name , description | gene, allele |
| 126790510 | Ahrem2Sage | aryl hydrocarbon receptor; ZFN induced mutant2, Sage | ASSOCIATED WITH abnormal kidney medullary ray morphology; abnormal urothelium morphology; absent ductus venosus | | | | Rat | 19 | name | gene, allele |
| 401717573 | Mpoem1Mcwi | myeloperoxidase; CRISPR/SpCas9 induced mutant1, Mcwi | CRISPR/SpCas9 system was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in the Crl:SD embryo. | | | | Rat | | name | gene, allele |
| 626419688 | Nox1em1Shmo | NADPH oxidase 1; endonuclease induced mutant 1, Shmo | A 29-base deletion was introduced into the first exon of the NADPH oxidase 1 (Nox1) gene of F344/DuCrj rats by CRISPR/Cas9. | | | | Rat | | name | gene, allele |
| 626419690 | Nox4em1Shmo | NADPH oxidase 4; endonuclease induced mutant 1, Shmo | A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. | | | | Rat | | name | gene, allele |
| 329955460 | P2rx7em1Tja | purinergic receptor P2X 7; ZFN induced mutant 1, Tja | This allele was created by ZFN technology to generate a 2-bp ,AT, insertion in exon 10 | | | | Rat | | name | gene, allele |
| 408364972 | Vdrem1Hfd | vitamin D receptor; CRISPR/Cas9 induced mutant 1,Hfd | The CRISPR/Cas9 system was used to introduce a net 12-bp deletion in exon 3 of the Vdr gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGcccccggatctgtgGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGt----- GAGTGTGTGGAGACCGAG CCAC | | | | Rat | | name | gene, allele |
| 408364962 | Vdrem3Hfd | vitamin D receptor; CRISPR/Cas9 induced mutant 3,Hfd | This mutant allele carries 5-bp deletion (CCCCG) in exon 3 of Vdr gene induced by CRISPR/Cas9 system in the embryos of F344-ApcPirc/Uwm rats (RGD:1641862). | | | | Rat | | name , description | gene, allele |
| 12903271 | Ahrem1Sage | aryl hydrocarbon receptor; ZFN induced mutant1, Sage | This ZFN allele contains a 760-bp deletion in the rat Ahr gene. | | | | Rat | | name | gene, allele |
| 40902862 | Kiss1tm1Nips | KiSS-1 metastasis-suppressor; targeted mutant 1, Nips | ASSOCIATED WITH absent sexual maturation; decreased circulating luteinizing hormone level | | | | Rat | 2 | name , description | gene, allele |
| 126781693 | Kiss1tm8Nips | KiSS-1 metastasis-suppressor; targeted mutant 8, Nips | This mutation was created by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination | | | | Rat | | name , description | gene, allele |
| 12910763 | KitWs | KIT proto-oncogene receptor tyrosine kinase; mutant 1 | ASSOCIATED WITH abnormal interstitial cell of Cajal morphology; absent mast cells; belly spot; ASSOCIATED WITH aplastic anemia | | | | Rat | 10 | name , description | gene, allele |
| 155631294 | Pde3aem1Bdr | phosphodiesterase 3A; Cas9/Cas9 induced mutant 1, Bdr | The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat mod el exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446). | | | | Rat | | name , description | gene, allele |
| 155631296 | Pde3aem2Bdr | phosphodiesterase 3A; Cas9/Cas9 induced mutant 2, Bdr | The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat mod el exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein | | | | Rat | | name , description | gene, allele |
| 155631299 | Pde3aem3Bdr | phosphodiesterase 3A; Cas9/Cas9 induced mutant 3, Bdr | The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGT missense mut tation and results in R862C substitutions in the protein | | | | Rat | | name , description | gene, allele |
| 12904904 | Rag2em1Sage | recombination activating 2; ZFN induced mutant1, Sage | This ZFN mutant allele has a 2 bp deletion within exon 3 of the Rag2 gene. | | | | Rat | | name , description | gene, allele |
| 126790548 | Rin1em1Hcz | Ras and Rab interactor 1; TALEN induced mutant 1, Hcz | ASSOCIATED WITH abnormal learning/memory/conditioning; decreased freezing behavior | | | | Rat | 2 | name , description | gene, allele |
| 152999024 | Aif1tm(EGFP)Apps | allograft inflammatory factor 1; target mutant 1,Apps | Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porc ine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used. | | | | Rat | | name | gene, allele |
| 127345127 | Angptl8em1Kyo | angiopoietin-like 8; CRISPR/Cas9 induced mutant 1, Kyo | ASSOCIATED WITH decreased body weight; decreased circulating triglyceride level; decreased circulating VLDL triglyceride level | | | | Rat | 7 | name , description | gene, allele |
| 127345128 | Angptl8em2Kyo | angiopoietin-like 8; CRISPR/Cas9 induced mutant 2, Kyo | This Angptl8 allele was generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGC TGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense). A 980-bp deletion in the ANGPTL8 gene was identified in this allele, resulting in a premature termination codon. | | | | Rat | | name | gene, allele |
| 12879401 | Atmem1Kyo | ATM serine/threonine kinase; ZFN induced mutant 1, Kyo | ASSOCIATED WITH abnormal microglial cell activation; abnormal microglial cell morphology; abnormal ovarian folliculogenesis; ASSOCIATED WITH ataxia telangiectasia; disease of cellular proliferation; infertility | | | | Rat | 15 | name , description | gene, allele |
| 12879395 | Atmm1Kyo | ATM serine/threonine kinase; ENU induced mutant 1, Kyo | ASSOCIATED WITH abnormal ovarian folliculogenesis; abnormal seminiferous tubule morphology; abnormal survival; ASSOCIATED WITH disease of cellular proliferation; infertility; lymphoma | | | | Rat | 10 | name , description | gene, allele |
| 405649861 | Esr1em1Bra | estrogen receptor 1; CRISPR/Cas9 induced mutant 1, Bra | This CRISPR/Cas9 system was used to generate a 25 bp deletion in the rat Esr1, resulting lost of function for Esr1. | | | | Rat | | name | gene, allele |
| 628359040 | Fstl3em1Soar | follistatin like 3; CRISPR/Cas9 induced mutant 1, Soar | Crispr/Cas9 mediated 3243 bp deletion affecting Exons 1-3 of the Fstl3 gene | | | | Rat | | name | gene, allele |
| 12904901 | Rag1em1Sage | recombination activating 1; ZFN induced mutant 1, Sage | This ZFN mutant allele has a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. | | | | Rat | | name , description | gene, allele |
| 124713547 | Vdrem1Thka | vitamin D receptor; CRISPR/Cas9 induced mutant 1, Thka | ASSOCIATED WITH abnormal cartilage morphology; abnormal femur morphology; abnormal trabecular bone morphology; ASSOCIATED WITH vitamin D-dependent rickets type 2A | | | | Rat | 7 | name , description | gene, allele |
| 124713550 | Vdrem2Thka | vitamin D receptor; CRISPR/Cas9 induced mutant 2, Thka | ASSOCIATED WITH abnormal cartilage morphology; abnormal skin appearance; abnormal trabecular bone morphology; ASSOCIATED WITH vitamin D-dependent rickets type 2A | | | | Rat | 7 | name , description | gene, allele |
| 15090818 | Ahrem1Hyama | aryl hydrocarbon receptor; TALEN induced mutant1, Hyama | TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' was injected to embryos of JclKud:WI to delete part of exon 2 of the rat Ahr gene. | | | | Rat | | name | gene, allele |
| 408364987 | C1ql3em1Lian | complement C1q like 3; CRISPR/Cas9 induced mutant1,Lian | This C1ql3 knock out allele was induced in Wistar embryos.The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant fe male were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame. | | | | Rat | | name , description | gene, allele |
| 13464330 | Frem2fpl | Fras1 related extracellular matrix protein 2;fpl mutant | ASSOCIATED WITH abnormal eyelid fusion; fused right lung lobes; syndactyly; ASSOCIATED WITH Fraser syndrome 2 | | | | Rat | 5 | name , description | gene, allele |
| 12910102 | Ldlrem1 | low density lipoprotein receptor; ZFN induced mutant 1 | ASSOCIATED WITH increased liver free fatty acids level; ASSOCIATED WITH Dyslipidemias; Hypercholesterolemia; Hypertriglyceridemia | | | | Rat | 4 | name | gene, allele |
| 12910500 | Mmp12em1Soar | matrix metallopeptidase 12; TALEN induced mutant 1,Soar | ASSOCIATED WITH decreased fetal weight | | | | Rat | 1 | name | gene, allele |
| 12910506 | Mmp12em2Soar | matrix metallopeptidase 12; TALEN induced mutant 2,Soar | ASSOCIATED WITH decreased fetal weight; decreased litter size | | | | Rat | 2 | name | gene, allele |
| 42721979 | Pde6bem1Baek | phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Baek | ASSOCIATED WITH abnormal retina blood vessel pattern; increased retina apoptosis; retina degeneration; ASSOCIATED WITH retinitis pigmentosa | | | | Rat | 7 | name | gene, allele |
| 155631290 | Pde6bem1Cgen | phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Cgen | The rat Pde6b knock out allele was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. | | | | Rat | | name | gene, allele |
| 14696789 | Trim63em1(hiLuc) | tripartite motif containing 63; ZFN targeted mutation 1 | ASSOCIATED WITH muscular dystrophy | | | | Rat | 1 | name | gene, allele |
| 616390062 | Adcy3em3Mcwi | adenylate cyclase 3; CRISPR/Cas9 induced mutant 3, Mcwi | Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062). | | | | Rat | | name | gene, allele |
| 12910941 | Cdkn1bwe | cyclin-dependent kinase inhibitor 1B; white eye mutation | ASSOCIATED WITH increased pheochromocytoma incidence; thyroid gland hyperplasia; ASSOCIATED WITH cataract; multiple endocrine neoplasia; paraganglioma | | | | Rat | 9 | name , description | gene, allele |
| 625813034 | Fmr1em1Sidb | FMRP translational regulator 1; ZFN induced mutant1,Sidb | ASSOCIATED WITH abnormal afterhyperpolarization; abnormal brain wave pattern; abnormal habituation to a new environment; ASSOCIATED WITH fragile X syndrome | | | | Rat | 10 | name | gene, allele |
| 149735563 | Gad2em24Yyan | glutamate decarboxylase 2; TALEN induced mutant 24, Yyan | This Gad2 allele was created by TALEN. | | | | Rat | | name | gene, allele |
| 126925168 | Ogdhem1Yuyi | oxoglutarate dehydrogenase; TALEN induced mutant 1, Yuyi | The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. | | | | Rat | | name | gene, allele |
| 626419692 | Pbkem1Dfult | PDZ binding kinase; endonuclease induced mutant 1, Dfult | CRISPR-Cas9 technology was used to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein. | | | | Rat | | name | gene, allele |
| 7241593 | Rbm20m1Mlgw | RNA binding motif protein 20; mutation 1, Marion Greaser | ASSOCIATED WITH decreased aerobic running capacity | | | | Rat | 1 | name | gene, allele |
| 14394509 | Tlr4em5Mcwi | toll-like receptor 4; CRISPR/Cas9 induced mutant 5, Mcwi | CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos | | | | Rat | | name | gene, allele |
| 151665326 | Ucp2em1Mcwi | uncoupling protein 2; CRIPSR/Cas9 induced mutant 1, MCWi | Generated by CRISPR/Cas9 mutagenesis of SS/JrHsdMcwi rats by Aron Geurts. The resulting mutation is a 23-bp deletion (rn7: chr1:154,842,967-154,842,989) | | | | Rat | | name , description | gene, allele |
| 126781692 | Csf1rtm(EGFP)Tset | colony stimulating factor 1 receptor; target mutant, Tset | ASSOCIATED WITH abnormal brain development; abnormal corpus callosum size; absent teeth; ASSOCIATED WITH bone development disease; infertility; lymphopenia | | | | Rat | 27 | name | gene, allele |
| 125093747 | Disc1em1Rst | DISC1 scaffold protein; CRISPR/Cas9 induced mutant 1, Rst | CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation. | | | | Rat | | name , description | gene, allele |
| 38599015 | L1camem1Jgn | L1 cell adhesion molecule;CRISPR/Cas9 induced mutant1,JGN | The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain. | | | | Rat | | name , description | gene, allele |
| 14696788 | L1camem2Jgn | L1 cell adhesion molecule;CRISPR/Cas9 induced mutant2,JGN | ASSOCIATED WITH X-Linked Hydrocephalus | | | | Rat | 1 | name , description | gene, allele |
| 126925953 | Myh7bem1Blar | myosin heavy chain 7B; CRISPR/Cas9 induced mutant 1, Blar | ASSOCIATED WITH abnormal myocardial fiber calcium currents; abnormal sarcomere morphology; cardiac fibrosis; ASSOCIATED WITH hypertrophic cardiomyopathy | | | | Rat | 10 | name | gene, allele |
| 626471108 | Tbx21em1Sage | T-box transcription factor 21; ZFN induced mutant 1, Sage | This allele is created using ZFN technology targeting Tbx21 exon 1 coding sequences 378-412. The resulting mutation is a 22-bp deletion (392-413). | | | | Rat | | name , description | gene, allele |
| 150523756 | Ighmem1Ang | immunoglobulin heavy constant mu; ZFN induced mutant1, Ang | ASSOCIATED WITH decreased B cell number; decreased IgA level; decreased IgE level; ASSOCIATED WITH B cell deficiency | | | | Rat | 7 | name , description | gene, allele |
| 150523758 | Ighmem2Ang | immunoglobulin heavy constant mu; ZFN induced mutant2, Ang | ASSOCIATED WITH decreased B cell number; decreased IgA level; decreased IgE level; ASSOCIATED WITH B cell deficiency | | | | Rat | 7 | name , description | gene, allele |
| 126777685 | Mkxem1Asah | mohawk homeobox; CRISPR/Cas9 system induced mutant 1, Asah | ASSOCIATED WITH abnormal gait; abnormal tendon collagen fibril morphology; abnormal tendon morphology; ASSOCIATED WITH Heterotopic Ossification | | | | Rat | 7 | name , description | gene, allele |
| 14398480 | Xdhem1Mcwi | xanthine dehydrogenase; CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. | | | | Rat | | name | gene, allele |
| 14398482 | Xdhem2Mcwi | xanthine dehydrogenase; CRISPR/Cas9 induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. | | | | Rat | | name | gene, allele |
| 626419682 | Peg3em1Soar | paternally expressed 3; endonuclease induced mutant 1, Soar | Crispr/Cas9 genome editing of the Peg3 gene | | | | Rat | | name | gene, allele |
| 126781695 | Sall1tm4(tdTomato)Nips | spalt-like transcription factor 1; targeted mutant 4, Nips | Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Founder animals were backcrossed to Crlj:WI. Homozygous Sall1 knocked-in ra ts had the anephric phenotype at E21.5, and died at postnatal Day-1. | | | | Rat | | name | gene, allele |
| 14390068 | Slc6a4m1Hubr | solute carrier family 6 member 4; ZFN induced mutant1, Hubr | ASSOCIATED WITH abnormal acquisiton of operant behavior for a cocaine reinforcer; abnormal cocaine self-administration; anhedonia; ASSOCIATED WITH anxiety disorder; depressive disorder | | | | Rat | 11 | name | gene, allele |
| 11565090 | Ccdc85cem1Kyo | coiled-coil domain containing 85C; TALEN induced mutant1,Kyo | ASSOCIATED WITH intracranial hemorrhage; premature death; ASSOCIATED WITH hydrocephalus | | | | Rat | 3 | name | gene, allele |
| 38455987 | Hamp em1Jfcol | hepcidin antimicrobial peptide; TALEN induced mutant 1, Jfco | The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 169-bp deletion between exons 2 & 3 of rat Hamp gene. | | | | Rat | | name , description | gene, allele |
| 38455989 | Hamp em2Jfcol | hepcidin antimicrobial peptide; TALEN induced mutant 2, Jfco | The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene. | | | | Rat | | name , description | gene, allele |
| 38455990 | Hamp em3Jfcol | hepcidin antimicrobial peptide; TALEN induced mutant 3, Jfco | The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene. | | | | Rat | | name , description | gene, allele |
| 38455991 | Hamp em4Jfcol | hepcidin antimicrobial peptide; TALEN induced mutant 4, Jfco | The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 15-bp deletion in exon 2 of the rat Hamp gene. | | | | Rat | | name , description | gene, allele |
| 12904909 | Ldlrem1Sage | low density lipoprotein receptor; ZFN induced mutant 1, Sage | ASSOCIATED WITH impaired glucose tolerance; increased body weight; increased circulating free fatty acids level; ASSOCIATED WITH Hypercholesterolemia; Hypertriglyceridemia | | | | Rat | 8 | name | gene, allele |
| 12792970 | Lgi1m1Kyo | leucine-rich, glioma inactivated 1; ENU induced mutant1, Kyo | ASSOCIATED WITH audiogenic seizures; increased susceptibility to induction of seizure by inducing agent; premature death; ASSOCIATED WITH epilepsy; epilepsy with generalized tonic-clonic seizures | | | | Rat | 5 | name , description | gene, allele |
| 126848739 | Lpar1m1Hubr | lysophosphatidic acid receptor 1; ENU induced mutant 1, Hubr | ASSOCIATED WITH abnormal craniofacial development; decreased body size | | | | Rat | 2 | name , description | gene, allele |
| 150429964 | Pmchm1Hubr | pro-melanin-concentrating hormone; ENU induced mutant1, Hubr | ASSOCIATED WITH decreased adipose tissue noradrenaline turnover; decreased body fat mass; decreased brown adipose tissue mass | | | | Rat | 15 | name , description | gene, allele |
| 329955453 | Serpina6em1Glha | serpin family A member 6; CRISPR/cas9 induced mutant 1, Glha | This allele was made by CRISPR/cas9 in Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as cortic osteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon. | | | | Rat | | name | gene, allele |
| 126925197 | Slc6a3m1Span | solute carrier family 6 member 3; ENU induced mutant 1, Span | This allele was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was id entified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence. | | | | Rat | | name , description | gene, allele |
| 12792962 | Sv2am1Kyo | synaptic vesicle glycoprotein 2a; ENU induced mutant 1, Kyo, | ASSOCIATED WITH increased kindling response; increased susceptibility to pharmacologically induced seizures; ASSOCIATED WITH Experimental Seizures | | | | Rat | 3 | name , description | gene, allele |
| 401940199 | Ahrem1Iexas | aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Iexas | ASSOCIATED WITH increased right ventricle systolic pressure; pulmonary hypertension; ASSOCIATED WITH pulmonary hypertension | | | | Rat | 3 | name | gene, allele |
| 13702081 | Ahrem1Soar | aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar | ASSOCIATED WITH decreased circulating anti-Mullerian hormone level; decreased physiological sensitivity to xenobiotic; decreased susceptibility to xenobiotic induced morbidity/mortality | | | | Rat | 4 | name | gene, allele |
| 12902622 | Bdnfem1Sage | brain-derived neurotrophic factor; ZFN induced mutant 1, Sage | ASSOCIATED WITH addiction; cocaine preference; high preference for an addictive substance; ASSOCIATED WITH Cocaine-Related Disorders | | | | Rat | 7 | name | gene, allele |
| 12880382 | Cacna1agry | calcium voltage-gated channel subunit alpha1 A; groggy mutant | ASSOCIATED WITH decreased spike-wave discharge type I; ASSOCIATED WITH childhood absence epilepsy | | | | Rat | 2 | name , description | gene, allele |
| 14398500 | Drd1em1(iCre)Berke | dopamine receptor D1; CRISPR induced targeted mutant 1, Berke | The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE. | | | | Rat | | name | gene, allele |
| 150429816 | Gnalem1Hpng | G protein subunit alpha L; CRISPR/Cas9 induced mutant 1, Hpng | ASSOCIATED WITH abnormal motor coordination/balance; abnormal motor learning; decreased locomotor activity; ASSOCIATED WITH dystonia | | | | Rat | 8 | name , description | gene, allele |
| 626419678 | Gnalem2Hpng | G protein subunit alpha L; CRISPR/Cas9 induced mutant 2, Hpng | Gnal knockout allele was generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2. | | | | Rat | | name | gene, allele |
| 626419680 | Gnalem3Hpng | G protein subunit alpha L; CRISPR/Cas9 induced mutant 3, Hpng | The allele was generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutation. | | | | Rat | | name , description | gene, allele |
| 329845587 | Izumo1em1Osb | izumo sperm-oocyte fusion 1;CRISPR/Cas9 induced mutant 1,Osb | This CRISPR/Cas9 induced mutant allele carries a 7-bp deletion（CTTTGGA）after start codon (Met) in exon2 of Izumo1 gene. | | | | Rat | | name , description | gene, allele |
| 40902839 | Mertkrdy | MER proto-oncogene, tyrosine kinase; retinal dystrophy mutant | A small deletion of DNA that disrupts the gene encoding the receptor tyrosine kinase Mertk was detected in the retinal dystrophy RCS/LavRrrc. The deletion includes the splice acceptor site upstream of the second coding exon of Mertk and results in a shortened transcript that lacks this exon. The abe rrant transcript joins the first and third coding exons, leading to a frameshift and a translation termination signal 20 codons after the AUG. | | | | Rat | | name | gene, allele |
| 14694849 | Pvalbem1(flpo)Berke | parvalbumin; CRISPR/Cas9 induced flpo knock in mutant1, Berke | A double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.o rg/10.1101/386474. ) | | | | Rat | | name | gene, allele |
| 149735335 | Wfs1em1Ptsn | wolframin ER transmembrane glycoprotein; ZFN induced mutant 1 | ASSOCIATED WITH abnormal brainstem morphology; decreased insulin secretion; decreased pancreatic beta cell mass; ASSOCIATED WITH cataract; diabetes mellitus; glucose intolerance | | | | Rat | 18 | name | gene, allele |
| 149735337 | Wfs1em2Ptsn | wolframin ER transmembrane glycoprotein; ZFN induced mutant 2 | ASSOCIATED WITH impaired glucose tolerance | | | | Rat | 1 | name | gene, allele |
| 149735339 | Wfs1em3Ptsn | wolframin ER transmembrane glycoprotein; ZFN induced mutant 3 | ASSOCIATED WITH impaired glucose tolerance | | | | Rat | 1 | name | gene, allele |
| 14398735 | Adora2aem1(iCre)Berke | adenosine A2a receptor;CRISPR induced targeted mutant 1, Berke | The CRISPR system was used to created target insertion of iCre recombinase immediately after Adora2a gene, with P2A linker, of the embryos of BluHsd:LE. | | | | Rat | | name | gene, allele |
| 628359039 | Lifrem1Soar | LIF receptor subunit alpha; CRISPR/Cas9 induced mutant 1, Soar | Crispr/Cas9 mediated 88bp deletion of Exon 2 of the Lifr gene | | | | Rat | | name | gene, allele |
| 127345099 | Muc1em1Cgen | mucin 1, cell surface associated; TALEN induced mutant 1, Cgen | ASSOCIATED WITH allergic rhinitis | | | | Rat | 1 | name | gene, allele |
| 13792802 | P2rx7em12Mcwi | purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 12, Mcwi | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp deletion in Exon 2 of the P2rx7 gene. | | | | Rat | | name , description | gene, allele |
| 629096379 | Rag1em6Mcwi | recombination activating 1; CRISPR/Cas9 induced mutant 1, Mcwi | The allele was produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 100 02791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. | | | | Rat | | name , description | gene, allele |
| 12904734 | Slc22a1em1Sage | solute carrier family 22 member 1; ZFN induced mutant 1, Sage | This ZFN induced allele contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot. | | | | Rat | | name | gene, allele |
| 126790465 | Ube3aem1Jue | ubiquitin protein ligase E3A; CRISPR/Cas9 induced mutant1, Jue | ASSOCIATED WITH abnormal motor learning; decreased exploration in new environment; decreased vertical activity; ASSOCIATED WITH Angelman syndrome | | | | Rat | 9 | name | gene, allele |
| 149735571 | Atg16l1em8Rrrc | autophagy related 16-like 1; CRISPR/Cas9 induced mutant 8, RRRC | CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in h umans (T300A), Homozygosity for this allele is embryonic lethal. | | | | Rat | | name | gene, allele |
| 149735561 | Gad1em15Yyan | glutamate decarboxylase 1; CRISPR/Cas9 induced mutant 15, Yyan | ASSOCIATED WITH abnormal response to novel object; abnormal spike wave discharge; behavioral despair | | | | Rat | 11 | name , description | gene, allele |
| 12879433 | Ift140em1Kyo | intraflagellar transport 140; CRISPR/Cas9 induced mutant 1, Kyo | This allele was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene. | | | | Rat | | name | gene, allele |
| 12879435 | Ift140em2Kyo | intraflagellar transport 140; CRISPR/Cas9 induced mutant 2, Kyo | This allele was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 2 (em2) has 2-bp deletion (c.23_24del) in the exon 1 of Ift140 (intraflagellar transport 140) gene. | | | | Rat | | name | gene, allele |
| 13628731 | Il2rgem1Ang | interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang | ASSOCIATED WITH decreased bone marrow cell number; decreased CD4-positive, alpha-beta T cell number; decreased CD8-positive, alpha-beta T cell number; ASSOCIATED WITH Immune Deficiency Disease | | | | Rat | 10 | name , description | gene, allele |
| 12798560 | Il2rgem1Kyo | interleukin 2 receptor subunit gamma; ZFN induced mutant 1, Kyo | ASSOCIATED WITH combined T cell and B cell immunodeficiency; X-linked severe combined immunodeficiency | | | | Rat | 2 | name , description | gene, allele |
