D1Rat108 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D1Rat108

Symbol: D1Rat108
Previously known as: oxsts6536; R043-D10; R0043-D10; 
RGD ID: 36719
Expected Size: 148 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21179,773,921 - 179,774,069 (+)MAPPERmRatBN7.2
Rnor_6.01196,601,708 - 196,601,855NCBIRnor6.0
Rnor_5.01203,587,501 - 203,587,648UniSTSRnor5.0
RGSC_v3.41184,158,746 - 184,158,894RGDRGSC3.4
RGSC_v3.41184,158,747 - 184,158,894UniSTSRGSC3.4
RGSC_v3.11184,308,628 - 184,308,775RGD
Celera1177,450,933 - 177,451,080UniSTS
RH 2.0 Map1949.4RGD
FHH x ACI Map186.55RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer CCAGGGGATCCAGATTACCT
Reverse Primer GAGCATGCATTGGCTATTTG
 
Strain, Expected Size(s)

ACI/N 146 AVN/Orl 148 BBDP/Rhw 148
BBDR/Rhw 148 BC/CpbU 150 BDIX/Han 158
BDVII/Cub 190 BN-Lx/Cub 148 BN/SsNHsd 148
BP/Cub 148 BUF/Pit 148 COP/OlaHsd 146
DA/PitN 148 DON/Melb 148 F344/Pit 148
FHH/Eur 148 GH/Omr 148 GK/KyoSwe 148
IS/Kyo 146 LE/Mol 148 LEW/Pit 148
LH/Mav 148 LN/Mav 148 LOU/CHan 148
M520/N 146 MHS/Gib 148 MNR/N 152
MNRA/N 148 MNS/Gib 148 MR/Pit 148
NEDH/K 148 ODU/N 148 OKA/Wsl 148
OM/Ztm 148 P5C 148 PVG/Pit 148
SD/Rij 190 SHR/OlaHsd 148 SHRSP/Riv 148
SR/Jr 148 SS/Jr 148 WAG/RijKyo 148
WF/Pit 148 WIST/Nhg 148 WKY/OlaHsd 148
WN/N 148 WTC/Kyo 148


GenBank Nucleotide CH473956 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 85 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
61326Eae6Experimental allergic encephalomyelitis QTL 65.3body mass (VT:0001259)change in body weight (CMO:0002045)1172949660181830018Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat

1 to 10 of 85 rows