D1Rat237 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D1Rat237

Symbol: D1Rat237
Previously known as: oxsts6640; R0052-D03; 
RGD ID: 37228
Expected Size: 141 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81181,189,038 - 181,189,179 (+)Marker Load Pipeline
mRatBN7.21171,754,764 - 171,754,905 (+)MAPPERmRatBN7.2
Rnor_6.01187,092,701 - 187,092,841NCBIRnor6.0
Rnor_5.01194,046,685 - 194,046,825UniSTSRnor5.0
RGSC_v3.41175,630,144 - 175,630,285RGDRGSC3.4
RGSC_v3.41175,630,145 - 175,630,285UniSTSRGSC3.4
RGSC_v3.11175,769,390 - 175,769,531RGD
Celera1169,553,513 - 169,553,653UniSTS
SHRSP x BN Map186.8799RGD
SHRSP x BN Map186.8799UniSTS
FHH x ACI Map181.06RGD
Cytogenetic Map1q35UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Xylt1  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines


 
Forward Primer CCTATACCCCTATGGCTCACTG
Reverse Primer CTGGCCCTTCACAAGGTCTA
 
Strain, Expected Size(s)

ACI/N 140 AVN/Orl 150 BBDP/Rhw 126
BBDR/Rhw 126 BC/CpbU 140 BDIX/Han 140
BDVII/Cub 140 BN-Lx/Cub 140 BP/Cub 140
BUF/Pit 140 COP/OlaHsd 140 DA/PitN 140
DON/Melb 140 F344/Pit 140 FHH/Eur 126
GH/Omr 126 GK/KyoSwe 144 IS/Kyo 148
LE/Mol 140 LEW/Pit 126 LH/Mav 140
LN/Mav 140 LOU/CHan 148 M520/N 140
MHS/Gib 126 MNR/N 126 MNRA/N 126
MNS/Gib 126 MR/Pit 126 NEDH/K 126
NP9 126 ODU/N 126 OKA/Wsl 150
OM/Ztm 148 P5C 148 PVG/Pit 140
SD/Rij 140 SHR/OlaHsd 150 SHRSP/Riv 150
SR/Jr 140 SS/Jr 140 WAG/RijKyo 148
WF/Pit 140 WIST/Nhg 150 WKY/OlaHsd 126
WN/N 148 WTC/Kyo 152


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
620093Xylt1xylosyltransferase 11171643925171929774Rat
GenBank Nucleotide CH473956 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 82 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat

1 to 10 of 82 rows


Database
Acc Id
Source(s)
NCBI Gene 64133 UniSTS