| 12798561 | Il2rgem2Kyo | interleukin 2 receptor subunit gamma; ZFN induced mutant 2, Kyo | ASSOCIATED WITH combined T cell and B cell immunodeficiency; X-linked severe combined immunodeficiency | | | | Rat | 2 | name , description | gene, allele |
| 13464340 | Il2rgem3Kyo | interleukin 2 receptor subunit gamma; ZFN induced mutant 3, Kyo | This mutant allele was generated by a zinc finger nuclease induced 332-bp deletion in Il2rg gene of F344/TM embryo. | | | | Rat | | name , description | gene, allele |
| 13464339 | Il2rgem4Kyo | interleukin 2 receptor subunit gamma; ZFN induced mutant 4, Kyo | The mutant allele has a zinc finger nuclease-induced 162-bp deletion mutation in the Il2rg gene of the the TM/Kyo embryo. | | | | Rat | | name , description | gene, allele |
| 12910099 | Il2rgem5Kyo | interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo | This ZFN induced mutant allele contains a 653-bp deletion in the Il2rg gene. | | | | Rat | | name , description | gene, allele |
| 12910097 | Il2rgem6Kyo | interleukin 2 receptor subunit gamma; ZFN induced mutant 6, Kyo | These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm. A 332-bp deletion mutation was created. | | | | Rat | | name , description | gene, allele |
| 13792571 | Oprl1m1Hubr | opioid related nociceptin receptor 1; ENU induced mutant1, Hubr | ASSOCIATED WITH abnormal behavioral response to nicotine; abnormal cocaine self-administration; abnormal drug-induced reinstatement of an extinguished operant behavior for a drug reinforcer; ASSOCIATED WITH alcohol dependence; cocaine dependence; heroin dependence | | | | Rat | 17 | name , description | gene, allele |
| 629006643 | Per1em1Smoc | period circadian regulator 1; CRISPR/Cas9 induced mutant 1,Smoc | CRISPR/Cas9 system was used to generate a deletion of the CRE site (Del_TGACGTCA) in the Per1 gene promoter in Sprague Dawley (Charles River) rat embryos. | | | | Rat | | name | gene, allele |
| 12790714 | Rag2em1Mcwi | recombination activating 2;mutant 1, Medical College of Wisconsin | The mutant allele is a 8-bp deletion in exon 2 of Rag2 gene. | | | | Rat | | name , description | gene, allele |
| 626419687 | Tmem130em1Taoki | transmembrane protein 130; endonuclease induced mutant 1, Taoki | This allele was generated with CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. Guide RNA gRNA No1: GACCATCAGTAGTAAGACTA gRNA No2: GATTTCCAGGTACTCGGGACG | | | | Rat | | name | gene, allele |
| 13432064 | Ugt1a1j | UDP glucuronosyltransferase family 1 member A1, jaundice mutant | ASSOCIATED WITH abnormal renal water reabsorption; decreased mean corpuscular volume; decreased urine osmolality; ASSOCIATED WITH bilirubin metabolic disorder; Jaundice; Polyuria | | | | Rat | 13 | name , description | gene, allele |
| 155631262 | Brca1em1Kyo | BRCA1, DNA repair associated; CRISPR/Cas9 induced mutation 1,Kyo | CRISPR/Cas9 system was used to generate c.188T>A (p.L63X) mutation on exon 4 of rat Brca1. | | | | Rat | | name , description | gene, allele |
| 13825144 | Gja5em1Mcwi | gap junction protein, alpha 5; CRISPR/Cas9 induced mutant1, Mcwi | CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos. | | | | Rat | | name | gene, allele |
| 41410882 | Grm2em1 | glutamate metabotropic receptor 2; endonuclease induced mutant 1 | ASSOCIATED WITH abnormal behavioral response to addictive substance; abnormal behavioral response to morphine; abnormal behavioral withdrawal response; ASSOCIATED WITH Cocaine-Related Disorders; heroin dependence | | | | Rat | 21 | name , description | gene, allele |
| 1311802 | Nudt18 | nudix hydrolase 18 | ENCODES a protein that exhibits 8-hydroxy-dADP phosphatase activity (ortholog); 8-oxo-dGDP phosphatase activity (ortholog); 8-oxo-GDP phosphatase activity (ortholog); INVOLVED IN dADP catabolic process (ortholog); dGDP catabolic process (ortholog); GDP catabolic process (ortholog); FOUND IN Golgi ap paratus (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; alpha-Zearalanol | 15 | 52060297 | 52062822 | Rat | 95 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 13825148 | Per1em3Mcwi | period circadian regulator 1; CRISPR/Cas9 induced mutant 3, Mcwi | CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. | | | | Rat | | name | gene, allele |
| 39457948 | Vwfem1Mcwi | von Willebrand factor; CRISPR/Cas9 system induced mutant 1, Mcwi | CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon in the Sprague Dawley embryos . | | | | Rat | | name | gene, allele |
| 18182945 | Vwfem2Mcwi | von Willebrand factor; CRISPR/Cas9 system induced mutant 2, Mcwi | CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos | | | | Rat | | name | gene, allele |
| 18182947 | Vwfem3Mcwi | von Willebrand factor; CRISPR/Cas9 system induced mutant 3, Mcwi | CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos | | | | Rat | | name | gene, allele |
| 150429599 | Vwfem4Mcwi | von Willebrand factor; CRISPR/Cas9 system induced mutant 4, Mcwi | The deletion allele was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting mutation is a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. | | | | Rat | | name , description | gene, allele |
| 158013767 | Akt1em1Soar | AKT serine/threonine kinase 1; CRISPR/Cas9 induced mutant 1, Soar | ASSOCIATED WITH decreased fetal weight; decreased placenta weight; decreased placental labyrinth size | | | | Rat | 3 | name , description | gene, allele |
| 150519906 | Gfapem2Mes | glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 2,Mes | CRISPR/Cas9 mediated single nucleotide deletion resulting in a frameshift that creates a premature stop and generates a null allele. | | | | Rat | | name | gene, allele |
| 13800560 | Hsd11b2em1Jmul | hydroxysteroid 11-beta dehydrogenase 2; ZFN induced mutant1, Jmul | ASSOCIATED WITH abnormal adrenal gland zona glomerulosa morphology; abnormal adrenal gland zona reticularis morphology; abnormal adrenal medulla morphology; ASSOCIATED WITH hypertension | | | | Rat | 15 | name | gene, allele |
| 13628732 | Il2rgem7Kyo | interleukin 2 receptor subunit gamma; TALEN induced mutant 7, Kyo | This mutant allele has a 7 bp deletion in the 2nd exon of the rat Il2rg gene created by TALEN. | | | | Rat | | name , description | gene, allele |
| 41404647 | Lrp5em1Vari | LDL receptor related protein 5;CRISPR/Cas9 induced mutant 1, Vari | ASSOCIATED WITH abnormal femur morphology; abnormal retina blood vessel morphology; abnormal retina blood vessel pattern | | | | Rat | 7 | name | gene, allele |
| 14394610 | Sh2b3tm1Mcwi | SH2B adaptor protein 3; CRISPR/Cas9 induced target mutant 1, Mcwi | CRISPR/Cas9 and two ssODNs (single-stranded oligodeoxynucleotide) were used to insert loxP sites flanking multiple exons | | | | Rat | | name | gene, allele |
| 728295 | Cyp11b2m1 | cytochrome P450, family 11, subfamily b, polypeptide 2; mutation 1 | nucleotide 752 (G) in exon 4 of Milan hypertensive (MHS) differs from that of normotensive (MNS) rats (A) | | | | Rat | | name | gene, allele |
| 14696714 | Htr7em1Geh | 5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Geh | CRISPR/Cas9 system was used to generate this mutation in Wistar (CRL:WI) embryos; this editing induced 89 base pair deletion in exon 1 of the Htr7 gene. | | | | Rat | | name , description | gene, allele |
| 14696716 | Htr7em1Msu | 5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Msu | ASSOCIATED WITH decreased circulating alkaline phosphatase level; decreased circulating cholesterol level; decreased circulating triglyceride level | | | | Rat | 4 | name , description | gene, allele |
| 41404650 | Lrp5em2Vari | LDL receptor related protein 5; CRISPR/Cas9 induced mutant 2, Vari | ASSOCIATED WITH abnormal femur morphology; abnormal retina blood vessel morphology; abnormal retina blood vessel pattern | | | | Rat | 6 | name | gene, allele |
| 41404652 | Lrp5em3Vari | LDL receptor related protein 5; CRISPR/Cas9 induced mutant 3, Vari | ASSOCIATED WITH abnormal femur morphology; abnormal retina blood vessel morphology; abnormal retina blood vessel pattern | | | | Rat | 7 | name | gene, allele |
| 13800841 | Mybphlem1Mcwi | myosin binding protein H-like; CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. | | | | Rat | | name | gene, allele |
| 13800846 | Mybphlem2Mcwi | myosin binding protein H-like; CRISPR/Cas9 induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. | | | | Rat | | name | gene, allele |
| 401795483 | Nanos3em1(tdTomato)Nips | nanos C2HC-type zinc finger 3; CRISPR/Cas9 induced mutant 1, Nips | The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. A fter incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. | | | | Rat | | name | gene, allele |
| 150521709 | Tbc1d1Tn(sb)1Fkh | TBC1 domain family member 1; Sleeping Beauty induced mutant 1, Fkh | ASSOCIATED WITH abnormal carbohydrate metabolism; abnormal endocrine pancreas physiology; abnormal respiratory function | | | | Rat | 16 | name , description | gene, allele |
| 38596330 | Tbc1d4em1 | TBC1 domain family, member 4; CRISPR/Cas9 system induced mutant 1, | ASSOCIATED WITH impaired glucose tolerance; insulin resistance | | | | Rat | 4 | name | gene, allele |
| 626419670 | Cdkl5em1Sidb | cyclin-dependent kinase-like 5; endonuclease induced mutant 1, Sidb | The CRISPR/Cas9 technology was used in Long Evans (LE) embryos to introduce a 10bp deletion in exon 8 of the Cdkl5 gene (Ensembl coordinates X:35,674,763–35,674,772, in the Rnor_6.0 genome assembly) which results in the introduction of an early stop codon in constitutive exon 9, leading to lack of C DKL5 protein expression. | | | | Rat | | name | gene, allele |
| 25330101 | Cntnap2em1Mcwi | contactin associated protein 2; CRISPR/Cas9 induced mutant 1, Mcwi | The CRISPR/Cas9 was used to introduce a 1-bp deletion in exon 6 of rat Cntnap2 gene. | | | | Rat | | name | gene, allele |
| 329969888 | Col4a5em1Matsu | collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 1, Matsu | ASSOCIATED WITH decreased body weight; decreased creatinine clearance; increased blood urea nitrogen level; ASSOCIATED WITH Hematuria; proteinuria | | | | Rat | 8 | name , description | gene, allele |
| 329969892 | Col4a5em2Matsu | collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 2, Matsu | ASSOCIATED WITH premature death; ASSOCIATED WITH proteinuria | | | | Rat | 2 | name , description | gene, allele |
| 329969893 | Col4a5em3Matsu | collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 3, Matsu | ASSOCIATED WITH premature death; ASSOCIATED WITH proteinuria | | | | Rat | 2 | name , description | gene, allele |
| 10045592 | Dmdem1Kykn | dystrophin; CRISPR/Cas9 system induced mutant 1, Keitaro Yamanouchi | ASSOCIATED WITH centrally nucleated skeletal muscle fibers; decreased body weight; decreased skeletal muscle fiber diameter; ASSOCIATED WITH Duchenne muscular dystrophy | | | | Rat | 8 | name | gene, allele |
| 626419681 | Gpr143em19Gosh | G protein-coupled receptor 143; endonuclease induced mutant 1, Gosh | This allele carries deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. | | | | Rat | | name | gene, allele |
| 617301244 | Slc5a9em1Mcwi | solute carrier family 5 member 9;CRISPR/Cas9 induced mutant 1, Mcwi | This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted. | | | | Rat | | name , description | gene, allele |
| 151664749 | Slc9a6 em1Moro | solute carrier family 9 member A6;CRISPR/Cas9 induced mutant1, Moro | ASSOCIATED WITH abnormal lysosome physiology; astrocytosis; axon degeneration | | | | Rat | 16 | name , description | gene, allele |
| 626469802 | Tfap2cem1Soar | transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar | Crispr/Cas9 mediated 308 bpy deletion within Exon 4 of the Tfap2c gene | | | | Rat | | name | gene, allele |
| 626469803 | Tfap2cem2Soar | transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 2, Soar | Crispr/Cas9 mediated insertion of loxp sites flanking Exon 4 of the Tfap2c gene | | | | Rat | | name | gene, allele |
| 11553856 | Vnn1em1Mcwi | vanin 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in Exon 3 of the Vnn1 gene | | | | Rat | | name , description | gene, allele |
| 11553853 | Vnn1em2Mcwi | vanin 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin | CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos. | | | | Rat | | name , description | gene, allele |
| 155598603 | Bmal1em1Mcwi | basic helix-loop-helix ARNT like 1;CRISPR/Cas9 induced mutant 1,Mcwi | ASSOCIATED WITH abnormal urine sodium level; decreased body weight; decreased food intake | | | | Rat | 7 | name | gene, allele |
| 626419684 | Col7a1em1Jtol | collagen type VII alpha 1 chain; endonuclease induced mutant 1, Jtol | ASSOCIATED WITH preweaning lethality, complete penetrance; ASSOCIATED WITH recessive dystrophic epidermolysis bullosa | | | | Rat | 2 | name | gene, allele |
| 628359038 | Epas1em1Soar | endothelial PAS domain protein 1; CRISPR/Cas9 induced mutant 1, Soar | Crispr/Cas9 mediated 34 bp deletion within Exon 2 of the Epas1 gene | | | | Rat | | name | gene, allele |
| 13800750 | Glp1rem1Mcwi | glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. | | | | Rat | | name | gene, allele |
| 14394489 | Glp1rem2Mcwi | glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. | | | | Rat | | name | gene, allele |
| 14394492 | Glp1rem3Mcwi | glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 3, Mcwi | CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. | | | | Rat | | name | gene, allele |
| 150520193 | Ldlrem1Dlli | low density lipoprotein receptor; CRISPR/Cas9 induced mutant 1, Dlli | ASSOCIATED WITH aortic atherosclerosis; familial hyperlipidemia; steatotic liver disease | | | | Rat | 3 | name , description | gene, allele |
| 11073608 | Mir29b1em1Mcwi | microRNA 29b-1; TALEN induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH decreased vasodilation | | | | Rat | 1 | name , description | gene, allele |
| 12904731 | Abcb11em1Sage | ATP binding cassette subfamily B member 11;ZFN induced mutant 1, Sage | This ZFN induced allele contains 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot. | | | | Rat | | name | gene, allele |
| 12904687 | Abcc2em1Sage | ATP binding cassette subfamily C member 2; ZFN induced mutant 1, Sage | ASSOCIATED WITH abnormal xenobiotic pharmacokinetics | | | | Rat | 1 | name | gene, allele |
| 38501087 | Bmpr2em1Ang | bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Ang | ASSOCIATED WITH vascular smooth muscle hypertrophy; ASSOCIATED WITH Vascular Remodeling | | | | Rat | 2 | name | gene, allele |
| 38599014 | Defb23em2MlitDefb26em2Mlit | defensin beta 23, defensin beta 26; CRISPR/Cas9 induced mutant2, Mlit | ASSOCIATED WITH decreased litter size; decreased sperm progressive motility; impaired sperm capacitation | | | | Rat | 4 | name , description | gene, allele |
| 149735330 | Kcnn2Trdk | potassium calcium-activated channel subfamily N member 2; Trdk mutant | ASSOCIATED WITH tremors; ASSOCIATED WITH essential tremor | | | | Rat | 2 | name , description | gene, allele |
| 12790663 | Mbem6Mcwi | myoglobin; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in exon 2 of the Mb gene. | | | | Rat | | name , description | gene, allele |
| 13800827 | Muc1em1Mcwi | mucin 1, cell surface associated; CRISPR/Cas9 induced mutant 1, Mcwi. | CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos. | | | | Rat | | name | gene, allele |
| 38596341 | Rarres2em1Msu | retinoic acid receptor responder 2; CRISPR/Cas9 induced mutant 1, Msu | ASSOCIATED WITH decreased circulating aspartate transaminase level; decreased heart rate; decreased mean systemic arterial blood pressure | | | | Rat | 21 | name | gene, allele |
| 6484518 | ROSA26em1(SB11)Mcwi | ROSA 26 ZFN-stimulated knockin mutant 1; Medical College of Wisconsin | this locus incorporates the Engrailed-2 mouse splice acceptor, a loxP site, the SB11 Sleeping Beauty transposase cDNA and SV40 polyadenylation signal to integrate the transgene by homologous recombination | | | | Rat | | name | gene, allele |
| 126790499 | Shank2em13Sage | SH3 and multiple ankyrin repeat domains 2; ZFN induced mutant13, Sage | ASSOCIATED WITH abnormal auditory brainstem response; abnormal hippocampal pyramidal neuron dendrite morphology; abnormal operant conditioning behavior; ASSOCIATED WITH autism spectrum disorder | | | | Rat | 13 | name , description | gene, allele |
| 617301245 | Slc5a10em1Mcwi | solute carrier family 5 member 10; CRISPR/Cas9 induced mutant 1, Mcwi | This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted. | | | | Rat | | name , description | gene, allele |
| 151665773 | Tfap2cem1(tdTomato)Nips | transcription factor AP-2 epsilon; CRISPR/Cas9 induced mutant 1, Nips | The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. Aft er incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells. | | | | Rat | | name | gene, allele |
| 12904058 | Abcb1aem1Sage | ATP binding cassette subfamily B member 1A; ZFN induced mutant 1, Sage | ASSOCIATED WITH abnormal xenobiotic pharmacokinetics | | | | Rat | 2 | name , description | gene, allele |
| 12907569 | Abcb1aem2Sage | ATP binding cassette subfamily B member 1A; ZFN induced mutant 2, Sage | ASSOCIATED WITH abnormal blood-brain barrier function; abnormal intestinal absorption | | | | Rat | 2 | name , description | gene, allele |
| 14981587 | Bmpr2em1Sage | bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Sage | ASSOCIATED WITH pulmonary hypertension | | | | Rat | 1 | name , description | gene, allele |
| 14981589 | Bmpr2em2Sage | bone morphogenetic protein receptor type 2; ZFN induced mutant 2, Sage | ASSOCIATED WITH pulmonary hypertension | | | | Rat | 1 | name , description | gene, allele |
| 13204831 | CitfhJjlo | citron rho-interacting serine/threonine kinase; flat head mutant, Jjlo | ASSOCIATED WITH binucleate; decreased forebrain size; flat head; ASSOCIATED WITH epilepsy; microcephaly | | | | Rat | 5 | name | gene, allele |
| 626419689 | Cybbem1Shmo | cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Shmo | A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. | | | | Rat | | name | gene, allele |
| 12792283 | Scn1am1Kyo | sodium voltage-gated channel alpha subunit 1; ENU induced mutant1, Kyo | ASSOCIATED WITH increased susceptibility to induction of seizure by inducing agent; ASSOCIATED WITH Febrile Seizures | | | | Rat | 2 | name , description | gene, allele |
| 12792284 | Scn1am2Kyo | sodium voltage-gated channel alpha subunit 1; ENU induced mutant2, Kyo | ASSOCIATED WITH increased susceptibility to induction of seizure by inducing agent; ASSOCIATED WITH Febrile Seizures | | | | Rat | 2 | name , description | gene, allele |
| 12907571 | Abcb1aem3Sage | ATP binding cassette subfamily B member 1A; ZFN induced mutant 3, Sage) | The ZFN-induced mutant allele contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot. | | | | Rat | | name , description | gene, allele |
| 127285598 | Abcc8em1Cgen | ATP binding cassette subfamily C member 8; TALEN induced mutant 1, Cgen | ASSOCIATED WITH decreased body weight; decreased fasting circulating glucose level; decreased insulin secretion | | | | Rat | 8 | name | gene, allele |
| 1578799 | Slc27a5m1Mcwi | solute carrier family 27 member 5; mutation 1, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); K196Stop is generated. | | | | Rat | | name , description | gene, allele |
| 150340624 | Zbtb16em1Ipcv | zinc finger and BTB domain containing 16; TALEN induced mutant 1, Ipcv | ASSOCIATED WITH cardiac interstitial fibrosis; decreased body weight; decreased circulating cholesterol level | | | | Rat | 10 | name , description | gene, allele |
| 126928147 | Cdkn1bem1Musc | cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 1, Musc | ASSOCIATED WITH abnormal mammary gland luminal epithelium morphology; cataract; increased body weight; ASSOCIATED WITH cataract; infertility | | | | Rat | 16 | name | gene, allele |
| 126928151 | Cdkn1bem4Musc | cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 4, Musc | ASSOCIATED WITH abnormal mammary gland luminal epithelium morphology; cataract; increased body weight; ASSOCIATED WITH cataract; infertility | | | | Rat | 16 | name | gene, allele |
| 151347865 | Gper1em1Bj | G protein-coupled estrogen receptor 1; CRISPR/Cas 9 induced mutant 1, Bj | ASSOCIATED WITH abnormal free fatty acids level; decreased mean systemic arterial blood pressure; decreased pulse pressure; ASSOCIATED WITH Dysbiosis | | | | Rat | 9 | name | gene, allele |
| 13792799 | Nlrp3em2Mcwi | NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 2, Mcwi | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 14-bp deletion in exon 1 of the Nlrp3 gene. | | | | Rat | | name , description | gene, allele |
| 401795485 | Slc30a10em1Sommu | solute carrier family 30, member 10; CRISPR/Cas9 induced mutant 1, Sommu | Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion. | | | | Rat | | name , description | gene, allele |
| 150521600 | Tshrem1Mlit | thyroid stimulating hormone receptor; CRISPR/Cas9 induced mutant 1, Mlit | ASSOCIATED WITH decreased circulating thyroxine level; decreased circulating triiodothyronine level; increased circulating thyroid-stimulating hormone level; ASSOCIATED WITH congenital hypothyroidism; Congenital Nongoitrous Hypothyroidism; Dwarfism | | | | Rat | 8 | name , description | gene, allele |
| 127285662 | Adgrl3em1Huyc | adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc | ASSOCIATED WITH enhanced behavioral response to amphetamine; hyperactivity; increased startle reflex | | | | Rat | 4 | name | gene, allele |
| 728298 | Brca1m1Uwm | BRCA1, DNA repair associated; mutation 1, University of Wisconsin-Madison | produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon | | | | Rat | | name , description | gene, allele |
| 728326 | Brca2m1Uwm | BRCA2, DNA repair associated; mutation 1, University of Wisconsin-Madison | ASSOCIATED WITH abnormal mammary gland development; abnormal spermatogenesis; decreased body weight; ASSOCIATED WITH atrophy of testis; cancer; cataract | | | | Rat | 13 | name , description | gene, allele |
| 12798562 | Il2rgem1Hina | interleukin 2 receptor subunit gamma; endonuclease-induced mutant 1, Hina | This mutation was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat（Crlj:Wistar). | | | | Rat | | name , description | gene, allele |
| 5144089 | Ncf2em1Mcwi | neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1,Mcwi | ASSOCIATED WITH decreased NAD(P)H oxidase activity; decreased susceptibility to hypertension; salt-sensitive hypertension; ASSOCIATED WITH proteinuria; renal fibrosis | | | | Rat | 9 | name , description | gene, allele |
| 12790693 | Pon1em1Mcwi | paraoxonase 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene. | | | | Rat | | name , description | gene, allele |
| 12790696 | Pon1em2Mcwi | paraoxonase 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene. | | | | Rat | | name , description | gene, allele |
| 12790699 | Pon1em3Mcwi | paraoxonase 1; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. | | | | Rat | | name , description | gene, allele |
| 12790703 | Pon3em1Mcwi | paraoxonase 3; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene. | | | | Rat | | name , description | gene, allele |
| 11553854 | Shc1em1Mcwi | SHC adaptor protein 1; ZFN induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH increased vasoconstriction | | | | Rat | 1 | name , description | gene, allele |
| 11553903 | Shc1em3Mcwi | SHC adaptor protein 1; ZFN induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN system. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene. | | | | Rat | | name , description | gene, allele |
| 11553913 | Shc1em4Mcwi | SHC adaptor protein 1; ZFN induced mutant 4, Medical College of Wisconsin | ASSOCIATED WITH decreased urine albumin level; glomerulosclerosis; increased vasoconstriction; ASSOCIATED WITH Albuminuria; glomerulosclerosis | | | | Rat | 5 | name , description | gene, allele |
| 11553915 | Shc1em5Mcwi | SHC adaptor protein 1; ZFN induced mutant 5, Medical College of Wisconsin | ASSOCIATED WITH decreased tubuloglomerular feedback response; ASSOCIATED WITH Hypertensive Nephropathy | | | | Rat | 2 | name , description | gene, allele |
