Abcc6<sup>em4Qlju</sup> (ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Abcc6em4Qlju (ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li) Rattus norvegicus
Analyze
Symbol: Abcc6em4Qlju
Name: ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li
RGD ID: 10413848
Description: This mutation was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG).
ASSOCIATED WITH pseudoxanthoma elasticum
Type: allele  of Abcc6  
Previously known as: Abcc6^[em4Qlju]; Abcc6em4Qlju
Is Marker For: Strains:   SD-Abcc6em4Qlju-/-  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map1 RGD


Disease Annotations     Click to see Annotation Detail View

References

References - curated
# Reference Title Reference Citation
1. Abcc6 Knockout Rat Model Highlights the Role of Liver in PPi Homeostasis in Pseudoxanthoma Elasticum. Li Q, etal., J Invest Dermatol. 2017 May;137(5):1025-1032. doi: 10.1016/j.jid.2016.11.042. Epub 2017 Jan 19.
2. Data registered by Dr. Qiaoli Li's group Personal communication between Dr. Qiaoli Li's group and the RGD curators.

Genomics


Related Rat Strains
The following Strains have been annotated to Abcc6em4Qlju
SD-Abcc6em4Qlju-/-    


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_031013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information