D2Rat296 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Rat296

Symbol: D2Rat296
Previously known as: oxsts10556; R0093-A06; 
RGD ID: 39526
Expected Size: 200 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22230,469,531 - 230,469,773 (+)MAPPERmRatBN7.2
Rnor_6.02247,331,943 - 247,332,273NCBIRnor6.0
Rnor_5.02265,860,605 - 265,860,935UniSTSRnor5.0
RGSC_v3.42239,654,588 - 239,654,790RGDRGSC3.4
RGSC_v3.42239,654,589 - 239,654,790UniSTSRGSC3.4
RGSC_v3.12239,641,328 - 239,641,530RGD
Celera2222,525,569 - 222,525,770UniSTS
SHRSP x BN Map298.7698RGD
SHRSP x BN Map298.7698UniSTS
Cytogenetic Map2q44UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Unc5c  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGACTCCAGTTACCCAAAGC
Reverse Primer ATATACCTGCATGCATGCACAC
 
Template
GCAAGTTGCATGCTGCAGGTCGACTCTAGAGGATCCCCACACTAAGGTAAAAATATGTCCATGT
TCAAAATTAAGGAACATGTTAGTATTTCCATACTACGCAGTCAACTATATATCGACTCCAGTTA
CCCAAAGCAATGATATTTGCTTTGCTGCAGATCATCAATTATGTGCTTGTTACTTAAAGTGCTA
GCACATATGTGTGTGTATGTTTGTCTGTGTGAGTGTATGTATGTGTATGTGTATACATGCACAC
GTTTGTATGCATGTGTGTATGTGTGTGTTCATTTGTGTGTGTGCATGCATGCAGGTATATATAT
GTGTGCATCTGTGTGCATGCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGGT
ACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACA
ATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCT
AACTCACATTAATTGCGGTCGCTCACTGCGCGCTTTCAGTCGGGAAACTGTCGTGNCANTCATT
AATGNAACGCNANCCGGGGAGAGGNC

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
735109Unc5cunc-5 netrin receptor C2230180353230535219Rat

Nucleotide Sequences
GenBank Nucleotide CH473952 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000232 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631563Hcuc3Hepatic copper content QTL 33.87liver copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)2229059610249053267Rat
1331767Hrtrt12Heart rate QTL 123.373heart pumping trait (VT:2000009)heart rate (CMO:0000002)2218414747240841241Rat
1598813Memor9Memory QTL 92.7exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)2199341726234244620Rat
8693697Alc36Alcohol consumption QTL 3620.592drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)2217139753236660713Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2211744537249053267Rat
2293833Kiddil8Kidney dilation QTL 82.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2219753301247136170Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2200990457245990457Rat
2298479Eau5Experimental allergic uveoretinitis QTL 50.0021uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)2202446871237938339Rat
1300126Bp175Blood pressure QTL 1753.46arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2214226044247136170Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2211744537249053267Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2211744537249053267Rat
2313073Bmd75Bone mineral density QTL 754.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)2215377404237938339Rat
8693622Alc26Alcohol consumption QTL 262.40.667drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)2221136523241305619Rat
7411555Bw132Body weight QTL 1320.001body mass (VT:0001259)body weight gain (CMO:0000420)2223389739249053267Rat
61366Iddm3Insulin dependent diabetes mellitus QTL 34.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2189599258234599258Rat
61398Bp50Blood pressure QTL 504.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189599258234599258Rat
9587428Epfw6Epididymal fat weight QTL 67.470.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)2223389739249053267Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2211744537249053267Rat
2293844Kiddil7Kidney dilation QTL 73.5kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2219753301247136170Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2193452645245889826Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2211744537249053267Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
2317885Alcrsp28Alcohol response QTL 282.10.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2212828222249053267Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 362049 UniSTS