| 13437613 | Adamts16em1Bj | ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj | ASSOCIATED WITH decreased systemic arterial diastolic blood pressure; decreased systemic arterial systolic blood pressure; extended life span; ASSOCIATED WITH cryptorchidism; hypertension; male infertility | | | | Rat | 12 | name , description | gene, allele |
| 14985211 | Cyfip1em1Sage | cytoplasmic FMR1 interacting protein 1; CRISPR/Cas9 induced mutant 1, Sage | ASSOCIATED WITH abnormal brain white matter morphology; decreased myelin sheath thickness; decreased oligodendrocyte number | | | | Rat | 3 | name , description | gene, allele |
| 12910495 | Ifnar1em1 | interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1 | ASSOCIATED WITH decreased susceptibility to autoimmune diabetes; increased susceptibility to viral infection induced morbidity/mortality; insulitis; ASSOCIATED WITH Cardiovirus Infections; Experimental Diabetes Mellitus | | | | Rat | 5 | name , description | gene, allele |
| 12910496 | Ifnar1em2 | interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 2 | ASSOCIATED WITH decreased susceptibility to autoimmune diabetes; increased susceptibility to viral infection induced morbidity/mortality; insulitis; ASSOCIATED WITH Cardiovirus Infections; Experimental Diabetes Mellitus | | | | Rat | 5 | name , description | gene, allele |
| 12902626 | Nr1i2em1Sage | nuclear receptor subfamily 1, group I, member 2; ZFN induced mutant1, Sage | ASSOCIATED WITH abnormal enzyme/coenzyme level; increased body weight; increased thyroid gland weight | | | | Rat | 3 | name | gene, allele |
| 12903268 | Nr1i3em1Sage | nuclear receptor subfamily 1, group I, member 3; ZFN induced mutant 1,SAGE | ASSOCIATED WITH decreased body weight | | | | Rat | 1 | name | gene, allele |
| 4139863 | Renem1Mcwi | renin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH abnormal kidney morphology; decreased body weight; decreased circulating bicarbonate level | | | | Rat | 17 | name , description | gene, allele |
| 13838727 | Bscl2m1Kyo | BSCL2, seipin lipid droplet biogenesis associated; ENU induced mutant1, Kyo | ASSOCIATED WITH abnormal spatial working memory; decreased body weight; decreased brain weight; ASSOCIATED WITH azoospermia; Insulin Resistance | | | | Rat | 15 | name , description | gene, allele |
| 6484700 | Lepem5Mcwi | leptin; zinc finger nuclease induced mutant 5, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 118-130) | | | | Rat | | name , description | gene, allele |
| 127285617 | Ppargm1Kyo | peroxisome proliferator-activated receptor gamma; ENU induced mutant 1, Kyo | ASSOCIATED WITH abnormal fat cell differentiation; decreased epididymal fat pad weight; decreased total fat pad weight | | | | Rat | 9 | name , description | gene, allele |
| 401900752 | Prl7b1tm1(cre)Soar | prolactin family 7, subfamily B, member 1; CRISPR/Cas9 target mutant1, Soar | CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. | | | | Rat | | name | gene, allele |
| 626419667 | Syngap1em1Sidb | synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb | This allele carrying a 2bp deletion and 1bp insertion, leading to a frameshift mutation in exon 8 of Syngap1, which prevents expression of the protein. | | | | Rat | | name , description | gene, allele |
| 626419668 | Syngap1em2Sidb | synaptic Ras GTPase activating protein 1; endonucease induced mutant 2,Sidb | This allele created in LE embryos contains a 3,584-bp selective deletion and 3-bp insertion were confirmed by sequencing, which resulted in a mutant protein that was 377 amino acids smaller than endogenous SYNGAP1. | | | | Rat | | name , description | gene, allele |
| 6484709 | Lpin1em1Mcwi | lipin 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp deletion in exon 3 (del 719-722) | | | | Rat | | name , description | gene, allele |
| 11561896 | Lrapem1Geh | locus regulating alcohol preference; CRISPR/Cas9 system induced mutant 1,Geh | The CRISPR/Cas9 genome editing system was used to create a 618-bp deletion in rat Lrap (RGD:7734862) gene. | | | | Rat | | name | gene, allele |
| 151232284 | Prkdcem1Sage | protein kinase, DNA-activated, catalytic subunit; ZFN induced mutant 1, Sage | ASSOCIATED WITH decreased body weight; decreased cell death; decreased spleen weight; ASSOCIATED WITH Brain Hypoxia-Ischemia | | | | Rat | 5 | name , description | gene, allele |
| 401900751 | Prl7b1em1Soar | prolactin family 7, subfamily B, member 1; CRISPR/Cas9 induced mutant1, Soar | CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus | | | | Rat | | name | gene, allele |
| 12790722 | Serpinc1em2Mcwi | serpin family C member 1; ZFN induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH increased susceptibility to kidney reperfusion injury; ASSOCIATED WITH Kidney Reperfusion Injury | | | | Rat | 2 | name , description | gene, allele |
| 10054451 | Sirt3em4Mcwi | sirtuin 3; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Sirt3 gene | | | | Rat | | name | gene, allele |
| 401938654 | Ctnsem1Odev | cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 1, Odev | This allele was produced by targeting Ctns gene in Sprague Dawley rats (PolyGene AG, Zurich,Switzer-land). Two single guide RNAs (sgRNAs) targeting exon3 o fCtns were selected:CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG),CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp an d insertion of 8bp resulting in a premature stop codon in the exon3 of Ctns. | | | | Rat | | name | gene, allele |
| 151347606 | Ddah1em1Ywxu | dimethylarginine dimethylaminohydrolase 1; CRISPR/Cas9 induced mutant 1, Ywxu | ASSOCIATED WITH increased aorta wall thickness; increased heart right ventricle weight; increased right ventricle systolic pressure; ASSOCIATED WITH Pulmonary Arterial Hypertension | | | | Rat | 7 | name | gene, allele |
| 13799351 | F2rem1Mcwi | coagulation factor II (thrombin) receptor; CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos. | | | | Rat | | name | gene, allele |
| 12910095 | Prkdcem1Kyo | protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant1,Kyo | This ZFN induced mutant allele contains a 46-bp deletion in the exon1 of Prkdc gene. | | | | Rat | | name , description | gene, allele |
| 12910096 | Prkdcem2Kyo | protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant2,Kyo | This ZFN induced mutant allele contains a 227-bp deletion in the exon1 of Prkdc gene. | | | | Rat | | name , description | gene, allele |
| 12910098 | Prkdcem4Kyo | protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant4,Kyo | This ZFN induced mutant allele contains a 20-bp deletion in the exon1 of Prkdc gene. | | | | Rat | | name , description | gene, allele |
| 150429827 | Scn9a*tm1Amgn | sodium voltage-gated channel alpha subunit 9;ZFN induced target mutant1, Amgn | ASSOCIATED WITH abnormal afterhyperpolarization; abnormal pain threshold; decreased susceptibility to induced hypothermia | | | | Rat | 6 | name | gene, allele |
| 10054448 | Sirt3em25Mcwi | sirtuin 3; CRISPR/Cas9 system induced mutant 25, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 13-bp deletion in the Sirt3 gene;(RGSC 5.0/rn5) deleted region: chr1:220,552,421-220,552,433 | | | | Rat | | name | gene, allele |
| 10054457 | Sirt3em30Mcwi | sirtuin 3; CRISPR/Cas9 system induced mutant 30, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion of exon 3 in the Sirt3 gene | | | | Rat | | name | gene, allele |
| 10054454 | Sirt3em35Mcwi | sirtuin 3; CRISPR/Cas9 system induced mutant 35, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene | | | | Rat | | name | gene, allele |
| 617212699 | Abca4em1Tuckr | ATP binding cassette subfamily A member 4; CRISPR/Cas9 induced mutant 1, Tuckr | This is an Abca4 knockout mutant allele induced by CRISPR/Cas9 targeted at exon 2 to exon 8 of rat Abca4 gene. | | | | Rat | | name , description | gene, allele |
| 14392814 | Cftrem1Sage | cystic fibrosis transmembrane conductance regulator; ZFN induced mutant 1 Sage | ASSOCIATED WITH abnormal chloride level; abnormal circulating protein level; abnormal epiphyseal plate morphology; ASSOCIATED WITH congenital bilateral absence of vas deferens; cystic fibrosis | | | | Rat | 20 | name | gene, allele |
| 14402420 | Chrna5em18Pas | cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 18,Pas | ASSOCIATED WITH abnormal reinstatement of an extinguished operant behavior for a cocaine reinforcer; impaired behavioral response to nicotine | | | | Rat | 2 | name | gene, allele |
| 14402422 | Chrna5em20(D398N)Pas | cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 20,Pas | ASSOCIATED WITH abnormal acquisiton of operant behavior for a cocaine reinforcer; high preference for an addictive substance; increased alcohol consumption | | | | Rat | 3 | name , description | gene, allele |
| 155630632 | Ctnsem2Vjupk | cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 2, Vjupk | This 2-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. | | | | Rat | | name , description | gene, allele |
| 155630634 | Ctnsem3Vjupk | cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 3, Vjupk | This 8-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. | | | | Rat | | name , description | gene, allele |
| 155630636 | Ctnsem4Vjupk | cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 4, Vjupk | This 7-bp deletion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein. | | | | Rat | | name , description | gene, allele |
| 5143964 | Mstnem1Mcwi | myostatin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH increased body weight; increased skeletal muscle fiber size; increased skeletal muscle mass | | | | Rat | 3 | name , description | gene, allele |
| 5131949 | Mstnem2Mcwi | myostatin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 2 (del 381-398). | | | | Rat | | name , description | gene, allele |
| 5131962 | Mstnem3Mcwi | myostatin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 381-388). | | | | Rat | | name , description | gene, allele |
| 41408340 | PcloTn(sb-B-Geo)Fkh | presynaptic cytomatrix protein; sleeping beauty transposon induced mutant, Fkh | ASSOCIATED WITH abnormal cerebellar glomerulus morphology; abnormal synaptic vesicle number; abnormal synaptic vesicle recycling | | | | Rat | 11 | name , description | gene, allele |
| 5687695 | Pdcem2Mcwi | phosducin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 5 (del 489-502) | | | | Rat | | name , description | gene, allele |
| 5687712 | Pdcem3Mcwi | phosducin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a net 47-bp deletion in exon 5 (del 450-501, ins. Catcg) | | | | Rat | | name , description | gene, allele |
| 11553893 | Tpcn2em1Mcwi | two pore segment channel 2; ZFN induced mutant 5, Medical College of Wisconsin | This allele was made by ZFN system. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene. | | | | Rat | | old_gene_name , name , description | gene, allele |
| 5687697 | Umodem1Mcwi | uromodulin zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 104-bp frameshift deletion in exon 2 (del 294-397) | | | | Rat | | name , description | gene, allele |
| 12904064 | Abcg2em1Sage | ATP-binding cassette, subfamily G (WHITE), member 2; ZFN induced mutant 1, Sage | ASSOCIATED WITH abnormal xenobiotic pharmacokinetics | | | | Rat | 1 | name , description | gene, allele |
| 1593265 | Atm | ATM serine/threonine kinase | ENCODES a protein that exhibits 1-phosphatidylinositol-3-kinase activity (ortholog); DNA-dependent protein kinase activity (ortholog); histone H2AXS139 kinase activity (ortholog); INVOLVED IN cellular response to ionizing radiation; DNA damage response; positive regulation of DNA catabolic process; PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; homologous recombination pathway of double-strand break repair; nuclear factor kappa B signaling pathway; ASSOCIATED WITH abnormal microglial cell activation; abnormal microglial cell morphology; abnormal ovarian folliculogenesis; ASSOCIATED WITH Acute Liver Failure; ataxia telangiectasia; disease of cellular proliferation; FOUND IN centrosome (ortholog); chromosome, telomeric region (ortholog); cytoplasm (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2-amino-2-deoxy-D-galactopyranose | 8 | 62724939 | 62829040 | Rat | 1022 | old_gene_name , description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 150521554 | Cntrobhd | centrobin, centriole duplication and spindle assembly protein; hypodacty mutant | ASSOCIATED WITH oligodactyly; ASSOCIATED WITH male infertility; male infertility due to acephalic spermatozoa | | | | Rat | 3 | name , description | gene, allele |
| 5687708 | Cst3em1Mcwi | cystatin C; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 18-bp deletion in exon 1 (del 228-245) | | | | Rat | | name , description | gene, allele |
| 5687738 | Cst3em3Mcwi | cystatin C; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 1 (ins t at position 234) | | | | Rat | | name , description | gene, allele |
| 150429708 | Cyp2c11em1Nju | cytochrome P450, subfamily 2, polypeptide 11; CRISPR/Cas9 induced mutant 1, Nju | ASSOCIATED WITH abnormal xenobiotic pharmacokinetics; decreased litter size; delayed fertility | | | | Rat | 4 | name , description | gene, allele |
| 13782352 | Kcnj1em1Kasu | potassium voltage-gated channel subfamily J member 1; ZFN induced mutant 1,Kasu | ASSOCIATED WITH decreased body weight; decreased circulating bicarbonate level; decreased susceptibility to hypertension | | | | Rat | 9 | name , description | gene, allele |
| 1561988 | Mcc | MCC regulator of WNT signaling pathway | ENCODES a protein that exhibits calcium ion binding (inferred); metal ion binding (inferred); INVOLVED IN establishment of protein localization (ortholog); negative regulation of canonical Wnt signaling pathway (ortholog); negative regulation of epithelial cell migration (ortholog); ASSOCIATED WITH autistic disorder (ortholog); colon carcinoma (ortholog); colorectal cancer (ortholog); FOUND IN cytoplasm (ortholog); cytosol (ortholog); nucleoplasm (ortholog); INTERACTS WITH (+)-schisandrin B; 1,2-dimethylhydrazine; 17beta-estradiol | 18 | 37042350 | 37517114 | Rat | 138 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 13204758 | Pappa2em4Mcwi | pappalysin 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin | CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2. | | | | Rat | | name | gene, allele |
| 13204789 | Pappa2em5Mcwi | pappalysin 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin | CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2. | | | | Rat | | name | gene, allele |
| 12738366 | Rag2em2Mcwi | recombination activating 2;TALEN induced mutant 2, Medical College of Wisconsin | The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 2-bp (GA) deletion in the exon2 of Rag2 gene | | | | Rat | | name , description | gene, allele |
| 12790711 | Rag2em3Mcwi | recombination activating 2;TALEN induced mutant 3, Medical College of Wisconsin | The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 10-bp deletion in the exon2 of Rag2 gene | | | | Rat | | name , description | gene, allele |
| 12790606 | Cd14em1Mcwi | CD14 molecule; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the exon 2 of rat Cd14 gene | | | | Rat | | name , description | gene, allele |
| 12790611 | Cd14em2Mcwi | CD14 molecule; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a net 7-bp deletion in the rat Cd14 gene. | | | | Rat | | name , description | gene, allele |
| 5131919 | Cdh13em1Mcwi | cadherin 13; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH abnormal cue-induced reinstatement of an extinguished operant behavior for a cocaine reinforcer; saccharin preference; ASSOCIATED WITH substance-related disorder | | | | Rat | 3 | name , description | gene, allele |
| 11553857 | Rbm20em5Mcwi | RNA binding motif protein 20; ZFN induced mutant 5, Medical College of Wisconsin | This allele was made by ZFN system. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene | | | | Rat | | name , description | gene, allele |
| 11553882 | Rbm20em8Mcwi | RNA binding motif protein 20; ZFN induced mutant 8, Medical College of Wisconsin | This allele was made by ZFN system. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene. | | | | Rat | | name , description | gene, allele |
| 25394531 | Scn2aem1Mcwi | sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 1, Mcwi | The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTT GGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). | | | | Rat | | name , description | gene, allele |
| 25394533 | Scn2aem2Mcwi | sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 2, Mcwi | The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 4-bp deletion in exon 5 of the gene. | | | | Rat | | name , description | gene, allele |
| 12904681 | Cyp2j4em1Sage | cytochrome P450, family 2, subfamily j, polypeptide 4, ZFN induced mutant 1, Sage | ASSOCIATED WITH abnormal extracellular matrix morphology; abnormal tumor necrosis factor level; increased body weight; ASSOCIATED WITH nephritis; ureteral obstruction | | | | Rat | 12 | name , description | gene, allele |
| 10002785 | Krt71m1Yuyi | keratin 71, type II; mutation 1, Laboratory Animal Center of Zhengzhou University | a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate. | | | | Rat | | name | gene, allele |
| 11553880 | Rbm20em10Mcwi | RNA binding motif protein 20; ZFN induced mutant 10, Medical College of Wisconsin | This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene. | | | | Rat | | name , description | gene, allele |
| 155900756 | Chrna6em1Slot | cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 1, Slot | Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous GG nucleotide modificat ion at position 123 within the CHRNA6 gene 3'UTR. | | | | Rat | | name | gene, allele |
| 155900759 | Chrna6em2Slot | cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 2, Slot | Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous CC nucleotide modificat ion at position 123 within the CHRNA6 gene 3'UTR. | | | | Rat | | name | gene, allele |
| 13800747 | F8em1Mcwi | coagulation factor VIII, procoagulant component; CRISPR/Cas9 induced mutant1, Mcwi | ASSOCIATED WITH abnormal hemostasis; hemarthrosis; increased bleeding time; ASSOCIATED WITH factor VIII deficiency; hemarthrosis | | | | Rat | 5 | name | gene, allele |
| 5131946 | Mas1em1Mcwi | MAS1 oncogene; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 601-610). | | | | Rat | | name , description | gene, allele |
| 5687703 | Cd247em1Mcwi | Cd247 molecule; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH absent alpha-beta T cells; decreased B cell number; decreased mean systemic arterial blood pressure | | | | Rat | 9 | name , description | gene, allele |
| 5687730 | Cd247em3Mcwi | Cd247 molecule; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 155-167) | | | | Rat | | name , description | gene, allele |
| 5687713 | Cd247em5Mcwi | Cd247 molecule; zinc finger nuclease induced mutant 5, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 159-166) | | | | Rat | | name , description | gene, allele |
| 10002790 | Fahem3Mcwi | fumarylacetoacetate hydrolase; TALEN induced mutant 3, Medical College of Wisconsin | This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 3 causing a predicted non-functional protein. | | | | Rat | | name | gene, allele |
| 12790633 | Il2rgem1Mcwi | interleukin 2 receptor, gamma; TALEN induced mutant 1, Medical College of Wisconsin | This allele was made by TALEN mutagensis. The resulting mutation is a 19-bp deletion in exon 2. | | | | Rat | | name , description | gene, allele |
| 10002792 | Il2rgem2Mcwi | interleukin 2 receptor, gamma; TALEN induced mutant 2, Medical College of Wisconsin | This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 2 causing a predicted non-functional protein. | | | | Rat | | name | gene, allele |
| 12790660 | Il2rgem3Mcwi | interleukin 2 receptor, gamma; TALEN induced mutant 3, Medical College of Wisconsin | This allele was made by TALEN mutagensis. The resulting mutation is a 2-bp deletion in exon 2. | | | | Rat | | name , description | gene, allele |
| 125097487 | Nr3c1em1Jhrmn | nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Jhrmn | ASSOCIATED WITH enhanced cued conditioning behavior; increased circulating corticosterone level; increased coping response; ASSOCIATED WITH depressive disorder | | | | Rat | 6 | name | gene, allele |
| 626419686 | Dop1avf | DOP1 leucine zipper like protein A;vacuole formation | This vacuole formation causing mutation (Dop1avf) in Dopey1(Dop1a) in VF/Kyo strain. | | | | Rat | | description | gene, allele |
| 6484701 | Leprem2Mcwi | leptin receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH abnormal glomerular filtration barrier morphology; glomerulosclerosis; impaired glucose tolerance; ASSOCIATED WITH chronic kidney disease; glucose intolerance; hypertension | | | | Rat | 22 | name , description | gene, allele |
| 5131428 | Nox4em1Mcwi | NADPH oxidase 4; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 7 (del 586-590). | | | | Rat | | name , description | gene, allele |
| 4139868 | Nox4em2Mcwi | NADPH oxidase 4; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH decreased mean systemic arterial blood pressure; decreased susceptibility to hypertension; decreased urine albumin level | | | | Rat | 7 | name , description | gene, allele |
| 621080 | Nudt1 | nudix hydrolase 1 | ENCODES a protein that exhibits 2-hydroxy-ATP hydrolase activity (ortholog); 2-hydroxy-dATP hydrolase activity (ortholog); 5'-(N(7)-methylguanosine 5'-triphospho)-[mRNA] hydrolase activity (ortholog); INVOLVED IN male gonad development; response to cadmium ion; DNA protection (ortholog); ASSOCIATED WITH Cadmium Poisoning; Experimental Mammary Neoplasms; hypertension; FOUND IN acrosomal vesicle; extracellular space; nuclear membrane; INTERACTS WITH ammonium chloride; bisphenol A; flavonoids | 12 | 19416411 | 19423448 | Rat | 171 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 5687722 | Stc1em2Mcwi | stanniocalcin 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 717-724) | | | | Rat | | name , description | gene, allele |
| 11565825 | Ttnem1Sage | Titin; zinc finger nuclease induced mutant 1,Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal cardiac muscle contractility; decreased cardiac muscle relaxation | | | | Rat | 2 | name | gene, allele |
| 11565827 | Ttnem2Sage | Titin; zinc finger nuclease induced mutant 2,Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal cardiac muscle contractility; decreased cardiac muscle relaxation; decreased cardiac stroke volume | | | | Rat | 5 | name | gene, allele |
| 5131918 | Apoeem7Mcwi | apolipoprotein E; zinc finger nuclease induced mutant 7, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 15-bp frameshift deletion in exon 2 (del 161-175). | | | | Rat | | name , description | gene, allele |
| 5131915 | Apoeem8Mcwi | apolipoprotein E; zinc finger nuclease induced mutant 8, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 24-bp frameshift deletion in exon 2 (del 148-171). | | | | Rat | | name , description | gene, allele |
| 7364878 | Apoeem9Mcwi | apolipoprotein E; zinc finger nuclease induced mutant 9, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 (del 81879590-81879690). | | | | Rat | | name , description | gene, allele |
| 19259465 | Camk2n1em1Tja | calcium/calmodulin-dependent protein kinase II inhibitor 1; ZFN induced mutant 1, Tja | INVOLVED IN positive regulation of insulin secretion involved in cellular response to glucose stimulus; positive regulation of systemic arterial blood pressure; ASSOCIATED WITH decreased brown adipose tissue mass; decreased epididymal fat pad weight; decreased heart left ventricle weight | | | | Rat | 9 | name , description | gene, allele |
| 13464319 | Hcn1A354V | hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; A354V mutant | ASSOCIATED WITH Tremor | | | | Rat | 1 | name , description | gene, allele |
| 11553876 | P2rx1em1Mcwi | purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene. | | | | Rat | | name , description | gene, allele |
| 12790677 | P2rx1em6Mcwi | purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene. | | | | Rat | | name , description | gene, allele |
