D2Rat61 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Rat61

Symbol: D2Rat61
Previously known as: oxsts6882; R027-B07; R0027-B07; 
RGD ID: 35915
Expected Size: 198 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr82220,931,218 - 220,931,416 (+)Marker Load Pipeline
mRatBN7.21879,924,734 - 79,925,127 (+)MAPPERmRatBN7.2
Rnor_6.0268,865,414 - 68,866,454NCBIRnor6.0
Rnor_5.0288,594,475 - 88,595,515UniSTSRnor5.0
RGSC_v3.42227,150,051 - 227,150,248RGDRGSC3.4
RGSC_v3.42227,150,052 - 227,150,249UniSTSRGSC3.4
RGSC_v3.12227,136,731 - 227,136,928RGD
Celera2210,543,293 - 210,543,469UniSTS
RH 3.4 Map21546.8RGD
RH 3.4 Map21546.8UniSTS
RH 2.0 Map21129.9RGD
SHRSP x BN Map288.6498RGD
FHH x ACI Map2101.7399RGD
Cytogenetic Map2q42-q43UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   SS.SHR-(D2Rat61-D2Mco18)/Mco  
QTLs:   Uae6   Stl26   Bw48   Esta2   Uae32   Pur7   Cm49   Bmd10  
Genes:   Egf  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCTTTTCTCTGCTGATACATGAA
Reverse Primer AATGTCGAGAGTTTGCTGGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2542Egfepidermal growth factor2220893660220976331Rat

Nucleotide Sequences
GenBank Nucleotide CH473952 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000232 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1358356Srcrt1Stress Responsive Cort QTL13.66blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)2163997722225110681Rat
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2170656145239614549Rat
631563Hcuc3Hepatic copper content QTL 33.87liver copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)2212145502231732847Rat
631566Bp90Blood pressure QTL 900.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2149957381221199885Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2214404877251712708Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)267845370229470703Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)283465462229820014Rat
1300126Bp175Blood pressure QTL 1753.46arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2204795005249795005Rat
1581576Pur7Proteinuria QTL 70.0001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)280396178220931218Rat
1581578Cm49Cardiac mass QTL 494.90.01heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2145807215220931416Rat
1302789Stl26Serum triglyceride level QTL 263.10.0035blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)2206613059226891081Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)280396178220931218Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2196140964251540988Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2205135267250135267Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2214404877251712708Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2205135267250135267Rat
1358900Bw48Body weight QTL 484.88body mass (VT:0001259)body weight (CMO:0000012)2159440891220931218Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2188565047233565047Rat
1581499Esta2Estrogen-induced thymic atrophy QTL 2thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2192287802229609668Rat
9589044Scfw1Subcutaneous fat weight QTL 15.80.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)2184856304229856304Rat
8694435Bw166Body weight QTL 16614.080.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)2184856304229856304Rat
631203Gluco14Glucose level QTL 140.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)2209350500221678003Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2214404877251712708Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)283400752223709938Rat
1331745Bp203Blood pressure QTL 2034.377arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2192287802221089121Rat
8694194Abfw1Abdominal fat weight QTL 111.70.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)2184856304229856304Rat
61366Iddm3Insulin dependent diabetes mellitus QTL 34.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2192287802237287802Rat
1578671Bmd10Bone mineral density QTL 105.4femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)2175931416220931416Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2151869660251712708Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)280396034220931416Rat
2300189Bmd48Bone mineral density QTL 485.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)2182024327227024327Rat
8662843Vetf9Vascular elastic tissue fragility QTL 92.05thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2159440760228950743Rat
2301408Kidm36Kidney mass QTL 360.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2184482291229482291Rat
631501Bp101Blood pressure QTL 1012.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2205135267250135267Rat
1598813Memor9Memory QTL 92.7exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)2202029709236904960Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2210956252251712708Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2143344967251712708Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2143344967251712708Rat
2298479Eau5Experimental allergic uveoretinitis QTL 50.0021uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)2205135267225627153Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2214404877251712708Rat
2313073Bmd75Bone mineral density QTL 754.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)2218051934251712708Rat
738013Alc15Alcohol consumption QTL 154.10.00022consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)2186850607231850607Rat
61398Bp50Blood pressure QTL 504.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2192287802237287802Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2214404877251712708Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2151869660223841096Rat
61417Cia10Collagen induced arthritis QTL 103.4joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)2182635347227635347Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)283465462225110681Rat
2293833Kiddil8Kidney dilation QTL 82.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2220274283249795005Rat
8694383Bw158Body weight QTL 1587.690.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)2184856304229856304Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2203664411248664411Rat
2306901Bp337Blood pressure QTL 3370.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2166372086229820014Rat
2293844Kiddil7Kidney dilation QTL 73.5kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2220274283249795005Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302765 UniSTS
  100302820 UniSTS
  100302846 UniSTS
  100302847 UniSTS
  100303210 UniSTS
  100303343 UniSTS
  25313 UniSTS
  387449 UniSTS
  544410 UniSTS