Symbol:
Mir145
Name:
microRNA 145
RGD ID:
2325565
Description:
Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Involved in several processes, including positive regulation of vascular associated smooth muscle cell differentiation involved in phenotypic switching; response to ischemia; and retina layer formation. Predicted to be located in extracellular exosome. Predicted to be part of RISC complex. Used to study glaucoma and myocardial infarction. Biomarker of biliary atresia; congestive heart failure; diabetes mellitus; liver disease (multiple); and pulmonary hypertension. Orthologous to human MIR145 (microRNA 145); INTERACTS WITH aflatoxin B1; atrazine; bleomycin A2.
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
microRNA mir-145; rno-mir-145
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 57,369,983 - 57,370,070 (-) NCBI GRCr8 mRatBN7.2 18 55,099,640 - 55,099,727 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 55,099,640 - 55,099,727 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 57,193,356 - 57,193,443 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 57,907,967 - 57,908,054 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 55,723,506 - 55,723,593 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 56,969,907 - 56,969,994 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 56,969,907 - 56,969,994 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 56,198,820 - 56,198,907 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 18 53,250,138 - 53,250,225 (-) NCBI Celera Cytogenetic Map 18 q12.1 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
1.
MiR-145 facilitates proliferation and migration of endothelial progenitor cells and recanalization of arterial thrombosis in cerebral infarction mice via JNK signal pathway.
Chen R, etal., Int J Clin Exp Pathol. 2015 Oct 1;8(10):13770-6. eCollection 2015.
2.
Long noncoding RNA myocardial infarction associated transcript promotes the development of thoracic aortic by targeting microRNA-145 via the PI3K/Akt signaling pathway.
Chen S, etal., J Cell Biochem. 2019 Sep;120(9):14405-14413. doi: 10.1002/jcb.28695. Epub 2019 Apr 15.
3.
MicroRNA-145, a novel smooth muscle cell phenotypic marker and modulator, controls vascular neointimal lesion formation.
Cheng Y, etal., Circ Res. 2009 Jul 17;105(2):158-66. doi: 10.1161/CIRCRESAHA.109.197517. Epub 2009 Jun 18.
4.
miR-145 attenuates cardiac fibrosis through the AKT/GSK-3β/β-catenin signaling pathway by directly targeting SOX9 in fibroblasts.
Cui S, etal., J Cell Biochem. 2021 Feb;122(2):209-221. doi: 10.1002/jcb.29843. Epub 2020 Sep 5.
5.
Circulatory microRNA-145 expression is increased in cerebral ischemia.
Gan CS, etal., Genet Mol Res. 2012 Jan 27;11(1):147-52. doi: 10.4238/2012.January.27.1.
6.
Plasma Levels of microRNA-145 Are Associated with Severity of Coronary Artery Disease.
Gao H, etal., PLoS One. 2015 May 4;10(5):e0123477. doi: 10.1371/journal.pone.0123477. eCollection 2015.
7.
Long noncoding RNA MALAT1 mediates cardiac fibrosis in experimental postinfarct myocardium mice model.
Huang S, etal., J Cell Physiol. 2019 Mar;234(3):2997-3006. doi: 10.1002/jcp.27117. Epub 2018 Aug 26.
8.
MicroRNA-145 post-transcriptionally regulates the expression and function of P-glycoprotein in intestinal epithelial cells.
Ikemura K, etal., Mol Pharmacol. 2013 Feb;83(2):399-405. doi: 10.1124/mol.112.081844. Epub 2012 Nov 19.
9.
Circular RNA Sirtuin1 represses pulmonary artery smooth muscle cell proliferation, migration and autophagy to ameliorate pulmonary hypertension via targeting microRNA-145-5p/protein kinase-B3 axis.
Jing X, etal., Bioengineered. 2022 Apr;13(4):8759-8771. doi: 10.1080/21655979.2022.2036302.
10.
Associations Between miRNAs and Two Different Cancers: Breast and Colon.
Kundaktepe BP, etal., Cancer Manag Res. 2020 Feb 7;12:871-879. doi: 10.2147/CMAR.S227628. eCollection 2020.
11.
P38 MAPK Signaling Pathway Mediates Angiotensin II-Induced miR143/145 Gene Cluster Downregulation during Aortic Dissection Formation.
Li B, etal., Ann Vasc Surg. 2017 Apr;40:262-273. doi: 10.1016/j.avsg.2016.09.016. Epub 2017 Feb 4.
12.
Investigation of the clinical significance and prognostic value of microRNA-145 in human hepatocellular carcinoma.
Li P, etal., Medicine (Baltimore). 2018 Dec;97(51):e13715. doi: 10.1097/MD.0000000000013715.
13.
MicroRNA-145 protects cardiomyocytes against hydrogen peroxide (H(2)O(2))-induced apoptosis through targeting the mitochondria apoptotic pathway.
Li R, etal., PLoS One. 2012;7(9):e44907. doi: 10.1371/journal.pone.0044907. Epub 2012 Sep 18.
14.
Regulatory Mechanism of MicroRNA-145 in the Pathogenesis of Acute Aortic Dissection.