| 12790680 | P2rx7em8Mcwi | purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. | | | | Rat | | name , description | gene, allele |
| 1308340 | Pwwp3a | PWWP domain containing 3A, DNA repair factor | ENCODES a protein that exhibits nucleosome binding (ortholog); INVOLVED IN chromatin organization (ortholog); DNA repair (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; FOUND IN nucleoplasm (ortholog); nucleus (ortholog); INTER ACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene; acrylamide | 7 | 10115865 | 10132696 | Rat | 107 | old_gene_name , description | gene, protein-coding, VALIDATED [RefSeq] |
| 11553895 | Spp1em1Mcwi | secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. | | | | Rat | | name , description | gene, allele |
| 626469801 | Taf7lem1Soar | TATA-box binding protein associated factor 7-like; CRISPR/Cas9 induced mutant 1, Soar | Crispr/Cas9 mediated 110 bp deletion targeting Exon 3 of the Taf7l gene | | | | Rat | | name | gene, allele |
| 11553885 | Tp53em3Mcwi | tumor protein p53;zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN system. The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene. | | | | Rat | | name , description | gene, allele |
| 3618 | Vps52 | VPS52 subunit of GARP complex | ENCODES a protein that exhibits syntaxin binding (ortholog); INVOLVED IN ectodermal cell differentiation (ortholog); embryonic ectodermal digestive tract development (ortholog); endocytic recycling (ortholog); ASSOCIATED WITH Prostatic Neoplasms (ortholog); FOUND IN EARP complex (ortholog); GARP com plex (ortholog); Golgi apparatus (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 20 | 4922599 | 4933458 | Rat | 100 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 151660342 | Cftrem1Apb | cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Apb | The CRISPR/Cas9 system was used to target exon 11 to create a deletion at codon F508 which was injected into Sprague-Dawley one-cell embryos. One rat had this allele that contained the desired homology-directed repair edited TTT deletion and was designated the Phe508del founder (c.1522_1524delTTT). | | | | Rat | | name | gene, allele |
| 598092489 | Cftrem1Wpick | cystic fibrosis transmembrane conductance regulator;CRISPR/Cas9 induced mutant 1,Wpick | A targeted 16 bp deletion was made in Exon 3 of the rat Cftr gene using CRISPR-Cas9 technology. | | | | Rat | | name | gene, allele |
| 151660343 | Cftrem2Apb | cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Apb | The CRISPR/Cas9 system was used to target exon 11 and create a deletion at codon F508, which was injected into Sprague-Dawley one-cell embryos . This allele with an 8-bp deletion upstream of the TTT site (c.1514_1521delATATCATC) was used to establish the KO strain. | | | | Rat | | name | gene, allele |
| 25330100 | Chd8em1Mcwi | chromodomain helicase DNA binding protein 8; CRISPR/Cas9 system induced mutant 1, Mcwi | This allele was made by CRISPR/Cas9 system. It introduced a 5-bp deletion in exon 3 of rat Chd8gene. | | | | Rat | | name | gene, allele |
| 38599016 | Eif2ak4em1 | eukaryotic translation initiation factor 2 alpha kinase 4; CRISPR/Cas9 induced mutant1 | The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4. | | | | Rat | | name | gene, allele |
| 5144077 | Itga9em1Mcwi | integrin, alpha 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor ( v3.4 del 123601499-123601585) | | | | Rat | | name , description | gene, allele |
| 7204135 | Rag1em1Ang | recombination activating gene 1; zinc finger nuclease induced mutant 1, Ignacio Anegon | ASSOCIATED WITH decreased B cell number; decreased bone marrow cell number; decreased CD4-positive, alpha-beta T cell number; ASSOCIATED WITH Immune Deficiency Disease; severe combined immunodeficiency | | | | Rat | 15 | name , description | gene, allele |
| 13800878 | C17h6orf52em2Mcwi | similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Mcwi | CRISPR/Cas9 editing excised one C nucleotide from position Chr17:23,767,016 and inserted eleven nucleotides resulting in a net insertion of 10 nucleotides in exon 2 of rat C17h6orf52. | | | | Rat | | name | gene, allele |
| 126925993 | Cftrem1Ang | cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Ang | ASSOCIATED WITH abnormal enamel development; abnormal olfactory epithelium physiology; decreased body weight; ASSOCIATED WITH cystic fibrosis; dental enamel hypoplasia | | | | Rat | 11 | name | gene, allele |
| 126925995 | Cftrem2Ang | cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Ang | ASSOCIATED WITH abnormal enamel development; abnormal olfactory epithelium physiology; absent vas deferens; ASSOCIATED WITH cystic fibrosis; dental enamel hypoplasia | | | | Rat | 12 | name | gene, allele |
| 5687740 | Clcn6em2Mcwi | chloride channel 6; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp frameshift deletion in exon 13 (del 1180-1194) | | | | Rat | | name , description | gene, allele |
| 408364974 | Cyp27b1em1Hfd | cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 1,Hfd | The CRISPR/Cas9 system was used to introduce a 82-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCTcagctgggcagtgactcggttctccggagtttatctgatatccctgggccctctacacctagcttcctggctgaactcttctGCAAAGGGGG KO: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCT--- GCA AAGGGGG | | | | Rat | | name | gene, allele |
| 408364975 | Cyp27b1em2Hfd | cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 2,Hfd | The CRISPR/Cas9 system was used to introduce a 29-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAgagtcttccatcgagtccaactgccttctCAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG KO: CTCGCCTCCA----- CAGCTGGGCAGTGACTCGGTTCTCCGGAGT TTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG | | | | Rat | | name | gene, allele |
| 10054395 | Glaem2Mcwi | galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH abnormal circulating cytokine level; abnormal glycosphingolipid level; abnormal lens fiber morphology; ASSOCIATED WITH Fabry disease; lysosomal storage disease; Pain | | | | Rat | 68 | name | gene, allele |
| 626419669 | Grin2aem1Sidb | glutamate ionotropic receptor NMDA type subunit 2A; endonuclease induced mutant 1, Sidb | This allele has a deletion of a 1065bp region spanning Grin2a exon 8 (which encodes key pore forming domains of GluN2A) in Long Evans (LE) embryos, generating a KO allele. | | | | Rat | | name | gene, allele |
| 10054243 | Adora1em3Mcwi | adenosine A1 receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Adora1 gene | | | | Rat | | name | gene, allele |
| 10054282 | Adora1em4Mcwi | adenosine A1 receptor; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 34-bp deletion in the Adora1 gene | | | | Rat | | name | gene, allele |
| 10054297 | Btg2em11Mcwi | BTG family, member 2; CRISPR/Cas9 system induced mutant 11, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Btg2 gene | | | | Rat | | name | gene, allele |
| 10054302 | Btg2em13Mcwi | BTG family, member 2; CRISPR/Cas9 system induced mutant 13, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the Btg2 gene | | | | Rat | | name | gene, allele |
| 12798564 | Btg2em21Mcwi | BTG family, member 2; CRISPR/Cas9 system induced mutant 21, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene | | | | Rat | | name , description | gene, allele |
| 12798565 | Btg2em24Mcwi | BTG family, member 2; CRISPR/Cas9 system induced mutant 24, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene. | | | | Rat | | name , description | gene, allele |
| 1561942 | Ccdc112 | coiled-coil domain containing 112 | FOUND IN centriolar satellite (ortholog); INTERACTS WITH (+)-schisandrin B; 3,4-methylenedioxymethamphetamine; 6-propyl-2-thiouracil | 18 | 41184769 | 41218958 | Rat | 57 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 126908015 | Kcnk3em1Ang | potassium two pore domain channel subfamily K member 3; CRISPR/Cas9 induced mutant1, Ang | ASSOCIATED WITH abnormal pulmonary collagen fibril morphology; decreased vasodilation; increased heart rate; ASSOCIATED WITH pulmonary hypertension | | | | Rat | 6 | name , description | gene, allele |
| 13800813 | Kcnq1em5Mcwi | potassium voltage-gated channel subfamily Q member 1; CRISPR/Cas9 induced mutant 5, Mcwi | CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos. | | | | Rat | | name , description | gene, allele |
| 9588549 | Nfe2l2em1Mcwi | nuclear factor, erythroid 2-like 2; TALEN induced mutant 1, Medical College of Wisconsin | INVOLVED IN positive regulation of gene expression; ASSOCIATED WITH abnormal vasodilation; decreased vasodilation | | | | Rat | 3 | name , description | gene, allele |
| 61995 | Pten | phosphatase and tensin homolog | ENCODES a protein that exhibits ionotropic glutamate receptor binding; PDZ domain binding; phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity; INVOLVED IN cellular response to ethanol; cellular response to insulin stimulus; cellular response to insulin-like growth factor stimulus; PARTI CIPATES IN altered phosphatidylinositol 3-kinase signaling pathway; altered phosphatidylinositol 3-kinase-Akt signaling pathway; endometrial cancer pathway; ASSOCIATED WITH acute myocardial infarction; Cardiomegaly; diabetes mellitus; FOUND IN dendritic spine; postsynaptic cytosol; postsynaptic membrane; INTERACTS WITH (+)-pilocarpine; (R)-noradrenaline; (S)-nicotine | 1 | 240043707 | 240110330 | Rat | 1126 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 5508327 | Wdr72em1Mcwi | WD repeat domain 72; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 3 and intron 3 (del 78900101 78900113) | | | | Rat | | name , description | gene, allele |
| 5131978 | Wdr72em2Mcwi | WD repeat domain 72; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 3 (del 329-336). | | | | Rat | | name , description | gene, allele |
| 10054285 | Adora2aem3Mcwi | adenosine A2a receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 98-bp deletion in the Adora2a gene | | | | Rat | | name | gene, allele |
| 10059571 | Adora2aem5Mcwi | adenosine A2a receptor; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene | | | | Rat | | name | gene, allele |
| 126925980 | Ercc6em1Cgen | ERCC excision repair 6, chromatin remodeling factor; CRISPR/Cas9 induced mutant 1, Cgen | ASSOCIATED WITH abnormal base-excision repair; abnormal cerebellar cortex morphology; astrocytosis; ASSOCIATED WITH Cockayne syndrome B | | | | Rat | 7 | name | gene, allele |
| 1312028 | Pgam5 | PGAM family member 5, mitochondrial serine/threonine protein phosphatase | ENCODES a protein that exhibits protein serine/threonine phosphatase activity (ortholog); INVOLVED IN necroptotic process (ortholog); negative regulation of cold-induced thermogenesis (ortholog); PARTICIPATES IN mitochondrial autophagy pathway; nuclear factor, erythroid 2 like 2 signaling pathway; F OUND IN mitochondrial membrane (ortholog); mitochondrion (ortholog); INTERACTS WITH (+)-schisandrin B; 2,4-dinitrotoluene; 3-chloropropane-1,2-diol | 12 | 52069023 | 52076131 | Rat | 103 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 40818254 | Rictorem4Mcwi | RPTOR independent companion of MTOR, complex 2; CRISPR/Cas9 system induced mutant 4, Mcwi | CRISPR/Cas9 system was injected to the SS/JrHsdMcwi embryo to introduce a 11-bp deletion in exon 19 of rat Rictor gene. | | | | Rat | | name | gene, allele |
| 13207495 | Cd55em4Mcwi | CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant4, Mcwi | CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. | | | | Rat | | name | gene, allele |
| 13207493 | Cd55em6Mcwi | CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant6, Mcwi | CRISPR/Cas9 system was used to introduce a 5-bp deletion and one C insertion, resulting in a net 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. | | | | Rat | | name | gene, allele |
| 14696725 | Cyp3a2em1Myliu | cytochrome P450, family 3, subfamily a, polypeptide 2; CRISPR/Cas9 induced mutant 1, Myliu | A 10-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a2 gene in the Sprague Dawley embryo | | | | Rat | | name | gene, allele |
| 5508345 | Dguokem1Mcwi | deoxyguanosine kinase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105) | | | | Rat | | name , description | gene, allele |
| 5508354 | Dguokem2Mcwi | deoxyguanosine kinase; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110) | | | | Rat | | name , description | gene, allele |
| 5508325 | Dguokem3Mcwi | deoxyguanosine kinase; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc) | | | | Rat | | name , description | gene, allele |
| 5508323 | Dguokem4Mcwi | deoxyguanosine kinase; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp frameshift deletion in exon 1 (del 78-86) | | | | Rat | | name , description | gene, allele |
| 11553872 | Fmr1em2Mcwi | FMRP translational regulator 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH abnormal spike wave discharge; hyperactivity; impaired short-term object recognition memory | | | | Rat | 10 | name , description | gene, allele |
| 11553874 | Fmr1em4Mcwi | FMRP translational regulator 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in exon 7 of the Fmr1 gene. | | | | Rat | | name , description | gene, allele |
| 6893413 | Nat8em4Mcwi | N-acetyltransferase 8; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 1 (del 46-52) | | | | Rat | | name , description | gene, allele |
| 5508324 | Nppbem2Mcwi | natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH cardiac hypertrophy; hypertension; increased urine protein level; ASSOCIATED WITH Hypertensive Nephropathy | | | | Rat | 5 | name , description | gene, allele |
| 5509979 | Nppbem4Mcwi | natriuretic peptide B; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2 (del 165062749 165062886) | | | | Rat | | name , description | gene, allele |
| 11568059 | Nrxn1em1 | neurexin 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal habituation to a new environment; decreased body weight; hyperactivity; ASSOCIATED WITH autism spectrum disorder | | | | Rat | 6 | name , description | gene, allele |
| 10059574 | Sik2em4Mcwi | salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene | | | | Rat | | name | gene, allele |
| 12790945 | Sik2em5Mcwi | salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp deletion in the genome and 1-bp (T) insertion in the deletion site, net 5-bp deletion in exon 4 of the Sik2 gene. | | | | Rat | | name , description | gene, allele |
| 5687729 | Adora2bem1Mcwi | adenosine A2B receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 114-bp deletion in exon 1 (del 141-254) | | | | Rat | | name , description | gene, allele |
| 5687698 | Adora2bem2Mcwi | adenosine A2B receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH decreased inflammatory response; increased body weight; increased circulating interleukin-6 level | | | | Rat | 6 | name , description | gene, allele |
| 10054308 | Casrem1Mcwi | calcium-sensing receptor; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (T) insertion in the Casr gene; (RGSC 5.0/rn5): chr11:70,329,456-70,329,457 | | | | Rat | | name , description | gene, allele |
| 11531096 | F8em1Sage | coagulation factor VIII, procoagulant component; zinc finger nuclease induced mutant1, Sage | ASSOCIATED WITH abnormal bone remodeling; abnormal hemostasis; decreased circulating serum albumin level; ASSOCIATED WITH factor VIII deficiency; hemarthrosis; Hemophilic Arthropathy | | | | Rat | 16 | old_gene_name , name , description | gene, allele |
| 14394503 | Klrb1aem1Mcwi | killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 1, Mcwi | CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. | | | | Rat | | name | gene, allele |
| 14394505 | Klrb1aem2Mcwi | killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos. | | | | Rat | | name | gene, allele |
| 10045594 | Nfe2l2em1Kyo | nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 1, Kyoto University | ASSOCIATED WITH abnormal incisor color; increased susceptibility to xenobiotic induced morbidity/mortality; small liver | | | | Rat | 3 | name | gene, allele |
| 10045598 | Nfe2l2em2Kyo | nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 2, Kyoto University | ASSOCIATED WITH abnormal incisor color; small liver | | | | Rat | 2 | name | gene, allele |
| 69223 | Sacm1l | SAC1 like phosphatidylinositide phosphatase | ENCODES a protein that exhibits phosphatase activity; phosphatidylinositol-3,5-bisphosphate phosphatase activity; phosphatidylinositol-3-phosphate phosphatase activity; INVOLVED IN neurotransmitter receptor transport to postsynaptic membrane; phosphatidylinositol dephosphorylation; exocytic insertio n of neurotransmitter receptor to postsynaptic membrane (ortholog); FOUND IN endoplasmic reticulum membrane; endoplasmic reticulum-plasma membrane contact site; glutamatergic synapse; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; ammonium chloride; bisphenol A | 8 | 132053465 | 132109857 | Rat | 107 | old_gene_name | gene, protein-coding, REVIEWED [RefSeq] |
| 10002755 | Sbf1m1Ipcv | SET binding factor 1; mutation 1, Institute of Physiology, Czechoslovac Academy of Sciences | ASSOCIATED WITH arrest of spermiogenesis; azoospermia; decreased testis weight | | | | Rat | 4 | name | gene, allele |
| 4139858 | Sh2b3em1Mcwi | SH2B adaptor protein 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH decreased susceptibility to hypertension; decreased urine albumin level; increased regulatory T cell number; ASSOCIATED WITH Albuminuria; hypertension | | | | Rat | 5 | name , description | gene, allele |
| 5509982 | Sh2b3em2Mcwi | SH2B adaptor protein 3; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH decreased heart ventricle muscle contractility; increased lymphocyte cell number; increased monocyte cell number; ASSOCIATED WITH Myocardial Reperfusion Injury | | | | Rat | 5 | name , description | gene, allele |
| 10054277 | Gfapem1Ionsz | glial fibrillary acidic protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences | mutation induced by CRISPR/Cas9 system that added a 2A and EYFP behind the last exon of Gfap | | | | Rat | | description | gene, allele |
| 12743378 | Mmp9em4Mcwi | matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin | CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. | | | | Rat | | name , description | gene, allele |
| 10054415 | Mmp9em6Mcwi | matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin | ASSOCIATED WITH decreased circulating creatinine level; decreased urine albumin level; salt-sensitive hypertension | | | | Rat | 3 | name | gene, allele |
| 11568701 | Nlgn3em1Sage | neuroligin 3; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal brain wave pattern; abnormal non-rapid eye movement sleep pattern; abnormal paradoxical sleep pattern; ASSOCIATED WITH autism spectrum disorder | | | | Rat | 19 | name , description | gene, allele |
| 5131948 | Prokr1em1Mcwi | prokineticin receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 2 (del 748-758). | | | | Rat | | name , description | gene, allele |
| 5131947 | Prokr1em2Mcwi | prokineticin receptor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 126-bp frameshift deletion in exon 2 (del 636-761). | | | | Rat | | name , description | gene, allele |
| 11553907 | Trpc6em4Mcwi | transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. | | | | Rat | | old_gene_name , name , description | gene, allele |
| 6484702 | Aceem1Mcwi | angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 6. | | | | Rat | | name , description | gene, allele |
| 6484704 | Aceem2Mcwi | angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 6. | | | | Rat | | name , description | gene, allele |
| 5144099 | Asipem1Mcwi | agouti signaling protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 172-176) | | | | Rat | | name , description | gene, allele |
| 6484708 | Bcat1em2Mcwi | branched chain amino acid transaminase 1, cytosolic; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp deletion in exon 5 | | | | Rat | | name , description | gene, allele |
| 1310512 | Mpv17 | mitochondrial inner membrane protein MPV17 | ENCODES a protein that exhibits channel activity (ortholog); INVOLVED IN glomerular basement membrane development (ortholog); inner ear development (ortholog); reactive oxygen species metabolic process (ortholog); ASSOCIATED WITH autosomal recessive Alport syndrome (ortholog); Charcot-Marie-Tooth di sease type 2EE (ortholog); cochlear disease (ortholog); FOUND IN mitochondrial inner membrane (ortholog); mitochondrion (ortholog); peroxisome (ortholog); INTERACTS WITH atrazine; bisphenol A; paracetamol | 6 | 30941693 | 30956389 | Rat | 92 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 4139859 | Nckap5em1Mcwi | NCK-associated protein 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 1559-1568). | | | | Rat | | name , description | gene, allele |
| 4139862 | Nckap5em2Mcwi | NCK-associated protein 5; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 6 (del 1560-1563). | | | | Rat | | name , description | gene, allele |
| 4139861 | Nckap5em3Mcwi | NCK-associated protein 5; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568). | | | | Rat | | name , description | gene, allele |
| 5509975 | Nckap5em4Mcwi | NCK-associated protein 5; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568) | | | | Rat | | name , description | gene, allele |
| 5143954 | Plcd3em4Mcwi | phospholipase C, delta 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor (del 92275081-92275241) | | | | Rat | | name , description | gene, allele |
| 5143976 | Plcd3em7Mcwi | phospholipase C, delta 3; zinc finger nuclease induced mutant 7, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 142-bp deletion, overlapping the start codon (del 68-209) | | | | Rat | | name , description | gene, allele |
| 10054460 | Stk39em5Mcwi | serine threonine kinase 39; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene | | | | Rat | | name | gene, allele |
| 10054463 | Stk39em6Mcwi | serine threonine kinase 39; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Stk39 gene | | | | Rat | | name | gene, allele |
| 10402817 | Tph2em2Mcwi | tryptophan hydroxylase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1027-1036) | | | | Rat | | name | gene, allele |
| 10402820 | Tph2em3Mcwi | tryptophan hydroxylase 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 11-bp frameshift deletion in exon 7 (del 1027-1037) | | | | Rat | | name | gene, allele |
| 39456109 | Trpv4em1Sage | transient receptor potential cation channel, subfamily V, member 4; ZFN induced mutant1, Sage | This Trpv4 allele has a 899-bp deletion which completely removes exon 13, plus parts of intron 12-13 and intron 13-14 . | | | | Rat | | name | gene, allele |
| 12790620 | Cybbem1Mcwi | cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene. | | | | Rat | | name , description | gene, allele |
| 12790624 | Cybbem3Mcwi | cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene. | | | | Rat | | name , description | gene, allele |
| 1307252 | Manf | mesencephalic astrocyte-derived neurotrophic factor | ENCODES a protein that exhibits sulfatide binding (ortholog); INVOLVED IN ATF6-mediated unfolded protein response (ortholog); regulation of response to endoplasmic reticulum stress (ortholog); vasoconstriction of artery involved in ischemic response to lowering of systemic arterial blood pressure (o rtholog); ASSOCIATED WITH Reperfusion Injury; breast cancer (ortholog); Diabetes, Deafness, Developmental Delay, and Short Stature Syndrome (ortholog); FOUND IN extracellular space; perinuclear region of cytoplasm; endoplasmic reticulum (ortholog); INTERACTS WITH (+)-schisandrin B; 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine | 8 | 116427053 | 116430259 | Rat | 187 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 4139860 | Mmp2em1Mcwi | matrix metallopeptidase 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1434-1443). | | | | Rat | | name , description | gene, allele |
| 4139869 | Mmp2em2Mcwi | matrix metallopeptidase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH abnormal podocyte physiology; decreased circulating creatinine level; decreased kidney weight; ASSOCIATED WITH Diabetic Nephropathies; Hypertensive Nephropathy; proteinuria | | | | Rat | 12 | name , description | gene, allele |
