D10Rat40 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D10Rat40

Symbol:

D10Rat40

Previously known as:

oxsts5971; R044-A01; R0044-A01;

RGD ID:

36721

Expected Size:

165 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	10	29,482,335 - 29,482,500 (+)	Marker Load Pipeline
mRatBN7.2	10	28,980,946 - 28,981,111 (+)	MAPPER	mRatBN7.2
Rnor_6.0	10	30,138,949 - 30,139,113	NCBI	Rnor6.0
Rnor_5.0	10	29,972,153 - 29,972,317	UniSTS	Rnor5.0
RGSC_v3.4	10	29,647,309 - 29,647,474	RGD	RGSC3.4
RGSC_v3.4	10	29,647,310 - 29,647,474	UniSTS	RGSC3.4
RGSC_v3.1	10	29,648,359 - 29,648,523	RGD
Celera	10	28,459,843 - 28,460,007	UniSTS
RH 3.4 Map	10	320.6	UniSTS
RH 3.4 Map	10	320.6	RGD
RH 2.0 Map	10	343.7	RGD
SHRSP x BN Map	10	30.6399	RGD

Is Marker For:

Strains: BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines
6.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	GCACCTACACACATGAGGGA
Reverse Primer	TCAGAGTTTGGAGTGCTCGA

Strain Variation

Strain, Expected Size(s)

ACI/N	175
BBDP/Rhw	175
BBDR/Rhw	175
BC/CpbU	175
BDIX/Han	175
BDVII/Cub	175
BN-Lx/Cub	167
BN/SsNHsd	167
BP/Cub	175
BUF/Pit	175
DA/PitN	173
DON/Melb	175

F344/Pit	175
FHH/Eur	175
GH/Omr	175
GK/KyoSwe	175
IS/Kyo	183
LE/Mol	175
LEW/Pit	175
LH/Mav	175
LN/Mav	175
LOU/CHan	175
M520/N	175
MNR/N	175

MNRA/N	175
MNS/Gib	175
MR/Pit	175
NEDH/K	175
ODU/N	175
OKA/Wsl	175
OM/Ztm	175
P5C	175
PVG/Pit	175
SD/Rij	175
SHR/OlaHsd	175
SHRSP/Riv	175

SR/Jr	175
SS/Jr	175
WAG/RijKyo	175
WF/Pit	175
WIST/Nhg	175
WKY/OlaHsd	175
WN/N	175
WTC/Kyo	175

