Sorcs2<sup>em7Mcwi</sup> (sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Sorcs2em7Mcwi (sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Sorcs2em7Mcwi
Name: sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin
RGD ID: 12790948
Description: This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp frameshift deletion in exon 15.
Type: allele  of Sorcs2  
Previously known as: Sorcs2^[em7Mcwi]; Sorcs2em7Mcwi
Is Marker For: Strains:   SS-Sorcs2em7Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


References

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Sorcs2em7Mcwi-var1 chr14 74711190 74711222 TTCCGCTCTGACTGGGAGCTGGTCAAGGTGGAC - deletion mRatBN7.2

Related Rat Strains
The following Strains have been annotated to Sorcs2em7Mcwi


Expression


Sequence

Nucleotide Sequences


Additional Information