| 11530022 | Npyem6Sage | neuropeptide Y; zinc finger nuclease induced mutant 6, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH alcohol preference; decreased body weight; increased alcohol consumption | | | | Rat | 3 | name , description | gene, allele |
| 10054434 | Pkd1em1Mcwi | polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Pkd1 gene | | | | Rat | | name | gene, allele |
| 10054428 | Pkd1em2Mcwi | polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene | | | | Rat | | name | gene, allele |
| 10054431 | Pkd1em3Mcwi | polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 12-bp deletion in the Pkd1 gene | | | | Rat | | name | gene, allele |
| 10054437 | Pkd1em6Mcwi | polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene | | | | Rat | | name | gene, allele |
| 12790718 | Rfwd2em1Mcwi | ring finger and WD repeat domain 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp insertion ( 7-bp insertion in the 1-bp deletion site) in exon 4. | | | | Rat | | name , description | gene, allele |
| 38676449 | Trpa1em1Kcrd | transient receptor potential cation channel, subfamily A, member 1; ZFN induced mutant 1, Kcrd | This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. | | | | Rat | | name | gene, allele |
| 13792702 | Trpv1em1Sage | transient receptor potential cation channel, subfamily V, member 1; ZFN induced mutant 1, Sage | ASSOCIATED WITH myocardial infarction | | | | Rat | 1 | name , description | gene, allele |
| 12790600 | Axlem1Mcwi | Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene | | | | Rat | | name , description | gene, allele |
| 12790605 | Axlem2Mcwi | Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene | | | | Rat | | name , description | gene, allele |
| 6484703 | Cacna1hem2Mcwi | calcium channel, voltage-dependent, T type, alpha 1H subunit; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 11. | | | | Rat | | name , description | gene, allele |
| 6484705 | Cubnem1Mcwi | cubilin (intrinsic factor-cobalamin receptor) ; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 14. | | | | Rat | | name , description | gene, allele |
| 6893412 | Fgf1em2Mcwi | fibroblast growth factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp deletion in exon 3 (del 442-451) | | | | Rat | | name , description | gene, allele |
| 5687720 | Fgf5em1Mcwi | fibroblast growth factor 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp deletion in exon 1 (del 314-345) | | | | Rat | | name , description | gene, allele |
| 5687727 | Fgf5em5Mcwi | fibroblast growth factor 5; zinc finger nuclease induced mutant 5, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp deletion in exon 1 (del 341-342) | | | | Rat | | name , description | gene, allele |
| 12790625 | Igh-6em1Mcwi | immunoglobulin heavy chain 6; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in exon 2 of the Igh-6 gene. | | | | Rat | | name , description | gene, allele |
| 12790630 | Igh-6em4Mcwi | immunoglobulin heavy chain 6; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in exon 2 of the Igh-6 gene. | | | | Rat | | name , description | gene, allele |
| 150519902 | Prkar1bem1Tua | protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 1, Tua | CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 2-bp frameshift insertion in exon2 creating a premature stop codon in the Prkar1b t ranscripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. | | | | Rat | | name , description | gene, allele |
| 150519903 | Prkar1bem2Tua | protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 2, Tua | ASSOCIATED WITH abnormal excitatory postsynaptic potential; decreased freezing behavior; increased thermal nociceptive threshold; ASSOCIATED WITH Tremor | | | | Rat | 6 | name , description | gene, allele |
| 5508341 | Pruneem1Mcwi | prune homolog (Drosophila); zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 198-bp deletion in the 5' URT and exon 1 (v3.4 del 190192348-190192545) | | | | Rat | | name , description | gene, allele |
| 5508348 | Pruneem3Mcwi | prune homolog (Drosophila); zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 130-bp frameshift deletion in exon 1 (del 237-268) | | | | Rat | | name , description | gene, allele |
| 11553859 | Scn5aem2Mcwi | sodium voltage-gated channel alpha subunit 5; ZFN induced mutant2, Medical College of Wisconsin | This allele was made by ZFN system. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene | | | | Rat | | name , description | gene, allele |
| 5509978 | Stk39em2Mcwi | serine threonine kinase 39; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 24-bp frameshift deletion in exon 7 (del 1232-1255) | | | | Rat | | name , description | gene, allele |
| 6893416 | Grm7em2Mcwi | glutamate receptor, metabotropic 7; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 3 (a) | | | | Rat | | name , description | gene, allele |
| 1565148 | Pwwp3b | PWWP domain containing 3B | ASSOCIATED WITH factor VIII deficiency (ortholog); INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 2,3,7,8-tetrachlorodibenzodioxine | X | 107593062 | 107627215 | Rat | 63 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1585131 | Pwwp4 | PWWP domain containing 4 | INTERACTS WITH perfluorohexanesulfonic acid (ortholog) | X | 156159344 | 156165457 | Rat | 1 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 10054442 | Rorcem3Mcwi | RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Rorc gene | | | | Rat | | name | gene, allele |
| 10054445 | Rorcem5Mcwi | RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 69-bp deletion in the genome and a 9-bp insertion at the deletion site, net 60-bp deletion in the Rorc gene. | | | | Rat | | name | gene, allele |
| 150521524 | Slco1b2em1Myliu | solute carrier organic anion transporter family member 1B2; CRISPR/Case9 induced mutant 1, Myliu | ASSOCIATED WITH abnormal xenobiotic pharmacokinetics; ASSOCIATED WITH Hereditary Hyperbilirubinemia | | | | Rat | 2 | name | gene, allele |
| 5687725 | Comtem1Mcwi | catechol-O-methyltransferase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 4 (del 639-652) | | | | Rat | | name , description | gene, allele |
| 5131930 | Cybaem1Mcwi | cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 36-bp frameshift deletion in exon 1 (del 54-89). | | | | Rat | | name , description | gene, allele |
| 25394527 | Dyrk1aem3Mcwi | dual specificity tyrosine phosphorylation regulated kinase 1A; CRISPR/Cas9 induced mutant 3, Mcwi | The mutated allele was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene. | | | | Rat | | name , description | gene, allele |
| 10047084 | Fusem1Ionsz | Fus RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences | mutation induced by CRISPR/Cas9 system in the Fus gene that made the 521th amino acid Arg into Cys | | | | Rat | | description | gene, allele |
| 5508342 | Ncf2em4Mcwi | neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2 (v3.4 del 67808926-67809069, ins atctt) | | | | Rat | | name , description | gene, allele |
| 10054274 | Vcpem1Ionsz | valosin-containing protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences | mutation induced by CRISPR/Cas9 system in the Vcp gene that made the 155th amino acid Arg into His | | | | Rat | | description | gene, allele |
| 10053596 | Foxn1em1Nips | forkhead box N1; CRISPR/Cas9 system induced mutant 1, National Institute for Physiological Sciences | ASSOCIATED WITH Thymus Hyperplasia | | | | Rat | 1 | name | gene, allele |
| 10053599 | Foxn1em2Nips | forkhead box N1; CRISPR/Cas9 system induced mutant 2, National Institute for Physiological Sciences | ASSOCIATED WITH Thymus Hyperplasia | | | | Rat | 1 | name | gene, allele |
| 5143957 | Gpr183em1Mcwi | G protein-coupled receptor 183; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 2 (del 550-556) | | | | Rat | | name , description | gene, allele |
| 5143955 | Gpr183em2Mcwi | G protein-coupled receptor 183; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 2 (del 567-570) | | | | Rat | | name , description | gene, allele |
| 5143961 | Gpr183em3Mcwi | G protein-coupled receptor 183; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 571-578) | | | | Rat | | name , description | gene, allele |
| 5144095 | Hexim2em4Mcwi | HEXIM P-TEFb complex subunit 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 3 (del 798-807) | | | | Rat | | name , description | gene, allele |
| 6893425 | Il1r1em1Mcwi | interleukin 1 receptor, type I; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 5 (del 441-453) | | | | Rat | | name , description | gene, allele |
| 6893414 | Il1r1em2Mcwi | interleukin 1 receptor, type I; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 (del 444-450) | | | | Rat | | name , description | gene, allele |
| 6893378 | Il1r1em3Mcwi | interleukin 1 receptor, type I; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5.(ins a) | | | | Rat | | name , description | gene, allele |
| 7241042 | Park7em1Sage | parkinson protein 7; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal gait; abnormal motor coordination/balance; abnormal muscle tone; ASSOCIATED WITH Parkinson's disease | | | | Rat | 9 | name , description | gene, allele |
| 12790955 | Tertem2Mcwi | telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Tert gene. | | | | Rat | | name , description | gene, allele |
| 11553847 | Trpv4em5Mcwi | transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant5, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene | | | | Rat | | old_gene_name , name , description | gene, allele |
| 2290121 | AbatTn(sb-T2/Bart3)2.163Mcwi | 4-aminobutyrate aminotransferase; transposon insertion 2.163, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene | | | | Rat | | description | gene, allele |
| 6893598 | Abcb1bem2Mcwi | ATP-binding cassette, subfamily B (MDR/TAP), member 1B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 98-bp frameshift deletion in exon 4 that includes the splice acceptor. | | | | Rat | | name , description | gene, allele |
| 10413843 | Abcc6em1Qlju | ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 1, Qiaoli Li | This allele was made by ZFN mutagenesis.ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deleti on from cDNA position 44-53 (CAGGCCTGAG). | | | | Rat | | name , description | gene, allele |
| 10413846 | Abcc6em2Qlju | ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li | ASSOCIATED WITH increased circulating phosphate level; ASSOCIATED WITH pseudoxanthoma elasticum | | | | Rat | 2 | name , description | gene, allele |
| 10413847 | Abcc6em3Qlju | ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 3, Qiaoli Li | ASSOCIATED WITH pseudoxanthoma elasticum | | | | Rat | 1 | name , description | gene, allele |
| 5131905 | Acad10em2Mcwi | acyl-Coenzyme A dehydrogenase family, member 10; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 2 (del 2040-2049). | | | | Rat | | name , description | gene, allele |
| 2314337 | AcoxlTn(sb-T2/Bart3)2.342Mcwi | acyl-Coenzyme A oxidase-like; transposon insertion 2.342, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene | | | | Rat | | description | gene, allele |
| 2299093 | AdaTn(sb-T2/Bart3)2.237Mcwi | adenosine deaminase; transposon insertion 2.237, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene | | | | Rat | | description | gene, allele |
| 2290129 | Adgrl3Tn(sb-T2/Bart3)2.151Mcwi | adhesion G protein-coupled receptor L3; transposon insertion 2.151, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 (formerly Lphn3) gene | | | | Rat | | description | gene, allele |
| 5687709 | Adipoqem1Mcwi | adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 186-232) | | | | Rat | | name , description | gene, allele |
| 5687716 | Adipoqem2Mcwi | adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 1 (del 226-229) | | | | Rat | | name , description | gene, allele |
| 5509986 | Adra2aem1Mcwi | adrenergic, alpha-2A-, receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 2 (del 514-520) | | | | Rat | | name , description | gene, allele |
| 2313461 | Agbl4Tn(sb-T2/Bart3)2.337Mcwi | ATP/GTP binding protein-like 4; transposon insertion 2.337, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene | | | | Rat | | description | gene, allele |
| 5508331 | Agtr1aem1Mcwi | angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp frameshift deletion in exon 3 (del 521-523) | | | | Rat | | name , description | gene, allele |
| 5508318 | Agtr1aem5Mcwi | angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 5, Medical College of Wisconsin | ASSOCIATED WITH decreased angiogenesis | | | | Rat | 1 | name , description | gene, allele |
| 5131907 | Aldh2em2Mcwi | aldehyde dehydrogenase 2 family (mitochondrial); zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 7-bp frameshift deletion in exon 4 (del 431-437). | | | | Rat | | name , description | gene, allele |
| 5131906 | Alms1em1Mcwi | Alstrom syndrome 1 homolog (human); zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH increased body weight; increased mean systemic arterial blood pressure; increased systemic arterial systolic blood pressure | | | | Rat | 6 | name , description | gene, allele |
| 11534996 | Anks6PKD | ankyrin repeat and sterile alpha motif domain containing 6, polycystic kidney disease | ASSOCIATED WITH decreased hematocrit; enlarged kidney; increased blood urea nitrogen level; ASSOCIATED WITH polycystic kidney disease; proteinuria; uremia | | | | Rat | 10 | description | gene, allele |
| 2303975 | Ano3Tn(sb-T2/Bart3)2.307Mcwi | anoctamin 3; transposon insertion 2.307, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene | | | | Rat | | description | gene, allele |
| 12880027 | Appem1Sage | amyloid beta precursor protein; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | Homozygous knockout rats exhibit complete loss of protein | | | | Rat | | name | gene, allele |
| 12790597 | Asic3em6Mcwi | acid sensing ion channel subunit 3; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene | | | | Rat | | name , description | gene, allele |
| 6484707 | Atp2b1em2Mcwi | ATPase, Ca++ transporting, plasma membrane 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 117-bp deletion in intron 8 and exon 9. | | | | Rat | | name , description | gene, allele |
| 11532742 | Atp7bhts | ATPase copper transporting beta; hepatitis | ASSOCIATED WITH abnormal renal tubule morphology; decreased body weight; decreased circulating copper level; ASSOCIATED WITH liver carcinoma; Liver Neoplasms; renal adenoma | | | | Rat | 18 | description | gene, allele |
| 1305796 | Atr | ATR checkpoint kinase | ENCODES a protein that exhibits histone H2AXS139 kinase activity (ortholog); MutLalpha complex binding (ortholog); MutSalpha complex binding (ortholog); INVOLVED IN response to arsenic-containing substance; response to xenob iotic stimulus; cellular response to gamma radiation (ortholog); PARTICIPATES IN p53 signaling pathway; ASSOCIATED WITH adenoid cystic carcinoma (ortholog); alpha thalassemia-X-linked intellectual disability syndrome (ortholog); Alzheimer's disease (ortholog); FOUND IN ATR-ATRIP complex (ortholog); chromosome (ortholog); extrinsic component of synaptic vesicle membrane (ortholog); INTERACTS WITH amphetamine; bisphenol A; cisplatin | 8 | 105306299 | 105403742 | Rat | 303 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 2314338 | Auts2Tn(sb-T2/Bart3)2.344Mcwi | autism susceptibility candidate 2; transposon insertion 2.344, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene. | | | | Rat | | description | gene, allele |
| 2290122 | AW527406Tn(sb-T2/Bart3)2.156Mcwi | EST AW527406; transposon insertion 2.156, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW527406 | | | | Rat | | description | gene, allele |
| 2306272 | AW915325Tn(sb-T2/Bart3)2.319Mcwi | EST AW915325; transposon insertion 2.319, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325 | | | | Rat | | description | gene, allele |
| 2299108 | AW921689Tn(sb-T2/Bart3)2.209Mcwi | EST AW921689; transposon insertion 2.209, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW921689 | | | | Rat | | description | gene, allele |
| 13782148 | Bace1em1Sage | | ASSOCIATED WITH abnormal motor coordination/balance; decreased locomotor activity; decreased myelin sheath thickness | | | | Rat | 7 | description | gene, allele |
| 1597089 | Baz1b | bromodomain adjacent to zinc finger domain, 1B | ENCODES a protein that exhibits histone binding (ortholog); histone H2AXY142 kinase activity (ortholog); INVOLVED IN chromatin organization (ortholog); chromatin remodeling (ortholog); DNA damage response (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ISWI family mediated chromatin remodeling pathway; ASSOCIATED WITH Williams-Beuren syndrome (ortholog); FOUND IN condensed chromosome (ortholog); nuclear replication fork (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 12 | 27068541 | 27126511 | Rat | 155 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2302640 | BbxTn(sb-T2/Bart3)2.291Mcwi | bobby sox homolog (Drosophila); transposon insertion 2.291, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. | | | | Rat | | description | gene, allele |
| 5508329 | Bcas3em4Mcwi | breast carcinoma amplified sequence 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 9 (del 648-654) | | | | Rat | | name , description | gene, allele |
| 2292448 | BE329202Tn(sb-T2/Bart3)2.198Mcwi | EST BE329202; transposon insertion 2.198, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BE329202 | | | | Rat | | description | gene, allele |
| 2290126 | BF522453Tn(sb-T2/Bart3)2.166Mcwi | EST BF522453; transposon insertion 2.166, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BF522453 | | | | Rat | | description | gene, allele |
| 2290072 | BI284934Tn(sb-T2/Bart3)2.185Mcwi | EST BI284934; transposon insertion 2.185, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI284934 | | | | Rat | | description | gene, allele |
| 2290120 | BI284938Tn(sb-T2/Bart3)2.155Mcwi | EST BI284938; transposon insertion 2.155, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI284938 | | | | Rat | | description | gene, allele |
| 2290074 | BI284938Tn(sb-T2/Bart3)2.187Mcwi | EST BI284938; transposon insertion 2.187, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI284938 | | | | Rat | | description | gene, allele |
| 2290115 | BI285110Tn(sb-T2/Bart3)2.167Mcwi | EST BI285110; transposon insertion 2.167, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI285110 | | | | Rat | | description | gene, allele |
| 2290062 | BI285226Tn(sb-T2/Bart3)2.193Mcwi | EST BI285226; transposon insertion 2.193, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI285226 | | | | Rat | | description | gene, allele |
| 2290069 | BI285226Tn(sb-T2/Bart3)2.194Mcwi | EST BI285226; transposon insertion 2.194, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI285226 | | | | Rat | | description | gene, allele |
| 2290070 | BQ195794Tn(sb-T2/Bart3)2.182Mcwi | EST BQ195794; transposon insertion 2.182, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BQ195794 | | | | Rat | | description | gene, allele |
| 2218 | Brca1 | BRCA1, DNA repair associated | ENCODES a protein that exhibits chromatin binding; damaged DNA binding (ortholog); enzyme binding (ortholog); INVOLVED IN positive regulation of protein import into nucleus; response to estradiol; response to genistein; PARTICIPATES IN ataxia telangiectasia-muta ted (ATM) signaling pathway; forkhead class A signaling pathway; homologous recombination pathway of double-strand break repair; ASSOCIATED WITH ductal carcinoma in situ; Experimental Mammary Neoplasms; adenoid cystic carcinoma (ortholog); FOUND IN mitochondrial matrix; BRCA1-A complex (ortholog); BRCA1-BARD1 complex (ortholog); INTERACTS WITH (+)-schisandrin B; 1-naphthyl isothiocyanate; 2,2',4,4'-Tetrabromodiphenyl ether | 10 | 86917693 | 86978012 | Rat | 1024 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1588543 | Brcc3 | BRCA1/BRCA2-containing complex subunit 3 | ENCODES a protein that exhibits enzyme regulator activity (ortholog); K63-linked deubiquitinase activity (ortholog); metal-dependent deubiquitinase activity (ortholog); INVOLVED IN cellular response to ionizing radiation (ortholog); chromatin remodeling (ortholog); DNA repair-dependent chromatin rem odeling (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; histone modification pathway; ASSOCIATED WITH Hereditary Neoplastic Syndromes (ortholog); Occupational Diseases (ortholog); Pregnancy in Diabetics (ortholog); FOUND IN BRCA1-A complex (ortholog); BRISC complex (ortholog); cytoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3H-1,2-dithiole-3-thione; acetamide | 9 | 2073927 | 2076469 | Rat | 152 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2290071 | Brinp3Tn(sb-T2/Bart3)2.189Mcwi | BMP/retinoic acid-inducible neural-specific protein 3; transposon insertion 2.189, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene. | | | | Rat | | description | gene, allele |
| 10450488 | Bsnem1Ionsz | bassoon (presynaptic cytomatrix protein); CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn | | | | Rat | | name , description | gene, allele |
| 2290087 | CA338503Tn(sb-T2/Bart3)2.168Mcwi | EST CA338503; transposon insertion 2.168, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST CA338503 | | | | Rat | | description | gene, allele |
| 2290094 | CA338503Tn(sb-T2/Bart3)2.175Mcwi | EST CA338503; transposon insertion 2.175, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST CA338503 | | | | Rat | | description | gene, allele |
| 2290059 | CA338503Tn(sb-T2/Bart3)2.196Mcwi | EST CA338503; transposon insertion 2.196, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST CA338503 | | | | Rat | | description | gene, allele |
| 11568704 | Cacna1cem1Sage | calcium voltage-gated channel subunit alpha1 C; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal social play behavior; abnormal vocalization; cognitive inflexibility | | | | Rat | 7 | name , description | gene, allele |
| 2299116 | Cadm1Tn(sb-T2/Bart3)2.229Mcwi | cell adhesion molecule 1; transposon insertion 2.229, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene. | | | | Rat | | description | gene, allele |
| 2290088 | Cadm2Tn(sb-T2/Bart3)2.180Mcwi | immunoglobulin superfamily, member 4 ; transposon insertion 2.180, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene. | | | | Rat | | description | gene, allele |
| 2302642 | Casp7Tn(sb-T2/Bart3)2.280Mcwi | caspase 7; transposon insertion 2.280, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. | | | | Rat | | description | gene, allele |
| 2290092 | CB706876Tn(sb-T2/Bart3)2.181Mcwi | EST CB706876; transposon insertion 2.181, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST CB706876 | | | | Rat | | description | gene, allele |
| 2299113 | Ccdc85aTn(sb-T2/Bart3)2.248Mcwi | coiled-coil domain containing 85A; transposon insertion 2.248, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene. | | | | Rat | | description | gene, allele |
| 2290158 | Cd226Tn(sb-T2/Bart3)2.141Mcwi | CD226 antigen; transposon insertion 2.141, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Cd226 gene. | | | | Rat | | description | gene, allele |
| 10054371 | Chrna3em1Mcwi | cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene;(RGSC 5.0/rn5) chr8:58,186,969-58,186,970 | | | | Rat | | name , description | gene, allele |
| 12790616 | Chrna4em5Mcwi | cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in the Chrna4 gene | | | | Rat | | name , description | gene, allele |
| 2290123 | Chsy1Tn(sb-T2/Bart3)2.165Mcwi | carbohydrate (chondroitin) synthase 1 ; transposon insertion 2.165, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Chsy1. | | | | Rat | | description | gene, allele |
| 11568647 | Cntnap2em1Sage | contactin associated protein-like 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal auditory brainstem response; abnormal habituation; abnormal prepulse inhibition; ASSOCIATED WITH autism spectrum disorder; epilepsy | | | | Rat | 11 | name , description | gene, allele |