Region

Nucleotide Sequences


GenBank Nucleotide	CH473948	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000240	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
631564	Apr3	Acute phase response QTL 3	3.9		blood interleukin-6 amount (VT:0008595)	plasma interleukin-6 level (CMO:0001927)	10	15776754	60776754	Rat
1298069	Bp168	Blood pressure QTL 168	5.5		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	10	27023535	98502431	Rat
724556	Pur2	Proteinuria QTL 2	5.5		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	10	22931373	91127454	Rat
2293669	Bmd33	Bone mineral density QTL 33	4.5	0.0001	femur strength trait (VT:0010010)	femoral neck polar moment of inertia (CMO:0001670)	10	27443787	72443787	Rat
8662860	Vetf10	Vascular elastic tissue fragility QTL 10			artery integrity trait (VT:0010639)	number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)	10	6660923	73950353	Rat
2313066	Bss63	Bone structure and strength QTL 63	1.4	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	10	5893811	50893811	Rat
631554	Bp133	Blood pressure QTL 133		0.005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	1250554	64349221	Rat
2313064	Bmd71	Bone mineral density QTL 71	0.9	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	10	5893811	50893811	Rat
61325	Aia5	Adjuvant induced arthritis QTL 5		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23948641	107713808	Rat
2293679	Bmd30	Bone mineral density QTL 30	3.5	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	27443787	72443787	Rat
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	14653541	59653541	Rat
1354587	Kidm21	Kidney mass QTL 21	3.3		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	10	15533012	73695498	Rat
634329	Pia15	Pristane induced arthritis QTL 15	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	24662123	73695339	Rat
1578761	Stresp21	Stress response QTL 21	3.3		thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	10	6877142	51877142	Rat
70224	Eae3	Experimental allergic encephalomyelitis QTL 3	4.1		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	10	27023535	61843633	Rat
2293680	Bss40	Bone structure and strength QTL 40	5.66	0.0001	femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	10	1	35730538	Rat
2298544	Neuinf9	Neuroinflammation QTL 9	4.6		nervous system integrity trait (VT:0010566)	spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)	10	19939207	64939207	Rat
61332	Eau3	Experimental allergic uveoretinitis QTL 3		0.004	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	10	18035782	63035782	Rat
10401803	Kidm50	Kidney mass QTL 50			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	10	922197	45922197	Rat
2317754	Glom25	Glomerulus QTL 25	3.5		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	10	2103708	47103708	Rat
2313081	Bss64	Bone structure and strength QTL 64	1.3	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	10	5893811	50893811	Rat
2298495	Eae23	Experimental allergic encephalomyelitis QTL 23	16.93		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis duration (CMO:0001424)	10	16175525	61175525	Rat
1598852	Anxrr19	Anxiety related response QTL 19	5.07		body movement coordination trait (VT:0005424)	number of rearing movements in an experimental apparatus (CMO:0001752)	10	18668419	63668419	Rat
2313087	Bmd80	Bone mineral density QTL 80	3.2	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	10	20110614	65110614	Rat
634327	Hc4	Hypercalciuria QTL 4	2.4		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	10	1	38832698	Rat
1581497	Esta1	Estrogen-induced thymic atrophy QTL 1			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	10	21833758	61843633	Rat
631531	Iresp2	Immunoglobin response QTL2	6.3		blood immunoglobulin E amount (VT:0002492)	serum immunoglobulin E level (CMO:0002101)	10	23422121	32490778	Rat
631530	Tls3	T-lymphoma susceptibility QTL 3	0	0.0001	thymus integrity trait (VT:0010555)	percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)	10	27587226	96099902	Rat
2289985	Bp305	Blood pressure QTL 305			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	29076978	74076978	Rat
2313095	Bss62	Bone structure and strength QTL 62	1.5	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	10	5893811	50893811	Rat
724527	Bp148	Blood pressure QTL 148		0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	28950353	73950353	Rat
631660	Hcar1	Hepatocarcinoma resistance QTL 1	3.4	0.0001	liver integrity trait (VT:0010547)	volume of individual liver tumorous lesion (CMO:0001078)	10	6661118	35509383	Rat
631532	Cm50	Cardiac mass QTL 50	6.6		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	10	18035782	63035782	Rat
2300171	Bmd58	Bone mineral density QTL 58	4.9	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	27443787	72443787	Rat
61354	Pia10	Pristane induced arthritis QTL 10		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23948641	107713808	Rat
631267	Cia20	Collagen induced arthritis QTL 20	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23948641	107713808	Rat
2293705	Bmd25	Bone mineral density QTL 25	7.1	0.0001	femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	10	27443787	72443787	Rat
1600371	Mcs21	Mammary carcinoma susceptibility QTL 21	3		mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	10	29377046	52699134	Rat
2301967	Cm73	Cardiac mass QTL 73	4.55		heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	14991535	86964295	Rat
631268	Cia21	Collagen induced arthritis QTL 21	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	14991535	107713808	Rat
2313104	Bss61	Bone structure and strength QTL 61	0.9	0.0001	tibia area (VT:1000281)	tibia midshaft cross-sectional area (CMO:0001717)	10	5893811	50893811	Rat
61427	Cia16	Collagen induced arthritis QTL 16	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	6864618	96620484	Rat
2316949	Gluco60	Glucose level QTL 60	3.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	14991535	107556066	Rat
2293652	Bmd22	Bone mineral density QTL 22	4.9	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	27443787	72443787	Rat
2313055	Bw96	Body weight QTL 96	3.6	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	10	20110614	65110614	Rat
631542	Bp82	Blood pressure QTL 82	6.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	27023535	99451848	Rat

Additional Information

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D10Rat40