D7Mgh3 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D7Mgh3

Symbol: D7Mgh3
Previously known as: oxsts9185; IID3G; 
RGD ID: 10448
Expected Size: 244 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.27113,915,925 - 113,916,171 (+)MAPPERmRatBN7.2
Rnor_6.07123,632,617 - 123,632,860NCBIRnor6.0
Rnor_5.07123,617,206 - 123,617,822UniSTSRnor5.0
RGSC_v3.47120,776,677 - 120,777,243UniSTSRGSC3.4
Celera7110,231,022 - 110,231,355UniSTS
RH 3.4 Map7894.9UniSTS
RH 3.4 Map7894.9RGD
RH 2.0 Map7678.1RGD
FHH x ACI Map753.35RGD
Cytogenetic Map7q34UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr  
Genes:   Cyp2d3  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer CGGCATGTGTCTCTGTGTG
Reverse Primer TGACTTCTGGTGTCCTCACG
 
Strain, Expected Size(s)

AVN/Orl 242 BBDP/Rhw 242 BBDR/Rhw 242
BC/CpbU 242 BDIX/Han 242 BDVII/Cub 242
BN-Lx/Cub 242 BN/SsNHsd 242 BP/Cub 242
BUF/Pit 234 DA/PitN 234 DON/Melb 234
F344/Pit 234 FHH/Eur 242 GH/Omr 242
GK/KyoSwe 242 IS/Kyo 244 LE/Mol 242
LEW/Pit 242 LH/Mav 242 LN/Mav 242
LOU/CHan 242 M520/N 234 MHS/Gib 242
MNR/N 242 MNRA/N 242 MNS/Gib 242
MR/Pit 242 NEDH/K 242 NP9 242
ODU/N 232 OKA/Wsl 232 OM/Ztm 242
P5C 242 PVG/Pit 234 SD/Rij 242
SHR/OlaHsd 232 SHRSP/Riv 232 SR/Jr 234
SS/Jr 242 WAG/RijKyo 242 WF/Pit 242
WIST/Nhg 242 WKY/OlaHsd 232 WN/N 242
WTC/Kyo 232


GenBank Nucleotide X52028 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 32 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
1357336Gluco6Glucose level QTL 63.4blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)794811326116294265Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
70159Bp61Blood pressure QTL 610.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7103146217116738842Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat

1 to 10 of 32 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 24303 UniSTS
NCBI Nucleotide X52028