| 11049142 | Crhem1Ionsz | corticotropin releasing hormone; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh. | | | | Rat | | name , description | gene, allele |
| 2302637 | Csmd3Tn(sb-T2/Bart3)2.288Mcwi | CUB and Sushi multiple domains 3; transposon insertion 2.288, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene | | | | Rat | | description | gene, allele |
| 2290093 | Cst3Tn(sb-T2/Bart3)2.172Mcwi | cystatin C; transposon insertion 2.172, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cst3 gene. | | | | Rat | | description | gene, allele |
| 5131928 | Cyp1a1em1Mcwi | cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 19-bp frameshift deletion in exon 4 (del 1098-1116). | | | | Rat | | name , description | gene, allele |
| 5509976 | Cyp1a1em2Mcwi | cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 188-bp deletion encompassing exon 4 (del 61466251-61466438) | | | | Rat | | name , description | gene, allele |
| 5131929 | Cyp1a1em5Mcwi | cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 5, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 4 (del 1099-1106). | | | | Rat | | name , description | gene, allele |
| 14696724 | Cyp3a23-3a1em1Myliu | cytochrome P450, family 3, subfamily a, polypeptide 23-polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu | A 22-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a23/3a1gene in the Sprague Dawley embryo. | | | | Rat | | name | gene, allele |
| 5687724 | Cyp4a2em1Mcwi | cytochrome P450, family 4, subfamily a, polypeptide 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a net 2-bp frameshift deletion in exon 2 (del 319-320) | | | | Rat | | name , description | gene, allele |
| 5687737 | Cyp4a3em3Mcwi | cytochrome P450, family 4, subfamily a, polypeptide 3; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp deletion in exon 2 (del 311-321) | | | | Rat | | name , description | gene, allele |
| 2303974 | Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi | cytochrome P450, family 7, subfamily b, polypeptide 1; transposon insertion 2.306, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene. | | | | Rat | | description | gene, allele |
| 2290095 | CyssTn(sb-T2/Bart3)2.173Mcwi | cystatin S; transposon insertion 2.173, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyss gene | | | | Rat | | description | gene, allele |
| 2307440 | Cyyr1Tn(sb-T2/Bart3)2.328Mcwi | cysteine/tyrosine-rich 1; transposon insertion 2.328, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene. | | | | Rat | | description | gene, allele |
| 2298938 | DccTn(sb-T2/Bart3)2.205Mcwi | deleted in colorectal carcinoma; transposon insertion 2.205, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene. | | | | Rat | | description | gene, allele |
| 2306275 | Diaph3Tn(sb-T2/Bart3)2.318Mcwi | diaphanous homolog 3 (Drosophila); transposon insertion 2.318, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. | | | | Rat | | description | gene, allele |
| 2290152 | Dlg1Tn(sb-T2/Bart3)2.133Mcwi | discs, large homolog 1 (Drosophila); transposon insertion 2.133, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene. | | | | Rat | | description | gene, allele |
| 2303098 | Dnah11Tn(sb-T2/Bart3)2.293Mcwi | dynein, axonemal, heavy chain 11; transposon insertion 2.293, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene. | | | | Rat | | description | gene, allele |
| 2299114 | Dnhd1Tn(sb-T2/Bart3)2.243Mcwi | dynein heavy chain domain 1; transposon insertion 2.243, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene. | | | | Rat | | description | gene, allele |
| 11073717 | Drd1em1Ionsz | dopamine receptor D1; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. | | | | Rat | | name , description | gene, allele |
| 2291839 | Dzank1Tn(sb-T2/Bart3)2.164Mcwi | double zinc ribbon and ankyrin repeat domains 1; transposon insertion 2.164, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene | | | | Rat | | description | gene, allele |
| 2290055 | Elmod3Tn(sb-T2/Bart3)2.42Mcwi | RNA binding motif and ELMO domain 1; transposon insertion 1.42, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Rbed1 gene | | | | Rat | | description | gene, allele |
| 2302641 | Enox1Tn(sb-T2/Bart3)2.282Mcwi | ecto-NOX disulfide-thiol exchanger 1; transposon insertion 2.282, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene. | | | | Rat | | description | gene, allele |
| 2290086 | Entpd6Tn(sb-T2/Bart3)2.174Mcwi | ectonucleoside triphosphate diphosphohydrolase 6; transposon insertion 2.174, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Entpd6 gene | | | | Rat | | description | gene, allele |
| 2299110 | Erbb4Tn(sb-T2/Bart3)2.208Mcwi | v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian); transposon insertion 2.208, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene. | | | | Rat | | description | gene, allele |
| 4139856 | Ets1em1Mcwi | v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH decreased circulating creatinine level; increased tubuloglomerular feedback response | | | | Rat | 2 | name , description | gene, allele |
| 2299094 | Eva1aTn(sb-T2/Bart3)2.233Mcwi | eva-1 homolog A, regulator of programmed cell death; transposon insertion 2.233, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. | | | | Rat | | description | gene, allele |
| 2306273 | Exoc4Tn(sb-T2/Bart3)2.317Mcwi | exocyst complex component 4; transposon insertion 2.317, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. | | | | Rat | | description | gene, allele |
| 1584849 | Eya1 | EYA transcriptional coactivator and phosphatase 1 | ENCODES a protein that exhibits histone H2AXY142 phosphatase activity (ortholog); protein tyrosine phosphatase activity (ortholog); RNA binding (ortholog); INVOLVED IN animal organ morphogenesis (ortholog); aorta morphogenesis (ortholog); branching involved in ureteric bud morphogenesis (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ASSOCIATED WITH Lung Agenesis; anterior segment dysgenesis (ortholog); branchiooculofacial syndrome (ortholog); FOUND IN cytoplasm (ortholog); nuclear body (ortholog); nucleoplasm (ortholog); INTERACTS WITH acrylamide; alpha-Zearalanol; bisphenol A | 5 | 9646599 | 9884609 | Rat | 182 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1309932 | Eya3 | EYA transcriptional coactivator and phosphatase 3 | ENCODES a protein that exhibits chromatin binding (ortholog); histone H2AXY142 phosphatase activity (ortholog); protein tyrosine phosphatase activity (ortholog); INVOLVED IN double-strand break repair (ortholog); positive regulation of DNA repair (ortholog); protein dephosphorylation (ortholog); PAR TICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; FOUND IN nucleoplasm (ortholog); nucleus (ortholog); transcription regulator complex (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 2,4-dinitrotoluene | 5 | 150090535 | 150218855 | Rat | 116 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 2290098 | Fam19a2Tn(sb-T2/Bart3)2.184Mcwi | similar to TAFA2 protein; transposon insertion 2.184, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene. | | | | Rat | | description | gene, allele |
| 2311687 | Fam227aTn(sb-T2/Bart3)2.333Mcwi | family with sequence similarity 227, member A; transposon insertion 2.333, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. | | | | Rat | | description | gene, allele |
| 2306872 | FaslgTn(sb-T2/Bart3)2.325Mcwi | Fas ligand (TNF superfamily, member 6); transposon insertion 2.324, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene. | | | | Rat | | description | gene, allele |
| 2306703 | FM117003Tn(sb-T2/Bart3)2.321Mcwi | EST FM117003; transposon insertion 2.321, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron EST FM117003 | | | | Rat | | description | gene, allele |
| 11568041 | Fmr1em1Sage | FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal auditory behavior; abnormal neuron morphology; abnormal operant conditioning behavior; ASSOCIATED WITH autism spectrum disorder; fragile X syndrome | | | | Rat | 18 | name , description | gene, allele |
| 6893411 | Fynem1Mcwi | FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 4 (del 383-389) | | | | Rat | | name , description | gene, allele |
| 6893380 | Fynem6Mcwi | FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 6, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp deletion in exon 4 (del 385-392) | | | | Rat | | name , description | gene, allele |
| 2304194 | Galntl6Tn(sb-T2/Bart3)2.311Mcwi | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6; transposon insertion 2.309, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene | | | | Rat | | description | gene, allele |
| 10758636 | Gcdhem1Dba | glutaryl-CoA dehydrogenase; CRISPR/Cas9 system induced mutant 1, Diana Ballhausen, CHUV, Switzerland | CRISPR/Cas9 system was used to generate this mutant; the resulting knock-in mutation is R411W in exon 11 of the GCDH gene. | | | | Rat | | name , description | gene, allele |
| 12880380 | Gh1sdr | | ASSOCIATED WITH decreased growth hormone level; decreased prolactin level; ASSOCIATED WITH Dwarfism | | | | Rat | 3 | description | gene, allele |
| 2290128 | Glis1Tn(sb-T2/Bart3)2.149Mcwi | GLIS family zinc finger 1 ; transposon insertion 2.149, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene. | | | | Rat | | description | gene, allele |
| 5687696 | Gnb3em1Mcwi | guanine nucleotide binding protein (G protein), beta polypeptide 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 111-bp deletion overlapping exon 7 (del 160960366 160960476) | | | | Rat | | name , description | gene, allele |
| 2306274 | Gng12Tn(sb-T2/Bart3)2.320Mcwi | guanine nucleotide binding protein (G protein), gamma 12; transposon insertion 2.320, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene | | | | Rat | | description | gene, allele |
| 2302635 | Gramd1bTn(sb-T2/Bart3)2.287Mcwi | GRAM domain containing 1B; transposon insertion 2.287, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene | | | | Rat | | description | gene, allele |
| 2299115 | Grk1Tn(sb-T2/Bart3)2.234Mcwi | G protein-coupled receptor kinase 1; transposon insertion 2.234, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene | | | | Rat | | description | gene, allele |
| 11568068 | Grm5em1Sage | glutamate metabotropic receptor 5; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot. | | | | Rat | | name , description | gene, allele |
| 5508351 | Gucy1a3em1Mcwi | guanylate cyclase 1, soluble, alpha 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a14-bp frameshift deletion in exon 5 (del 784-797) | | | | Rat | | name , description | gene, allele |
| 1566119 | H2ax | H2A.X variant histone | ENCODES a protein that exhibits chromatin-protein adaptor activity (ortholog); damaged DNA binding (ortholog); enzyme binding (ortholog); INVOLVED IN cellular response to gamma radiation; cellular senescence; cerebral cortex development; PARTICIPATES IN ataxia telangiectasia-mut :700;'>mutated (ATM) signaling pathway; histone modification pathway; systemic lupus erythematosus pathway; ASSOCIATED WITH Chemical and Drug Induced Liver Injury; hypertension; Kidney Reperfusion Injury; FOUND IN centrosome (ortholog); chromatin (ortholog); chromosome (ortholog); INTERACTS WITH (-)-ephedrine; 1,2-dimethylhydrazine; 1,3-dinitrobenzene | 8 | 53568718 | 53570072 | Rat | 1032 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 150429632 | Hcn1em1Kyo | hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; TALEN induced mutant 1, Kyo | ASSOCIATED WITH abnormal reflex; behavioral arrest; clonic seizures; ASSOCIATED WITH essential tremor | | | | Rat | 7 | name , description | gene, allele |
| 6893410 | Hvcn1em1Mcwi | hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 314-321) | | | | Rat | | name , description | gene, allele |
| 6893419 | Hvcn1em2Mcwi | hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH cerebral edema; ASSOCIATED WITH middle cerebral artery infarction | | | | Rat | 2 | name , description | gene, allele |
| 2299102 | Immp1lTn(sb-T2/Bart3)2.246Mcwi | IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae); transposon insertion 2.246, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene | | | | Rat | | description | gene, allele |
| 2290149 | Inpp4bTn(sb-T2/Bart3)2.143Mcwi | inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.143, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene | | | | Rat | | description | gene, allele |
| 2299095 | Inpp4bTn(sb-T2/Bart3)2.232Mcwi | inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.232, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene | | | | Rat | | description | gene, allele |
| 2306873 | IntuTn(sb-T2/Bart3)2.324Mcwi | inturned planar cell polarity effector homolog (Drosophila); transposon insertion 2.324, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene | | | | Rat | | description | gene, allele |
| 621061 | Kat5 | lysine acetyltransferase 5 | ENCODES a protein that exhibits chromatin binding; phospholipase binding; protein-containing complex binding; INVOLVED IN cellular response to hydrogen peroxide; cellular response to X-ray; positive regulation of transcription by RNA polymerase II; PARTICIPATES IN ataxia telangiectasia-mut font-weight:700;'>mutated (ATM) signaling pathway; histone modification pathway; INO80 family mediated chromatin remodeling pathway; ASSOCIATED WITH iron deficiency anemia; B-cell lymphoma (ortholog); breast cancer (ortholog); FOUND IN chromatin; protein-containing complex; cytoplasm (ortholog); INTERACTS WITH 2,4-dinitrotoluene; 6-propyl-2-thiouracil; amitrole | 1 | 212325089 | 212332640 | Rat | 312 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 12880383 | Kcna1Adms | potassium voltage-gated channel subfamily A member 1;autosomal dominant myokymia and seizures | ASSOCIATED WITH convulsive seizures; environmentally induced seizures; ASSOCIATED WITH epilepsy with generalized tonic-clonic seizures; episodic ataxia type 1; Myokymia | | | | Rat | 5 | description | gene, allele |
| 2303094 | Kcnab1Tn(sb-T2/Bart3)2.300Mcwi | potassium voltage-gated channel, shaker-related subfamily, beta member 1; transposon insertion 2.300, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene | | | | Rat | | description | gene, allele |
| 2303095 | Kcnh7Tn(sb-T2/Bart3)2.295Mcwi | potassium voltage-gated channel, subfamily H (eag-related), member 7; transposon insertion 2.295, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene | | | | Rat | | description | gene, allele |
| 2299100 | Kcnip4Tn(sb-T2/Bart3)2.225Mcwi | Kv channel interacting protein 4; transposon insertion 2.225, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene | | | | Rat | | description | gene, allele |
| 6893379 | Kcnj11em5Mcwi | potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 5, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting allele is a 8-bp deletion in exon 1 (del 311-318) | | | | Rat | | name , description | gene, allele |
| 6893381 | Kcnj11em9Mcwi | potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 9, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting allele is a 5-bp deletion in exon 1 (del 310-314) | | | | Rat | | name , description | gene, allele |
| 6893423 | Kcnj16em1Mcwi | potassium inwardly-rectifying channel, subfamily J, member 16; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH decreased body weight; decreased circulating aldosterone level; decreased circulating bicarbonate level; ASSOCIATED WITH hypokalemia; metabolic acidosis; Respiratory Underresponsiveness to Hypoxia and Hypercapnia | | | | Rat | 19 | name , description | gene, allele |
| 14394495 | Kcnj2em2Mcwi | potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 2, Mcwi | CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. | | | | Rat | | name , description | gene, allele |
| 14394497 | Kcnj2em4Mcwi | potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 4, Mcwi | CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. | | | | Rat | | name , description | gene, allele |
| 6893415 | Kcnmb1em1Mcwi | potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting allele is a net 4-bp deletion in exon 2 (del 441-447, ins. Tct) | | | | Rat | | name , description | gene, allele |
| 6893420 | Kcnmb1em3Mcwi | potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting allele is a 21-bp deletion in exon 2 and intron 2 (del 18906672-18906692) | | | | Rat | | name , description | gene, allele |
| 12802344 | Kcnq1dfk | potassium voltage-gated channel subfamily Q member 1;deafness Kyoto | ASSOCIATED WITH abnormal cardiovascular system physiology; decreased body weight; impaired balance; ASSOCIATED WITH Achlorhydria; Deafness; hypertension | | | | Rat | 12 | description | gene, allele |
| 5144083 | Kcnq1em14Mcwi | potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 14, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 3 (del 621-637) | | | | Rat | | name , description | gene, allele |
| 5144076 | Kcnq1em9Mcwi | potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 9, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 3 (del 631-637) | | | | Rat | | name , description | gene, allele |
| 1306378 | Kdm4a | lysine demethylase 4A | ENCODES a protein that exhibits histone demethylase activity (ortholog); histone H3K36 demethylase activity (ortholog); histone H3K9 demethylase activity (ortholog); INVOLVED IN apoptotic chromosome condensation; negative regulation of astrocyte differentiation; positive regulation of gene expressio n; PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; histone modification pathway; ASSOCIATED WITH alopecia areata (ortholog); breast cancer (ortholog); Cardiomegaly (ortholog); FOUND IN fibrillar center (ortholog); nucleoplasm (ortholog); nucleus (ortholog); INTERACTS WITH 1,2-dimethylhydrazine; 4,4'-sulfonyldiphenol; 6-propyl-2-thiouracil | 5 | 136958178 | 137004942 | Rat | 149 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 2299111 | Kif16bTn(sb-T2/Bart3)2.200Mcwi | kinesin family member 16B; transposon insertion 2.200, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene | | | | Rat | | description | gene, allele |
| 2290085 | Klhl13Tn(sb-T2/Bart3)2.176Mcwi | kelch-like 13 (Drosophila); transposon insertion 2.176, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene | | | | Rat | | description | gene, allele |
| 2302638 | Klra1Tn(sb-T2/Bart3)2.279Mcwi | killer cell lectin-like receptor, subfamily A, member 1; transposon insertion 2.279, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene | | | | Rat | | description | gene, allele |
| 1307316 | L3mbtl1 | L3MBTL histone methyl-lysine binding protein 1 | ENCODES a protein that exhibits chromatin binding (ortholog); histone binding (ortholog); histone H1 reader activity (ortholog); INVOLVED IN chromatin organization (ortholog); constitutive heterochromatin formation (ortholog); hemopoiesis (ortholog); PARTICIPATES IN ataxia telangiectasia-mut ='font-weight:700;'>mutated (ATM) signaling pathway; histone modification pathway; ASSOCIATED WITH breast cancer (ortholog); genetic disease (ortholog); FOUND IN chromatin (ortholog); condensed chromosome (ortholog); nuclear body (ortholog); INTERACTS WITH atrazine; bisphenol A; lead diacetate | 3 | 172014774 | 172053181 | Rat | 109 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 2299103 | Lama2Tn(sb-T2/Bart3)2.2013Mcwi | laminin, alpha 2; transposon insertion 2.213, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene | | | | Rat | | description | gene, allele |
| 2313460 | LargeTn(sb-T2/Bart3)2.336Mcwi | like-glycosyltransferase; transposon insertion 2.336, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene | | | | Rat | | description | gene, allele |
| 5144090 | Ldlrem1Mcwi | low density lipoprotein receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 647-659) | | | | Rat | | name , description | gene, allele |
| 5144094 | Ldlrem2Mcwi | low density lipoprotein receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 123-bp frameshift deletion in exon 4 (del 536-658) | | | | Rat | | name , description | gene, allele |
| 5144082 | Ldlrem3Mcwi | low density lipoprotein receptor; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp frameshift deletion in exon 4 (del 647-659) | | | | Rat | | name , description | gene, allele |
| 5144075 | Ldlrem4Mcwi | low density lipoprotein receptor; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 653-665) | | | | Rat | | name , description | gene, allele |
| 11570565 | Leprcp | leptin receptor;corpulent | ASSOCIATED WITH increased body mass index; increased circulating leptin level | | | | Rat | 2 | description | gene, allele |
| 2290096 | Lims1Tn(sb-T2/Bart3)2.169Mcwi | LIM zinc finger domain containing 1; transposon insertion 2.169, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. | | | | Rat | | description | gene, allele |
| 2306701 | LmlnTn(sb-T2/Bart3)2.322Mcwi | leishmanolysin-like (metallopeptidase M8 family); transposon insertion 2.322, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene | | | | Rat | | description | gene, allele |
| 2290089 | LOC290071Tn(sb-T2/Bart3)2.170Mcwi | similar to RIKEN cDNA A430107P09 gene; transposon insertion 2.170, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene | | | | Rat | | description | gene, allele |
| 2290119 | LOC681893Tn(sb-T2/Bart3)2.159Mcwi | similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template-activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002); transposon insertion 2.159, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene | | | | Rat | | description | gene, allele |
| 2299107 | Lrrc4cTn(sb-T2/Bart3)2.224Mcwi | leucine rich repeat containing 4C; transposon insertion 2.224, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene | | | | Rat | | description | gene, allele |
| 2301076 | Lrrc4cTn(sb-T2/Bart3)2.254Mcwi | leucine rich repeat containing 4C; transposon insertion 2.254, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene | | | | Rat | | description | gene, allele |
| 2301078 | Lrrc7Tn(sb-T2/Bart3)2.253Mcwi | leucine rich repeat containing 7; transposon insertion 2.253, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7 gene | | | | Rat | | description | gene, allele |
| 7241044 | Lrrk1em1Sage | leucine-rich repeat kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 4 (TGCCTCGCAGCGGCTGCTG) | | | | Rat | | name , description | gene, allele |
| 7241045 | Lrrk2em1Sage | leucine-rich repeat kinase 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal circulating aspartate transaminase level; decreased circulating alanine transaminase level; decreased circulating bilirubin level; ASSOCIATED WITH synucleinopathy | | | | Rat | 24 | name , description | gene, allele |
| 6484706 | Lssem2Mcwi | lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase); zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a net 10-bp deletion in exon 2 (del 117-130, ins. Gtgg) | | | | Rat | | name , description | gene, allele |
| 2304196 | LzicTn(sb-T2/Bart3)2.309Mcwi | leucine zipper and CTNNBIP1 domain containing; transposon insertion 2.309, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene | | | | Rat | | description | gene, allele |
| 2290117 | Map2k5Tn(sb-T2/Bart3)2.150Mcwi | mitogen activated protein kinase kinase 5; transposon insertion 2.150, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene. | | | | Rat | | description | gene, allele |
| 12802351 | Mbpmd | myelin basic protein; myelin deficient | ASSOCIATED WITH demyelinating disease | | | | Rat | 1 | description | gene, allele |
| 1559468 | Mdc1 | mediator of DNA damage checkpoint 1 | ENCODES a protein that exhibits chromatin-protein adaptor activity (ortholog); histone reader activity (ortholog); INVOLVED IN DNA damage response (ortholog); DNA replication checkpoint signaling (ortholog); protein localization to site of double-strand break (ortholog); PARTICIPATES IN ataxia telan giectasia-mutated (ATM) signaling pathway; histone modification pathway; ASSOCIATED WITH breast carcinoma (ortholog); cervical cancer (ortholog); lung carcinoma (ortholog); FOUND IN chromosome (ortholog); nuclear body (ortholog); nucleoplasm (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene | 20 | 2898496 | 2914960 | Rat | 127 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 11568035 | Mecp2em1Sage | methyl CpG binding protein 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal action potential; abnormal motor coordination/balance; abnormal pulmonary respiratory rate; ASSOCIATED WITH Rett syndrome | | | | Rat | 24 | name , description | gene, allele |
