D11Rat29 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D11Rat29

Symbol: D11Rat29
Previously known as: oxsts6044; R028-B11; R0028-B11; 
RGD ID: 35989
Expected Size: 145 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21113,427,157 - 13,427,302 (+)MAPPERmRatBN7.2
mRatBN7.21113,427,157 - 13,427,540 (+)MAPPERmRatBN7.2
Rnor_6.01111,973,922 - 11,974,347NCBIRnor6.0
Rnor_6.01111,973,922 - 11,974,066NCBIRnor6.0
Rnor_5.01115,641,476 - 15,641,901UniSTSRnor5.0
Rnor_5.01115,641,476 - 15,641,620UniSTSRnor5.0
RGSC_v3.41113,564,620 - 13,564,765RGDRGSC3.4
RGSC_v3.41113,564,621 - 13,564,765UniSTSRGSC3.4
RGSC_v3.11113,564,620 - 13,564,765RGD
Celera1113,446,422 - 13,446,566UniSTS
RH 2.0 Map11648.1RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer GGCTTTCAGAAGGAAATTGG
Reverse Primer GGAAAGGTTAGATTGGGGGA
 
Strain, Expected Size(s)

ACI/N 146 AVN/Orl 146 BBDP/Rhw 150
BBDR/Rhw 150 BC/CpbU 146 BDIX/Han 146
BDVII/Cub 146 BN-Lx/Cub 148 BN/SsNHsd 148
BP/Cub 150 BUF/Pit 146 COP/OlaHsd 150
DA/PitN 146 DON/Melb 146 F344/Pit 146
FHH/Eur 144 GH/Omr 154 GK/KyoSwe 146
IS/Kyo 146 LE/Mol 150 LEW/Pit 146
LH/Mav 148 LN/Mav 148 LOU/CHan 146
M520/N 146 MHS/Gib 146 MNR/N 146
MNRA/N 146 MNS/Gib 150 MR/Pit 146
NEDH/K 150 NP9 150 ODU/N 146
OKA/Wsl 160 OM/Ztm 148 P5C 150
PVG/Pit 150 SD/Rij 146 SHR/OlaHsd 146
SHRSP/Riv 146 SR/Jr 148 SS/Jr 146
WAG/RijKyo 146 WF/Pit 150 WIST/Nhg 146
WKY/OlaHsd 146 WN/N 146 WTC/Kyo 146


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
620167Robo2roundabout guidance receptor 2111252894914096726Rat
GenBank Nucleotide CH473989 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
2290451Scl58Serum cholesterol level QTL 583.48blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)111283104625121472Rat
1598842Glom10Glomerulus QTL 103.4kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)11135331169Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
634341Bw121Body weight QTL 1213.56abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)11121836709Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11843667453436674Rat