D13Rat52 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D13Rat52

Symbol:

D13Rat52

Previously known as:

oxsts9495; R0073-A11;

RGD ID:

38450

Expected Size:

243 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	13	43,335,013 - 43,335,256 (+)	Marker Load Pipeline
mRatBN7.2	13	40,782,685 - 40,782,928 (+)	MAPPER	mRatBN7.2
Rnor_6.0	13	46,040,949 - 46,041,191	NCBI	Rnor6.0
Rnor_5.0	13	51,108,098 - 51,108,340	UniSTS	Rnor5.0
RGSC_v3.4	13	42,207,420 - 42,207,663	RGD	RGSC3.4
RGSC_v3.4	13	42,207,421 - 42,207,663	UniSTS	RGSC3.4
RGSC_v3.1	13	42,221,463 - 42,221,706	RGD
Celera	13	41,144,630 - 41,144,872	UniSTS
RH 2.0 Map	13	274.7	RGD

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	UniSTS Pipeline	RGD automated pipelines
3.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	TGCCAAGTATCCCTTTGGAC
Reverse Primer	CCTACACTGCCCCACATTCT

Strain Variation

Strain, Expected Size(s)

ACI/N	242
AVN/Orl	244
BBDP/Rhw	242
BBDR/Rhw	242
BC/CpbU	242
BDIX/Han	244
BDVII/Cub	244
BN-Lx/Cub	242
BN/SsNHsd	242
BP/Cub	244
BUF/Pit	242
COP/OlaHsd	242

DA/PitN	242
DON/Melb	242
F344/Pit	242
FHH/Eur	242
GH/Omr	242
GK/KyoSwe	242
LE/Mol	242
LEW/Pit	242
LH/Mav	242
LN/Mav	242
LOU/CHan	242
M520/N	242

MHS/Gib	242
MNR/N	242
MNRA/N	242
MNS/Gib	242
MR/Pit	242
NEDH/K	244
NP9	242
ODU/N	242
OKA/Wsl	246
OM/Ztm	246
P5C	246
PVG/Pit	242

SD/Rij	242
SHR/OlaHsd	246
SHRSP/Riv	246
SR/Jr	246
SS/Jr	242
WAG/RijKyo	242
WF/Pit	244
WIST/Nhg	242
WKY/OlaHsd	242
WN/N	242
WTC/Kyo	242

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1306938	Thsd7b	thrombospondin type 1 domain containing 7B	13	43320895	44219546	Rat

Nucleotide Sequences


GenBank Nucleotide	CH473958	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000243	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
9589141	Insul28	Insulin level QTL 28	10.82	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	13	11866254	56866254	Rat
1354655	Bp241	Blood pressure QTL 241	3.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	38975045	103588154	Rat
70220	Bp55	Blood pressure QTL 55	5.75		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	13	39924693	84924693	Rat
61391	Bp5	Blood pressure QTL 5	5.6		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	24853925	69853925	Rat
4889861	Pur29	Proteinuria QTL 29	13.8	0.005	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	13	39968211	83286298	Rat
1300163	Cardf1	Cardiac cell morphology QTL 1	4.18		aorta morphology trait (VT:0000272)	artery lesion measurement (CMO:0000975)	13	12448421	47969993	Rat
2317040	Aia21	Adjuvant induced arthritis QTL 21	2.75		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	13	12384320	57384320	Rat
631645	Bp121	Blood pressure QTL 121	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	17468282	62468282	Rat
2303030	Bp327	Blood pressure QTL 327			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	1	43736554	Rat
2317046	Aia8	Adjuvant induced arthritis QTL 8	3.9700000286102295		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	13	12384320	57384320	Rat
619615	Bp80	Blood pressure QTL 80		0.0354	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	7421791	87286911	Rat
61339	Bp24	Blood pressure QTL 24		0.05	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	6002008	47359539	Rat
1331784	Bp222	Blood pressure QTL 222	2.944		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	24335432	55601132	Rat
61340	Bp25	Blood pressure QTL 25	4.2	0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	37087983	82087983	Rat
1581573	Uae36	Urinary albumin excretion QTL 36			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	13	6002008	88706694	Rat
1549897	Stresp12	Stress response QTL 12	3.35		stress-related behavior trait (VT:0010451)	number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)	13	40983585	85983585	Rat
2302275	Gluco37	Glucose level QTL 37	3.8		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	13	12448421	48744906	Rat
7207885	Glom27	Glomerulus QTL 27	3.9		kidney glomerulus integrity trait (VT:0010546)	kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)	13	21120177	109350286	Rat
1558644	Cm45	Cardiac mass QTL 45	3.6	0.002	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	13	26244808	71244808	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	13	33794096	78794096	Rat
61349	Bp31	Blood pressure QTL 31	5.75		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	13	39924693	84924693	Rat
2303563	Bw89	Body weight QTL 89	6		body mass (VT:0001259)	body weight (CMO:0000012)	13	34834947	79834947	Rat
1354621	Rf47	Renal function QTL 47	3.7		kidney renin amount (VT:0010559)	kidney renin level (CMO:0002166)	13	11081740	103588154	Rat
2301962	Cm72	Cardiac mass QTL 72	4.12		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	13	33794096	60914504	Rat
1581554	Pur11	Proteinuria QTL 11			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	13	6002008	88706694	Rat
12879477	Bp401	Blood pressure QTL 401			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	39814726	84814726	Rat
1331750	Bp220	Blood pressure QTL 220	2.98		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	39968211	84968211	Rat
6893338	Cm76	Cardiac mass QTL 76	0	0.99	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	13	26244808	71244808	Rat
11530006	Niddm72	Non-insulin dependent diabetes mellitus QTL 72		0.001	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	13	38286298	83286298	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	1	103588154	Rat
9589164	Gluco66	Glucose level QTL 66	6.67	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	13	17711336	62711336	Rat
7411662	Foco29	Food consumption QTL 29	20.8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	13	11866254	56866254	Rat

Additional Information

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D13Rat52