| 11568072 | Metem1Sage | MET proto-oncogene, receptor tyrosine kinase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met. | | | | Rat | | name , description | gene, allele |
| 2299106 | Mgat4cTn(sb-T2/Bart3)2.244Mcwi | mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative); transposon insertion 2.244, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. | | | | Rat | | description | gene, allele |
| 2301077 | Mmel1Tn(sb-T2/Bart3)2.255Mcwi | membrane metallo-endopeptidase-like 1; transposon insertion 2.255, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1 gene | | | | Rat | | description | gene, allele |
| 2302647 | Mov10Tn(sb-T2/Bart3)2.281Mcwi | Moloney leukemia virus 10; transposon insertion 2.281, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene | | | | Rat | | description | gene, allele |
| 69263 | Mre11 | MRE11 double strand break repair nuclease | ENCODES a protein that exhibits 3'-5' exonuclease activity (ortholog); 3'-5'-DNA exonuclease activity (ortholog); DNA binding (ortholog); INVOLVED IN heart development; host-mediated suppression of symbiont invasion; chromosome organization (ortholog); PARTICIPATES IN altered p53 signaling pathway; ataxia telangiectasia-mutated (ATM) signaling pathway; homologous recombination pathway of double-strand break repair; ASSOCIATED WITH Alzheimer's disease (ortholog); Animal Disease Models (ortholog); Ataxia Telangiectasia Like Disorder (ortholog); FOUND IN chromatin; condensed nuclear chromosome; nucleoplasm; INTERACTS WITH (+)-pilocarpine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 8 | 19900211 | 19961906 | Rat | 261 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 5131945 | Msraem3Mcwi | methionine sulfoxide reductase A; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 1 (del 85-102). | | | | Rat | | name , description | gene, allele |
| 5509977 | Msraem4Mcwi | methionine sulfoxide reductase A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a net 1-bp frameshift deletion in exon 1 (del 95-99, ins cttc) | | | | Rat | | name , description | gene, allele |
| 5131961 | Mthfrem1Mcwi | methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 28-bp frameshift deletion in exon 2 (del 165-192). | | | | Rat | | name , description | gene, allele |
| 5508317 | Myadml2em1Mcwi | myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1(del 161-173) | | | | Rat | | name , description | gene, allele |
| 5687726 | Myadml2em5Mcwi | myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 5, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 31-bp frameshift deletion in exon 1 (del 161-191) | | | | Rat | | name , description | gene, allele |
| 5508347 | Mylipem1Mcwi | myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 195-241) | | | | Rat | | name , description | gene, allele |
| 5508333 | Mylipem2Mcwi | myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 49-bp deletion in the genome and a G insertion at the deletion site. | | | | Rat | | name , description | gene, allele |
| 5508336 | Mylipem3Mcwi | myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 51-bp frameshift deletion in exon 1 (del 206-256) | | | | Rat | | name , description | gene, allele |
| 2311691 | Myo1dTn(sb-T2/Bart3)2.334Mcwi | myosin ID; transposon insertion 2.334, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene | | | | Rat | | description | gene, allele |
| 2290068 | Myo9aTn(sb-T2/Bart3)2.186Mcwi | myosin IXA; transposon insertion 2.186, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene | | | | Rat | | description | gene, allele |
| 2290116 | NapbTn(sb-T2/Bart3)2.162Mcwi | similar to N-ethylmaleimide sensitive fusion protein attachment protein beta; transposon insertion 2.162, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene. | | | | Rat | | description | gene, allele |
| 621420 | Nbn | nibrin | ENCODES a protein that exhibits chromatin-protein adaptor activity (ortholog); damaged DNA binding (ortholog); DNA-binding transcription factor binding (ortholog); INVOLVED IN host-mediated suppression of symbiont invasion; negative regulation of neuron differentiation; positive regulation of cell p opulation proliferation; PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; homologous recombination pathway of double-strand break repair; ASSOCIATED WITH acute lymphoblastic leukemia (ortholog); adenosine deaminase deficiency (ortholog); Alzheimer's disease (ortholog); FOUND IN chromosome, telomeric region (ortholog); Mre11 complex (ortholog); nuclear inclusion body (ortholog); INTERACTS WITH (S)-colchicine; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene | 5 | 34256678 | 34291163 | Rat | 350 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 9588537 | Ndufc2em1Mcwi | NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH failure of embryo implantation | | | | Rat | 1 | name , description | gene, allele |
| 9588541 | Ndufc2em2Mcwi | NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH failure of embryo implantation; increased urine protein level; ASSOCIATED WITH stroke | | | | Rat | 3 | name , description | gene, allele |
| 2302639 | Nectin1Tn(sb-T2/Bart3)2.284Mcwi | nectin cell adhesion molecule 1; transposon insertion 2.284, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1 gene | | | | Rat | | description | gene, allele |
| 2290061 | Nell1Tn(sb-T2/Bart3)2.195Mcwi | NEL-like 1 (chicken); transposon insertion 2.195, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Nell1 gene | | | | Rat | | description | gene, allele |
| 6893422 | Nos3em13Mcwi | nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 13, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4. | | | | Rat | | name , description | gene, allele |
| 6893418 | Nos3em2Mcwi | nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 399-411) | | | | Rat | | name , description | gene, allele |
| 6893421 | Nos3em8Mcwi | nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 8, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 109-bp deletion in exon 3 (del 309-417) | | | | Rat | | name , description | gene, allele |
| 4139857 | Nppaem4Mcwi | natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 22-bp frameshift deletion in exon 2 (del 252-273). | | | | Rat | | name , description | gene, allele |
| 5687721 | Nr2f2em1Mcwi | nuclear receptor subfamily 2, group F, member 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH decreased urine protein level; increased heart ventricle muscle contractility; ASSOCIATED WITH hypertension | | | | Rat | 3 | name , description | gene, allele |
| 2290090 | Nrg1Tn(sb-T2/Bart3)2.183Mcwi | neuregulin 1; transposon insertion 2.183, Medical College of Wisconsin | ASSOCIATED WITH abnormal habituation; decreased locomotor activity; decreased prepulse inhibition; ASSOCIATED WITH stress-related disorder | | | | Rat | 8 | description | gene, allele |
| 2299118 | Nrxn2Tn(sb-T2/Bart3)2.250Mcwi | neurexin 2; transposon insertion 2.250, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene | | | | Rat | | description | gene, allele |
| 2302645 | Nsun4Tn(sb-T2/Bart3)2.286Mcwi | NOL1/NOP2/Sun domain family, member 4; transposon insertion 2.286, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene | | | | Rat | | description | gene, allele |
| 2290157 | NtmTn(sb-T2/Bart3)2.130Mcwi | neurotrimin; transposon insertion 2.130, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene | | | | Rat | | description | gene, allele |
| 2302648 | Orc3Tn(sb-T2/Bart3)2.275Mcwi | origin recognition complex, subunit 3-like (yeast); transposon insertion 2.275, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene | | | | Rat | | description | gene, allele |
| 1311329 | Otub1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ENCODES a protein that exhibits cysteine-type deubiquitinase activity (ortholog); deNEDDylase activity (ortholog); ubiquitin binding (ortholog); INVOLVED IN cellular response to interleukin-1; DNA damage response (ortholog); negative regulation of double-strand break repair (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ASSOCIATED WITH IgA glomerulonephritis (ortholog); lupus nephritis (ortholog); FOUND IN cytoplasm (inferred); INTERACTS WITH 2,4-dinitrotoluene; 4,4'-sulfonyldiphenol; amitrole | 1 | 213816400 | 213824679 | Rat | 112 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2304195 | P3h3Tn(sb-T2/Bart3)2.310Mcwi | prolyl 3-hydroxylase 3; transposon insertion 2.310, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene | | | | Rat | | description | gene, allele |
| 2314336 | PalldTn(sb-T2/Bart3)2.341Mcwi | palladin, cytoskeletal associated protein; transposon insertion 2.341, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene | | | | Rat | | description | gene, allele |
| 2314335 | PatjTn(sb-T2/Bart3)2.343Mcwi | PATJ, crumbs cell polarity complex component; transposon insertion 2.343, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene | | | | Rat | | description | gene, allele |
| 2302644 | Pde4dTn(sb-T2/Bart3)2.285Mcwi | phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila); transposon insertion 2.285, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene | | | | Rat | | description | gene, allele |
| 2303096 | Pebp4Tn(sb-T2/Bart3)2.299Mcwi | phosphatidylethanolamine binding protein 4; transposon insertion 2.299, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene | | | | Rat | | description | gene, allele |
| 1311372 | Pex16 | peroxisomal biogenesis factor 16 | INVOLVED IN ER-dependent peroxisome localization (ortholog); ER-dependent peroxisome organization (ortholog); peroxisome membrane biogenesis (ortholog); ASSOCIATED WITH genetic disease (ortholog); infantile Refsum disease (ortholog); methylmalonic aciduria due to methylmalonyl-CoA mut weight:700;'>mutase deficiency (ortholog); FOUND IN peroxisomal membrane; endoplasmic reticulum (ortholog); endoplasmic reticulum membrane (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene; bisphenol A | 3 | 98800357 | 98808091 | Rat | 104 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1307843 | Pias1 | protein inhibitor of activated STAT, 1 | ENCODES a protein that exhibits protein domain specific binding; DNA-binding transcription factor binding (ortholog); enzyme binding (ortholog); INVOLVED IN G1/S transition of mitotic cell cycle; negative regulation of apoptotic process; positive regulation of DNA-templated transcription; PARTICIPAT ES IN aldosterone signaling pathway; ataxia telangiectasia-mutated (ATM) signaling pathway; Hedgehog signaling pathway; ASSOCIATED WITH Brain Injuries; focal segmental glomerulosclerosis; Arsenic Poisoning (ortholog); FOUND IN glutamatergic synapse (ortholog); nuclear periphery (ortholog); nucleoplasm (ortholog); INTERACTS WITH 17alpha-ethynylestradiol; 17beta-estradiol; 2,6-dinitrotoluene | 8 | 72233566 | 72347085 | Rat | 216 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1308737 | Pias4 | protein inhibitor of activated STAT, 4 | ENCODES a protein that exhibits DNA binding (ortholog); SUMO ligase activity (ortholog); SUMO transferase activity (ortholog); INVOLVED IN central nervous system development (ortholog); hair follicle development (ortholog); limb epidermis development (ortholog); PARTICIPATES IN ataxia telangiectasia -mutated (ATM) signaling pathway; Jak-Stat signaling pathway; type II interferon signaling pathway; FOUND IN cytoplasm (ortholog); nuclear matrix (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 7 | 9197032 | 9210557 | Rat | 141 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 7241046 | Pink1em1Sage | PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | ASSOCIATED WITH abnormal gait; abnormal motor coordination/balance; abnormal muscle tone; ASSOCIATED WITH Parkinson's disease | | | | Rat | 16 | name , description | gene, allele |
| 11535943 | Pkhd1pck | polycystic kidney and hepatic disease 1,polycystic kidney disease | ASSOCIATED WITH autosomal recessive polycystic kidney disease | | | | Rat | 1 | description | gene, allele |
| 2290155 | Plcb3Tn(sb-T2/Bart3)2.69Mcwi | phospholipase C, beta 3; transposon insertion 2.69, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene | | | | Rat | | description | gene, allele |
| 2290125 | Plce1Tn(sb-T2/Bart3)2.146Mcwi | phospholipase C, epsilon 1; transposon insertion 2.146, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene | | | | Rat | | description | gene, allele |
| 2313462 | Pld5Tn(sb-T2/Bart3)2.340Mcwi | phospholipase D family, member 5; transposon insertion 2.340, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene | | | | Rat | | description | gene, allele |
| 5143978 | Plekha7em1Mcwi | pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 635-650) | | | | Rat | | name , description | gene, allele |
| 5143979 | Plekha7em4Mcwi | pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | ASSOCIATED WITH decreased susceptibility to hypertension; decreased systemic vascular resistance; decreased urine albumin level; ASSOCIATED WITH Cardiac Fibrosis; glomerulosclerosis; hypertension | | | | Rat | 19 | name , description | gene, allele |
| 5131960 | Plod1em1Mcwi | procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1); zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 764-773). | | | | Rat | | name , description | gene, allele |
| 1305483 | Pms2 | PMS1 homolog 2, mismatch repair system component | ENCODES a protein that exhibits DNA binding (ortholog); MutSalpha complex binding (ortholog); single base insertion or deletion binding (ortholog); INVOLVED IN response to xenobiotic stimulus; DNA damage response (ortholog); DNA repair (ortholog); PARTICIPATES I N altered mismatch repair pathway; colorectal cancer pathway; mismatch repair pathway; ASSOCIATED WITH autosomal recessive progressive external ophthalmoplegia 1 (ortholog); Brain Neoplasms (ortholog); breast cancer (ortholog); FOUND IN MutLalpha complex (ortholog); nucleoplasm (ortholog); nucleus (ortholog); INTERACTS WITH 2,6-dinitrotoluene; 4-hydroperoxycyclophosphamide; 6-propyl-2-thiouracil | 12 | 15790478 | 15814790 | Rat | 277 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 2299105 | Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi | phosphatidic acid phosphatase type 2 domain containing 1A; transposon insertion 2.207, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene | | | | Rat | | description | gene, allele |
| 6893424 | Ppargem1Mcwi | peroxisome proliferator-activated receptor gamma; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3 | | | | Rat | | name , description | gene, allele |
| 2313459 | Ppfia2Tn(sb-T2/Bart3)2.339Mcwi | protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2; transposon insertion 2.339, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene | | | | Rat | | description | gene, allele |
| 1305460 | Ppm1d | protein phosphatase, Mg2+/Mn2+ dependent, 1D | ENCODES a protein that exhibits mitogen-activated protein kinase binding (ortholog); protein serine/threonine phosphatase activity (ortholog); INVOLVED IN cellular response to starvation; DNA damage response, signal transduction by p53 class mediator (ortholog); DNA methylation-dependent constitutiv e heterochromatin formation (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; p38 MAPK signaling pathway; p53 signaling pathway; ASSOCIATED WITH Brain Stem Neoplasms (ortholog); breast cancer (ortholog); Breast Cancer, Familial (ortholog); FOUND IN cytosol (ortholog); nucleolus (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; Ampullosporin; bisphenol A | 10 | 70670026 | 70706030 | Rat | 214 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 3380 | Ppp2ca | protein phosphatase 2 catalytic subunit alpha | ENCODES a protein that exhibits beta-2 adrenergic receptor binding; enzyme binding; identical protein binding; INVOLVED IN cardiac ventricle development; cellular response to calcium ion; cellular response to cytokine stimulus; PARTICIPATES IN adenosine monophosphate-activated protein kinase (AMPK) signaling pathway; ataxia telangiectasia-mutated (ATM) signaling pathway; dopamine signaling pathway; ASSOCIATED WITH Experimental Liver Neoplasms; Hyperalgesia; type 2 diabetes mellitus; FOUND IN protein phosphatase type 2A complex; terminal bouton; chromatin (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 10 | 36856534 | 36878789 | Rat | 341 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 2299104 | Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi | protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform; transposon insertion 2.239, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene | | | | Rat | | description | gene, allele |
| 621225 | Ppp4c | protein phosphatase 4, catalytic subunit | ENCODES a protein that exhibits lamin binding; phosphatase activity; protein-containing complex binding; INVOLVED IN cellular response to interleukin-1; dephosphorylation; negative regulation of protein phosphorylation; PARTICIPATES IN ataxia telangiectasia-muta ted (ATM) signaling pathway; ASSOCIATED WITH coronary artery disease (ortholog); oligoasthenoteratozoospermia (ortholog); spondylocostal dysostosis 5 (ortholog); FOUND IN nucleus; chromatin (ortholog); cytoplasm (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; ammonium chloride | 1 | 190823447 | 190830247 | Rat | 106 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 68415 | Ppp5c | protein phosphatase 5, catalytic subunit | ENCODES a protein that exhibits G-protein alpha-subunit binding; heat shock protein binding; Hsp70 protein binding; INVOLVED IN cellular response to cadmium ion; cellular response to hydrogen peroxide; negative regulation of apoptotic process; PARTICIPATES IN Rho/Rac/Cdc42 mediated signaling pathway ; ataxia telangiectasia-mutated (ATM) signaling pathway; mitogen activated protein kinase signaling pathway; ASSOCIATED WITH Left Ventricular Hypertrophy (ortholog); FOUND IN neuronal cell body; perikaryon; proximal dendrite; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 4,4'-sulfonyldiphenol | 1 | 86818297 | 86842505 | Rat | 197 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 708460 | Ppp6c | protein phosphatase 6, catalytic subunit | ENCODES a protein that exhibits protein serine/threonine phosphatase activity; INVOLVED IN protein dephosphorylation; negative regulation of cGAS/STING signaling pathway (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ASSOCIATE D WITH basal cell carcinoma (ortholog); melanoma (ortholog); FOUND IN cytosol (ortholog); INTERACTS WITH 2,6-dinitrotoluene; 3H-1,2-dithiole-3-thione; ammonium chloride | 3 | 43339521 | 43371807 | Rat | 72 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 5687719 | Prex1em2Mcwi | phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 16 (del 1872-1885) | | | | Rat | | name , description | gene, allele |
| 7241041 | Prknem1Sage | parkinson protein 2, E3 ubiquitin protein ligase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs | This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT) | | | | Rat | | name , description | gene, allele |
| 2299112 | Prr5lTn(sb-T2/Bart3)2.228Mcwi | proline rich 5 like; transposon insertion 2.228, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene. | | | | Rat | | description | gene, allele |
| 1594532 | Psmd14 | proteasome 26S subunit, non-ATPase 14 | ENCODES a protein that exhibits endopeptidase activator activity (ortholog); K63-linked deubiquitinase activity (ortholog); metal-dependent deubiquitinase activity (ortholog); INVOLVED IN response to ethanol; double-strand break repair via homologous recombination (ortholog); double-strand break rep air via nonhomologous end joining (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ubiquitin/proteasome degradation pathway; ASSOCIATED WITH alcohol-associated liver disease; autistic disorder (ortholog); Disease Progression (ortholog); FOUND IN cytosolic proteasome complex; nucleoplasm (ortholog); proteasome accessory complex (ortholog); INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; acrylamide | 3 | 66662933 | 66755666 | Rat | 174 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 5131970 | Ptpn11em1Mcwi | protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 4 (del 624-640). | | | | Rat | | name , description | gene, allele |
| 5131969 | Ptpn11em4Mcwi | protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 84-bp frameshift deletion in exon 4 (del 570-653). | | | | Rat | | name , description | gene, allele |
| 2301698 | PtpraTn(sb-T2/Bart3)2.261Mcwi | protein tyrosine phosphatase, receptor type, A; transposon insertion 2.261, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene | | | | Rat | | description | gene, allele |
| 2299097 | PtpreTn(sb-T2/Bart3)236Mcwi | protein tyrosine phosphatase, receptor type, E; transposon insertion 2.236, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene | | | | Rat | | description | gene, allele |
| 4139867 | Rab38em1Mcwi | RAB38, member RAS oncogene family; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH increased urine protein level; ASSOCIATED WITH Albuminuria | | | | Rat | 2 | name , description | gene, allele |
| 1600311 | Rab38ru | Rab38, member of RAS oncogene family, ruby allele | ASSOCIATED WITH abnormal coat/hair pigmentation; abnormal platelet dense granule number; abnormal surfactant secretion; ASSOCIATED WITH Hermansky-Pudlak syndrome | | | | Rat | 7 | description | gene, allele |
| 621542 | Rad50 | RAD50 double strand break repair protein | ENCODES a protein that exhibits double-stranded DNA binding; protein-containing complex binding; 3'-5' exonuclease activity (ortholog); INVOLVED IN DNA damage response; heart development; host-mediated suppression of symbiont invasion; PARTICIPATES IN ataxia telangiectasia-mut 00;'>mutated (ATM) signaling pathway; homologous recombination pathway of double-strand break repair; non-homologous end joining pathway of double-strand break repair; ASSOCIATED WITH liver cirrhosis; myocardial infarction; asthma (ortholog); FOUND IN chromatin; condensed nuclear chromosome; inclusion body; INTERACTS WITH 1,3-dinitrobenzene; 2,3,7,8-tetrachlorodibenzodioxine; 4-hydroperoxycyclophosphamide | 10 | 38310147 | 38362100 | Rat | 324 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 4139865 | Rag1em1Mcwi | recombination activating gene 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH decreased B cell number; decreased T cell number; decreased thymus weight; ASSOCIATED WITH Albuminuria; Hypertensive Nephropathy | | | | Rat | 7 | name , description | gene, allele |
| 7204132 | Rag1em1Ztm | recombination activating gene 1; zinc finger nuclease induced mutant 1, Zentrales Tierlaboratorium, Medizinische Hochschule Hannover | ASSOCIATED WITH decreased B cell number; decreased T cell number; small thymus; ASSOCIATED WITH severe combined immunodeficiency | | | | Rat | 4 | name , description | gene, allele |
| 4139866 | Rag1em2Mcwi | recombination activating gene 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH decreased thymus weight; decreased urine albumin level; increased mean systemic arterial blood pressure; ASSOCIATED WITH Albuminuria | | | | Rat | 4 | name , description | gene, allele |
| 2299098 | Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi | RAP1, GTP-GDP dissociation stimulator 1; transposon insertion 2.251, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene | | | | Rat | | description | gene, allele |
| 2304197 | Rapgef4Tn(sb-T2/Bart3)2.314Mcwi | Rap guanine nucleotide exchange factor (GEF) 4; transposon insertion 2.314, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene | | | | Rat | | description | gene, allele |
| 5131968 | Rasgrp3em1Mcwi | RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 12 (del 1501-1503, ins. Ttaggtgg). | | | | Rat | | name , description | gene, allele |
