D1Rat287 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D1Rat287

Symbol: D1Rat287
Previously known as: oxsts6658; R0107-B03; 
RGD ID: 41012
Expected Size: 194 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81194,786,607 - 194,786,801 (+)Marker Load Pipeline
mRatBN7.21185,356,336 - 185,356,530 (+)MAPPERmRatBN7.2
Rnor_6.01201,358,068 - 201,358,261NCBIRnor6.0
Rnor_5.01208,389,496 - 208,389,689UniSTSRnor5.0
RGSC_v3.41190,114,248 - 190,114,441UniSTSRGSC3.4
RGSC_v3.41190,114,247 - 190,114,441RGDRGSC3.4
RGSC_v3.11190,264,129 - 190,264,322RGD
Celera1182,970,229 - 182,970,422UniSTS
RH 3.4 Map11421.0UniSTS
RH 3.4 Map11421.0RGD
SHRSP x BN Map194.8RGD
SHRSP x BN Map194.8UniSTS
Cytogenetic Map1q37UniSTS
Is Marker For: Strains:   AVN/Orl   BBDR/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   FHH.FHH.1BN-(D1Rat287-D1Rat84)/Mcwi  
QTLs:   Hrtrt20   Glom18   Cm80  
Genes:   Btbd16  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines


 
Forward Primer GGGCGTGACCAGGTTACTTA
Reverse Primer GTGCTATGGTGGGCAAGTTT
 
Strain, Expected Size(s)

ACI/N 194 AVN/Orl 194 BBDR/Rhw 206
BC/CpbU 204 BDIX/Han 204 BN-Lx/Cub 194
BN/SsNHsd 194 BP/Cub 194 BUF/Pit 210
COP/OlaHsd 194 DA/PitN 194 DON/Melb 194
F344/Pit 194 FHH/Eur 206 GH/Omr 204
GK/KyoSwe 194 IS/Kyo 196 LE/Mol 206
LEW/Pit 194 LH/Mav 204 LN/Mav 204
LOU/CHan 194 M520/N 194 MHS/Gib 194
MNR/N 194 MNRA/N 204 MNS/Gib 194
MR/Pit 204 NEDH/K 204 NP9 206
ODU/N 210 OKA/Wsl 194 OM/Ztm 204
P5C 206 PVG/Pit 204 SD/Rij 204
SHR/OlaHsd 210 SHRSP/Riv 210 SR/Jr 204
SS/Jr 204 WAG/RijKyo 204 WF/Pit 198
WIST/Nhg 194 WKY/OlaHsd 210 WN/N 200
WTC/Kyo 210


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
1311454Btbd16BTB domain containing 161185334971185389518Rat
GenBank Nucleotide AC128103 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC131965 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 84 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1302787Stl25Serum triglyceride level QTL 252.70.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1180359209210702199Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat

1 to 10 of 84 rows


Database
Acc Id
Source(s)
NCBI Gene 100303158 UniSTS
  100303442 UniSTS
  361658 UniSTS