D3Arb24 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D3Arb24

Symbol: D3Arb24
Previously known as: oxsts7853; R0265-D08; 
RGD ID: 42134
Expected Size: 240 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.23161,935,834 - 161,936,089 (+)MAPPERmRatBN7.2
Rnor_6.03171,219,515 - 171,219,769NCBIRnor6.0
Rnor_5.03177,284,362 - 177,284,616UniSTSRnor5.0
RGSC_v3.43164,017,988 - 164,018,243RGDRGSC3.4
RGSC_v3.43164,017,989 - 164,018,243UniSTSRGSC3.4
RGSC_v3.13163,924,024 - 163,924,279RGD
Celera3161,124,103 - 161,124,357UniSTS
RH 2.0 Map31012.8RGD
Cytogenetic Map3q42UniSTS
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Pck1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
5. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CACGTTAGCTGTAGCAGTTAGC
Reverse Primer ACTAGCAACAAAGCAACACG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3267Pck1phosphoenolpyruvate carboxykinase 13161930256161936205Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2301411Bp320Blood pressure QTL 3200.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)3145925360166177555Rat
12879876Bw182Body weight QTL 1820.003body mass (VT:0001259)body weight (CMO:0000012)3145925360166177555Rat
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
12879872Cm97Cardiac mass QTL 970.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3145925360166177555Rat
1578653Vnigr3Vascular neointimal growth QTL 33.1artery morphology trait (VT:0002191)artery neointimal hyperplastic lesion area (CMO:0001414)3130656562169034231Rat
1598877Bp285Blood pressure QTL 2851.50.03arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3120538241165538241Rat
12879873Cm96Cardiac mass QTL 960.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)3145925360166177555Rat
12879874Cm98Cardiac mass QTL 980.005heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)3145925360166177555Rat
1298068Bp167Blood pressure QTL 1670.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3141074471169034231Rat
12879875Kidm64Kidney mass QTL 640.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3145925360166177555Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
2298477Eau4Experimental allergic uveoretinitis QTL 40.0011uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)3137398739169034231Rat
1300161Rf10Renal function QTL 103.57renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)3161192952169034231Rat
8552791Vie2Viral induced encephalitis QTL 24.1brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)3145956084169034231Rat
2317883Alcrsp26Alcohol response QTL 261.80.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)3145526770169034231Rat
1331726Bp208Blood pressure QTL 2083.129arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)3141339013162184794Rat
9589106Insul23Insulin level QTL 2313.860.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)3131635904169034231Rat
10755461Coatc16Coat color QTL 16coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)3122438700167438700Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
2303620Vencon4Ventilatory control QTL 43.9respiration trait (VT:0001943)tidal volume (CMO:0000222)3127162703168026850Rat
1576306Schws3Schwannoma susceptibility QTL 30.001nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)3118839124163839124Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)398535255168026850Rat
1578666Vnigr1Vascular neointimal growth QTL 14.6artery morphology trait (VT:0002191)artery lumen area (CMO:0001409)3149040888168026850Rat
1578656Vnigr2Vascular neointimal growth QTL 24.2artery morphology trait (VT:0002191)lesioned artery residual lumen area (CMO:0001417)3130656562169034231Rat
8552952Pigfal13Plasma insulin-like growth factor 1 level QTL 13blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)3138799500169034231Rat
12879871Am7Aortic mass QTL 70.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)3145925360166177555Rat
631541Bp81Blood pressure QTL 814arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3124122556169034231Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)398535255168026850Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 362282 UniSTS
NCBI Nucleotide K03248