| 5143946 | Rasgrp3em3Mcwi | RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made using ZFN mutagenesis. The resulting mutation is a 20-bp frameshift deletion in exon 12 (del 1494-1513) | | | | Rat | | name , description | gene, allele |
| 1308872 | Rbbp8 | RB binding protein 8, endonuclease | ENCODES a protein that exhibits damaged DNA binding (ortholog); identical protein binding (ortholog); RNA polymerase II-specific DNA-binding transcription factor binding (ortholog); INVOLVED IN response to estradiol; blastocyst hatching (ortholog); DNA double-strand break processing involved in repa ir via single-strand annealing (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; homologous recombination pathway of double-strand break repair; non-homologous end joining pathway of double-strand break repair; ASSOCIATED WITH COVID-19 (ortholog); Desbuquois dysplasia (ortholog); genetic disease (ortholog); FOUND IN nucleoplasm (ortholog); site of double-strand break (ortholog); transcription repressor complex (ortholog); INTERACTS WITH acetamide; bisphenol A; endosulfan | 18 | 3198188 | 3263643 | Rat | 184 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 5687705 | Resp18em2Mcwi | regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | ASSOCIATED WITH increased urine protein level; salt-sensitive hypertension; ASSOCIATED WITH hypertension; renal fibrosis | | | | Rat | 4 | name , description | gene, allele |
| 5687714 | Resp18em3Mcwi | regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made using ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 369-381) | | | | Rat | | name , description | gene, allele |
| 2304198 | RGD1563503Tn(sb-T2/Bart3)2.313Mcwi | similar to ribosomal protein L6; transposon insertion 2.313, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503 | | | | Rat | | description | gene, allele |
| 2292447 | RGD1564304Tn(sb-T2/Bart3)2.201Mcwi | RGD1564304; transposon insertion 2.201, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene | | | | Rat | | description | gene, allele |
| 2304193 | RGD1565323Tn(sb-T2/Bart3)2.312Mcwi | similar to OTTMUSP00000000621; transposon insertion 2.312, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323 | | | | Rat | | description | gene, allele |
| 1562474 | Rif1 | replication timing regulatory factor 1 | INVOLVED IN cellular response to leukemia inhibitory factor (ortholog); DNA damage response (ortholog); negative regulation of double-strand break repair via homologous recombination (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathw ay; non-homologous end joining pathway of double-strand break repair; ASSOCIATED WITH nemaline myopathy 2 (ortholog); FOUND IN chromatin (ortholog); chromosome, telomeric region (ortholog); chromosome, telomeric repeat region (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; amphetamine; bisphenol A | 3 | 56963840 | 57017106 | Rat | 173 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1585168 | Rnf168 | ring finger protein 168 | ENCODES a protein that exhibits chromatin binding (ortholog); histone binding (ortholog); histone H2AK15 ubiquitin ligase activity (ortholog); INVOLVED IN cellular response to UV (ortholog); DNA damage response (ortholog); DNA repair-dependent chromatin remodeling (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ASSOCIATED WITH Disease Progression (ortholog); genetic disease (ortholog); lung non-small cell carcinoma (ortholog); FOUND IN DNA repair complex (ortholog); nuclear body (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,2',4,4'-Tetrabromodiphenyl ether; 2,3,7,8-Tetrachlorodibenzofuran; acrylamide | 11 | 81991352 | 82013306 | Rat | 137 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1311936 | Rnf20 | ring finger protein 20 | ENCODES a protein that exhibits chromatin binding (ortholog); histone binding (ortholog); histone H2B C-terminal K residue ubiquitin ligase activity (ortholog); INVOLVED IN negative regulation of cell migration (ortholog); positive regulation of DNA-templated transcription (ortholog); positive regul ation of transcription by RNA polymerase II (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ASSOCIATED WITH acute biphenotypic leukemia (ortholog); Arsenic Poisoning (ortholog); breast cancer (ortholog); FOUND IN HULC complex (ortholog); nucleolus (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,4-dinitrotoluene; bisphenol A; diuron | 5 | 68771507 | 68797240 | Rat | 119 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 3583 | Rnf4 | ring finger protein 4 | ENCODES a protein that exhibits DNA binding; identical protein binding; nuclear androgen receptor binding; INVOLVED IN cellular response to arsenic-containing substance; cellular response to cytokine stimulus; cellular response to gamma radiation; PARTICIPATES IN ataxia telangiectasia-mut ont-weight:700;'>mutated (ATM) signaling pathway; nuclear factor, erythroid 2 like 2 signaling pathway; ASSOCIATED WITH Angelman syndrome (ortholog); Testicular Neoplasms (ortholog); FOUND IN nucleoplasm; nucleus; PML body; INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 14 | 80625864 | 80647138 | Rat | 198 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 628638 | Rnf40 | ring finger protein 40 | ENCODES a protein that exhibits syntaxin-1 binding; ubiquitin conjugating enzyme binding; ubiquitin-protein transferase activity; INVOLVED IN positive regulation of proteasomal protein catabolic process; positive regulation of protein polyubiquitination; response to peptide hormone; PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ASSOCIATED WITH nephrogenic diabetes insipidus; FOUND IN protein-containing complex; HULC complex (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 3-chloropropane-1,2-diol | 1 | 191632988 | 191649231 | Rat | 114 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1308035 | Rnf8 | ring finger protein 8 | ENCODES a protein that exhibits chromatin binding (ortholog); histone binding (ortholog); identical protein binding (ortholog); INVOLVED IN DNA damage response (ortholog); DNA repair-dependent chromatin remodeling (ortholog); double-strand break repair (ortholog); PARTICIPATES IN ataxia telangiectas ia-mutated (ATM) signaling pathway; ASSOCIATED WITH autistic disorder (ortholog); FOUND IN chromosome, telomeric region (ortholog); cytoplasm (ortholog); nucleoplasm (ortholog); INTERACTS WITH 4,4'-sulfonyldiphenol; 6-propyl-2-thiouracil; allethrin | 20 | 7683890 | 7708437 | Rat | 187 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 2307439 | Robo1Tn(sb-T2/Bart3)2.327Mcwi | roundabout homolog 1 (Drosophila); transposon insertion 2.327, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene | | | | Rat | | description | gene, allele |
| 2304199 | RorbTn(sb-T2/Bart3)2.304Mcwi | RAR-related orphan receptor B; transposon insertion 2.304, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene | | | | Rat | | description | gene, allele |
| 2290154 | Rph3aTn(sb-T2/Bart3)2.104Mcwi | rabphilin 3A; transposon insertion 2.104, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene | | | | Rat | | description | gene, allele |
| 2299096 | Rprd1aTn(sb-T2/Bart3)2.247Mcwi | cyclin-dependent kinase 2B-inhibitor-related protein; transposon insertion 2.247, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. | | | | Rat | | description | gene, allele |
| 2305933 | Rtn4Tn(sb-T2/Bart3)2.316Mcwi | reticulon 4; transposon insertion 2.316, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene | | | | Rat | | description | gene, allele |
| 2301696 | Sf4Tn(sb-T2/Bart3)2.264Mcwi | splicing factor 4; transposon insertion 2.264, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene | | | | Rat | | description | gene, allele |
| 2303097 | Slc16a12Tn(sb-T2/Bart3)2.298Mcwi | solute carrier family 16, member 12 (monocarboxylic acid transporter 12); transposon insertion 2.298, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene | | | | Rat | | description | gene, allele |
| 2290091 | Slc24a3Tn(sb-T2/Bart3)2.178Mcwi | solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.178, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene | | | | Rat | | description | gene, allele |
| 2290073 | Slc24a3Tn(sb-T2/Bart3)2.188Mcwi | solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.188, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene | | | | Rat | | description | gene, allele |
| 2290127 | Slc24a4Tn(sb-T2/Bart3)2.145Mcwi | solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 ; transposon insertion 2.145, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a4 gene. | | | | Rat | | description | gene, allele |
| 5131979 | Slc30a8em1Mcwi | solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 464-480). | | | | Rat | | name , description | gene, allele |
| 5131981 | Slc30a8em2Mcwi | solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 462-478). | | | | Rat | | name , description | gene, allele |
| 5687699 | Slc34a1em1Mcwi | solute carrier family 34 (sodium phosphate), member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp deletion in exon 4 (del 425-436) | | | | Rat | | name , description | gene, allele |
| 5687736 | Slc6a12em1Mcwi | solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 53-bp deletion overlapping exon 2 (v3.4 del 157781847- 157781899) | | | | Rat | | name , description | gene, allele |
| 2302643 | Slc7a11Tn(sb-T2/Bart3)2.266Mcwi | solute carrier family 7 (cationic amino acid transporter, y+ system), member 11; transposon insertion 2.266, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene | | | | Rat | | description | gene, allele |
| 5687700 | Slc7a9em1Mcwi | solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 6 (del 745-751) | | | | Rat | | name , description | gene, allele |
| 5687701 | Slc7a9em2Mcwi | solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 746-755) | | | | Rat | | name , description | gene, allele |
| 2299117 | SnphTn(sb-T2/Bart3)2.214Mcwi | syntaphilin; transposon insertion 2.214, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene | | | | Rat | | description | gene, allele |
| 2302636 | Snx25Tn(sb-T2/Bart3)2.270Mcwi | sorting nexin 25; transposon insertion 2.270, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene | | | | Rat | | description | gene, allele |
| 5508343 | Sorcs2em1Mcwi | sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 34-bp frameshift deletion in exon 15 (del 1989-2022) | | | | Rat | | name , description | gene, allele |
| 5508326 | Sorcs2em4Mcwi | sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 15 (del 1991-1995) | | | | Rat | | name , description | gene, allele |
| 12790948 | Sorcs2em7Mcwi | sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp frameshift deletion in exon 15. | | | | Rat | | name , description | gene, allele |
| 12790952 | Sorcs2em9Mcwi | sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 9, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 15. | | | | Rat | | name , description | gene, allele |
| 5687731 | Sorcs3em1Mcwi | sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp insertion in exon 7 (del 1392-1419, ins. Gacgtggtagagcggtgcatcatgagttgtctctggatgcataggtacctgccacatcttgtaataacagcatggtactccgtcatgtgcatatatcttagctgcttc aaatgctccttaattccttgac) | | | | Rat | | name , description | gene, allele |
| 2301697 | Spata13Tn(sb-T2/Bart3)2.267Mcwi | spermatogenesis associated 13; transposon insertion 2.267, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene | | | | Rat | | description | gene, allele |
| 2305932 | Spta1Tn(sb-T2/Bart3)2.315Mcwi | spectrin, alpha, erythrocytic 1 (elliptocytosis 2); transposon insertion 2.315, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene | | | | Rat | | description | gene, allele |
| 2290097 | Sptbn4Tn(sb-T2/Bart3)2.179Mcwi | spectrin beta 4; transposon insertion 2.179, Medical College of Wisconsin | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene tra p construct into the 17th intron of the Sptbn4 gene. | | | | Rat | | description | gene, allele |
| 2290124 | Sptlc3Tn(sb-T2/Bart3)2.147Mcwi | similar to RIKEN cDNA C130053K05 gene; similar to dJ718P11.1.1 (novel class II aminotransferase similar to serine palmotyltransferase (isoform 1)) ; transposon insertion 2.147, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Sptlc3 gene. | | | | Rat | | description | gene, allele |
| 2292450 | Stxbp5lTn(sb-T2/Bart3)2.202Mcwi | syntaxin binding protein 5-like; transposon insertion 2.202, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene | | | | Rat | | description | gene, allele |
| 2292449 | Syndig1Tn(sb-T2/Bart3)2.171Mcwi | synapse differentiation inducing 1; transposon insertion 2.171, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene. | | | | Rat | | description | gene, allele |
| 2290153 | Syne1Tn(sb-T2/Bart3)2.68Mcwi | spectrin repeat containing, nuclear envelope 1; transposon insertion 2.68, Medical College of Wisconsin | This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene. | | | | Rat | | description | gene, allele |
| 2299101 | Tasp1Tn(sb-T2/Bart3)2.219Mcwi | taspase, threonine aspartase 1; transposon insertion 2.219, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene | | | | Rat | | description | gene, allele |
| 5509981 | Tcf7l2em1Mcwi | transcription factor 7-like 2 (T-cell specific, HMG-box); zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 169-bp deletion of exon5 and intron 5 (del 262106289 262106457) | | | | Rat | | name , description | gene, allele |
| 5508332 | Tfdp2em2Mcwi | transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 2, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 6 (del 620-632) | | | | Rat | | name , description | gene, allele |
| 5508334 | Tfdp2em5Mcwi | transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 5, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 618-633) | | | | Rat | | name , description | gene, allele |
| 6893417 | Tfdp2em6Mcwi | transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 6, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 6 (del 614-627) | | | | Rat | | name , description | gene, allele |
| 5131986 | Tgfb1em1Mcwi | transforming growth factor, beta 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 12-bp frameshift deletion in exon 3 (del 193-204). | | | | Rat | | name , description | gene, allele |
| 5131980 | Tgfb1em3Mcwi | transforming growth factor, beta 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 22-bp frameshift deletion in exon 3 (del 191-212). | | | | Rat | | name , description | gene, allele |
| 2290156 | Tmco1Tn(sb-T2/Bart3)2.135Mcwi | transmembrane and coiled-coil domains 1; transposon insertion 2.135, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene | | | | Rat | | description | gene, allele |
| 2311689 | Tmem22Tn(sb-T2/Bart3)2.332Mcwi | transmembrane protein 22; transposon insertion 2.332 Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene | | | | Rat | | description | gene, allele |
| 2302646 | Tmtc2Tn(sb-T2/Bart3)2.276Mcwi | transmembrane and tetratricopeptide repeat containing 2; transposon insertion 2.276, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene | | | | Rat | | description | gene, allele |
| 1308039 | Tp53bp1 | tumor protein p53 binding protein 1 | ENCODES a protein that exhibits histone H4K20me methyltransferase activity (ortholog); histone H4K20me2 reader activity (ortholog); histone reader activity (ortholog); INVOLVED IN cellular response to X-ray; DNA damage response (ortholog); double-strand break repair via classical nonhomologous end j oining (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; histone modification pathway; non-homologous end joining pathway of double-strand break repair; ASSOCIATED WITH Breast Neoplasms (ortholog); Colonic Neoplasms (ortholog); glioblastoma (ortholog); FOUND IN chromosome, telomeric region (ortholog); cytoplasm (ortholog); nuclear body (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; all-trans-retinoic acid; atrazine | 3 | 128620320 | 128724716 | Rat | 242 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 5508352 | Trafd1em1Mcwi | TRAF type zinc finger domain containing 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 5 (del 440-452) | | | | Rat | | name , description | gene, allele |
| 2299099 | TrdnTn(sb-T2/Bart3)2.238Mcwi | triadin; transposon insertion 2.238, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene | | | | Rat | | description | gene, allele |
| 1306607 | Trip12 | thyroid hormone receptor interactor 12 | ENCODES a protein that exhibits nuclear thyroid hormone receptor binding (ortholog); ubiquitin protein ligase activity (ortholog); INVOLVED IN DNA repair-dependent chromatin remodeling (ortholog); heterochromatin boundary formation (ortholog); protein polyubiquitination (ortholog); PARTICIPATES IN a taxia telangiectasia-mutated (ATM) signaling pathway; ubiquitin/proteasome degradation pathway; ASSOCIATED WITH Clark-Baraitser syndrome (ortholog); Developmental Disease (ortholog); genetic disease (ortholog); FOUND IN nucleoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 9 | 93364791 | 93491015 | Rat | 148 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 127285812 | Trpa1em1Gne | transient receptor potential cation channel, subfamily A, member 1;CRISPR/Cas9 induced mutant 1, Gne | ASSOCIATED WITH asthma | | | | Rat | 1 | name | gene, allele |
| 11553891 | Trpc3em1Mcwi | transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 1, Medical college of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene. | | | | Rat | | name , description | gene, allele |
| 11553887 | Trpc3em2Mcwi | transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene. | | | | Rat | | name , description | gene, allele |
| 126848808 | Trpc4Tn(sb)Tngen | transient receptor potential cation channel, subfamily C, member 4; sleeping beauty induced mutant, Tngen | ASSOCIATED WITH abnormal acquisiton of operant behavior for a cocaine reinforcer; ASSOCIATED WITH Pulmonary Arterial Hypertension | | | | Rat | 3 | name | gene, allele |
| 2290060 | Trpc4Tn(sb-T2/Bart3)2.192Mcwi | transient receptor potential cation channel, subfamily C, member 4; transposon insertion 2.192, Medical College of Wisconsin | ASSOCIATED WITH Visceral Pain | | | | Rat | 1 | description | gene, allele |
| 11553911 | Trpc6em1Mcwi | transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin | ASSOCIATED WITH decreased body weight; decreased creatinine clearance; glomerulosclerosis; ASSOCIATED WITH Diabetic Nephropathies | | | | Rat | 7 | name , description | gene, allele |
| 11553901 | Trpc6em3Mcwi | transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene. | | | | Rat | | name , description | gene, allele |
| 11553898 | Trpv2em1Mcwi | transient receptor potential cation channel, subfamily V, member 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. | | | | Rat | | name , description | gene, allele |
| 11553851 | Trpv4em4Mcwi | transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin | This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene | | | | Rat | | name , description | gene, allele |
| 12791989 | Tsc2Eker | tuberous sclerosis 2;Eker renal cell carcinoma | This allele is a spontaneously nonsense mutant found in a renal cell carcinoma diseased Long-Evans rat. The mutation was genome insertion that creates a premature stop coden in the protein sequence. | | | | Rat | | description | gene, allele |
| 5509987 | Ube2q2em3Mcwi | ubiquitin-conjugating enzyme E2Q family member 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 7. | | | | Rat | | name , description | gene, allele |
| 2299109 | Ubqln4Tn(sb-T2/Bart3)2.230Mcwi | ubiquilin 4; transposon insertion 2.230, Medical College of Wisconsin | this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene | | | | Rat | | description | gene, allele |
| 621236 | Ubr5 | ubiquitin protein ligase E3 component n-recognin 5 | ENCODES a protein that exhibits protein domain specific binding; ubiquitin protein ligase activity; ubiquitin binding (ortholog); INVOLVED IN protein ubiquitination; cytoplasm protein quality control (ortholog); cytoplasm protein quality control by the ubiquitin-proteasome system (ortholog); PARTICI PATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; ubiquitin/proteasome degradation pathway; ASSOCIATED WITH breast cancer (ortholog); colon adenocarcinoma (ortholog); colon cancer (ortholog); FOUND IN chromatin (ortholog); cytoplasm (ortholog); cytosol (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene; 3H-1,2-dithiole-3-thione | 7 | 71000197 | 71109841 | Rat | 180 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 5143968 | Ulk3em1Mcwi | unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 546-555) | | | | Rat | | name , description | gene, allele |
| 5143971 | Ulk3em4Mcwi | unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 4, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is an 88-bp frameshift deletion in exon 5 (del 476-563) | | | | Rat | | name , description | gene, allele |
| 5508340 | Ulk4em3Mcwi | unc-51-like kinase 4 (C. elegans); zinc finger nuclease induced mutant 3, Medical College of Wisconsin | This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 15 and intron 15 (del 126242938 126242951) | | | | Rat | | name , description | gene, allele |
| 1307192 | Usp16 | ubiquitin specific peptidase 16 | ENCODES a protein that exhibits cysteine-type deubiquitinase activity (ortholog); cysteine-type endopeptidase activity (ortholog); histone binding (ortholog); INVOLVED IN DNA damage response (ortholog); monoubiquitinated protein deubiquitination (ortholog); positive regulation of DNA-templated trans cription (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; histone modification pathway; FOUND IN cytoplasm (ortholog); nucleus (ortholog); INTERACTS WITH (+)-schisandrin B; 2,6-dinitrotoluene; 3-chloropropane-1,2-diol | 11 | 40166651 | 40196792 | Rat | 149 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1308852 | Usp3 | ubiquitin specific peptidase 3 | ENCODES a protein that exhibits promoter-specific chromatin binding; RNA polymerase II cis-regulatory region sequence-specific DNA binding; cysteine-type deubiquitinase activity (ortholog); INVOLVED IN negative regulation of transcription by RNA polymerase II; DNA repair (ortholog); DNA repair-depen dent chromatin remodeling (ortholog); PARTICIPATES IN ataxia telangiectasia-mutated (ATM) signaling pathway; histone modification pathway; ASSOCIATED WITH atrial fibrillation (ortholog); lymphopenia (ortholog); neutropenia (ortholog); FOUND IN chromatin (ortholog); nucleoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 6-propyl-2-thiouracil | 8 | 75973278 | 76049151 | Rat | 118 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1308216 | Usp44 | ubiquitin specific peptidase 44 | ENCODES a protein that exhibits cysteine-type deubiquitinase activity (ortholog); deubiquitinase activity (ortholog); INVOLVED IN antiviral innate immune response (ortholog); chromosome segregation (ortholog); negative regulation of mitotic metaphase/anaphase transition (ortholog); PARTICIPATES IN a taxia telangiectasia-mutated (ATM) signaling pathway; histone modification pathway; FOUND IN fibrillar center (ortholog); nucleus (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; alpha-Zearalanol; amphetamine | 7 | 30251142 | 30301185 | Rat | 99 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 621595 | Vcp | valosin-containing protein | ENCODES a protein that exhibits ADP binding; ATP binding; ATP hydrolysis activity; INVOLVED IN endoplasmic reticulum to Golgi vesicle-mediated transport; ERAD pathway; positive regulation of ubiquitin-dependent protein catabolic process; PARTICIPATES IN ataxia telangiectasia-mut :700;'>mutated (ATM) signaling pathway; Endoplasmic Reticulum-associated degradation pathway; ASSOCIATED WITH Alzheimer's disease (ortholog); amyotrophic lateral sclerosis (ortholog); amyotrophic lateral sclerosis type 1 (ortholog); FOUND IN cytosol; glutamatergic synapse; VCP-NPL4-UFD1 AAA ATPase complex; INTERACTS WITH 1,2,4-trimethylbenzene; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 5 | 62005984 | 62025387 | Rat | 465 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
