D8Rat15 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D8Rat15

Symbol: D8Rat15
Previously known as: oxsts7416; R011-B02; R0011-B02; 
RGD ID: 35018
Expected Size: 148 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr88107,847,991 - 107,848,139 (+)Marker Load Pipeline
mRatBN7.2898,968,617 - 98,968,765 (+)MAPPERmRatBN7.2
Rnor_6.08106,394,231 - 106,394,378NCBIRnor6.0
Rnor_5.08105,836,600 - 105,836,747UniSTSRnor5.0
RGSC_v3.48103,548,728 - 103,548,876RGDRGSC3.4
RGSC_v3.48103,548,729 - 103,548,876UniSTSRGSC3.4
RGSC_v3.18103,568,183 - 103,568,331RGD
Celera898,380,264 - 98,380,411UniSTS
RH 2.0 Map8844.1RGD
SHRSP x BN Map860.66RGD
Cytogenetic Map8q31UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   LEW.SS-(D8Chm12-D8Rat15)/Ayd  
QTLs:   Bmd3   Bp316   Bmd55   Bmd39   Bp380   Am8   Bw183   Cm99   Cm100   Cm101   Kidm65  
Genes:   Nmnat3  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer GCTACTCCCCCAGTCCTGTT
Reverse Primer TTTACCTGGGAGTTTGGCAC
 
Strain, Expected Size(s)

ACI/N 146 AVN/Orl 154 BBDP/Rhw 146
BBDR/Rhw 148 BC/CpbU 146 BDIX/Han 146
BDVII/Cub 154 BN-Lx/Cub 154 BN/SsNHsd 150
BP/Cub 146 BUF/Pit 146 COP/OlaHsd 154
DA/PitN 146 DON/Melb 146 F344/Pit 146
FHH/Eur 146 GH/Omr 146 GK/KyoSwe 154
IS/Kyo 158 LE/Mol 146 LEW/Pit 154
LH/Mav 146 LN/Mav 146 LOU/CHan 154
M520/N 146 MHS/Gib 154 MNR/N 154
MNRA/N 154 MNS/Gib 154 MR/Pit 154
NEDH/K 146 NP9 146 ODU/N 154
OKA/Wsl 154 OM/Ztm 152 P5C 146
PVG/Pit 146 SD/Rij 154 SHR/OlaHsd 154
SHRSP/Riv 154 SR/Jr 146 SS/Jr 146
WAG/RijKyo 154 WF/Pit 154 WIST/Nhg 154
WKY/OlaHsd 154 WN/N 154 WTC/Kyo 154


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
1309140Nmnat3nicotinamide nucleotide adenylyltransferase 389889216899003912Rat
GenBank Nucleotide JH616520.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 44 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
12879878Bw183Body weight QTL 1830.001body mass (VT:0001259)body weight (CMO:0000012)84329616998968765Rat
1300177Cm2Cardiac mass QTL 23.65heart mass (VT:0007028)heart weight (CMO:0000017)854259986100382532Rat
1549909Stresp11Stress response QTL 116.830.0019stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)873473045118473045Rat
12879879Cm99Cardiac mass QTL 990.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)84329616998968765Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)871888757116888757Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)830848154101699754Rat
12879880Cm100Cardiac mass QTL 1000.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)84329616998968765Rat
12879881Cm101Cardiac mass QTL 1010.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)84329616998968765Rat
12879882Am8Aortic mass QTL 80.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)84329616998968765Rat

1 to 10 of 44 rows


Database
Acc Id
Source(s)
NCBI Gene 100302795 UniSTS
  100302974 UniSTS
  100303276 UniSTS
  100303294 UniSTS
  363118 UniSTS