Li T, etal., Yonsei Med J. 2019 Apr;60(4):352-359. doi: 10.3349/ymj.2019.60.4.352.
15.
Effects of flavonoids on MicroRNA 145 regulation through Klf4 and myocardin in neointimal formation in vitro and in vivo.
Lin CM, etal., J Nutr Biochem. 2018 Feb;52:27-35. doi: 10.1016/j.jnutbio.2017.08.016. Epub 2017 Sep 14.
16.
Correlation between miR-21 and miR-145 and the incidence and prognosis of colorectal cancer.
Liu Q, etal., J BUON. 2018 Jan-Feb;23(1):29-35.
17.
Over-expression of microRNA-145 drives alterations in β-adrenergic signaling and attenuates cardiac remodeling in heart failure post myocardial infarction.
Liu Z, etal., Aging (Albany NY). 2020 Jun 18;12(12):11603-11622. doi: 10.18632/aging.103320. Epub 2020 Jun 18.
18.
MicroRNA-145 Protects against Myocardial Ischemia Reperfusion Injury via CaMKII-Mediated Antiapoptotic and Anti-Inflammatory Pathways.
Liu Z, etal., Oxid Med Cell Longev. 2019 Sep 10;2019:8948657. doi: 10.1155/2019/8948657. eCollection 2019.
19.
Overexpression of MicroRNA-145 Promotes Ascending Aortic Aneurysm Media Remodeling through TGF-β1.
Pei H, etal., Eur J Vasc Endovasc Surg. 2015 Jan;49(1):52-9. doi: 10.1016/j.ejvs.2014.10.018.
20.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
21.
Overexpression of microRNA-145 in atherosclerotic plaques from hypertensive patients.
Santovito D, etal., Expert Opin Ther Targets. 2013 Mar;17(3):217-23. doi: 10.1517/14728222.2013.745512. Epub 2013 Jan 23.
22.
miR-145-5p attenuates inflammatory response and apoptosis in myocardial ischemia-reperfusion injury by inhibiting (NADPH) oxidase homolog 1.
Tan L, etal., Exp Anim. 2021 Aug 6;70(3):311-321. doi: 10.1538/expanim.20-0160. Epub 2021 Mar 4.
23.
Clinicopathological significance of microRNA-31, -143 and -145 expression in colorectal cancer.
Wang CJ, etal., Dis Markers. 2009;26(1):27-34. doi: 10.3233/DMA-2009-0601.
24.
Long noncoding RNA H19 suppresses cardiac hypertrophy through the MicroRNA-145-3p/SMAD4 axis.
Wang H, etal., Bioengineered. 2022 Feb;13(2):3826-3839. doi: 10.1080/21655979.2021.2017564.
25.
LncRNA TUG1 Promotes Apoptosis, Invasion, and Angiogenesis of Retinal Endothelial Cells in Retinopathy of Prematurity via MiR-145-5p.
Wang Y, etal., Front Med (Lausanne). 2022 Apr 4;9:803214. doi: 10.3389/fmed.2022.803214. eCollection 2022.
26.
MicroRNA-145 is involved in endothelial cell dysfunction and acts as a promising biomarker of acute coronary syndrome.
Wu S, etal., Eur J Med Res. 2020 Mar 17;25(1):2. doi: 10.1186/s40001-020-00403-8.
27.
The miR-143/145 cluster reverses the regulation effect of KLF5 in smooth muscle cells with proliferation and contractility in intracranial aneurysm.
Xu J, etal., Gene. 2018 Dec 30;679:266-273. doi: 10.1016/j.gene.2018.09.010. Epub 2018 Sep 7.
28.
MicroRNA-145-5p targeting of TRIM2 mediates the apoptosis of retinal ganglion cells via the PI3K/AKT signaling pathway in glaucoma.
Xu K, etal., J Gene Med. 2021 Nov;23(11):e3378. doi: 10.1002/jgm.3378. Epub 2021 Aug 10.
29.
Downregulation of microRNA-145 may contribute to liver fibrosis in biliary atresia by targeting ADD3.
Ye Y, etal., PLoS One. 2017 Sep 13;12(9):e0180896. doi: 10.1371/journal.pone.0180896. eCollection 2017.
30.
Downregulation of miR143/145 gene cluster expression promotes the aortic media degeneration process via the TGF-β1 signaling pathway.
Zhang M and Wang Z, Am J Transl Res. 2019 Jan 15;11(1):370-378. eCollection 2019.
31.
Circulating MicroRNA-145 is Associated with Acute Myocardial Infarction and Heart Failure.
Zhang M, etal., Chin Med J (Engl). 2017 5th Jan 2017;130(1):51-56. doi: 10.4103/0366-6999.196573.
32.
Hypermethylation of the Micro-RNA 145 Promoter Is the Key Regulator for NLRP3 Inflammasome-Induced Activation and Plaque Formation.
Zhong W, etal., JACC Basic Transl Sci. 2018 Sep 19;3(5):604-624. doi: 10.1016/j.jacbts.2018.06.004. eCollection 2018 Oct.
33.
MicroRNA-145 inhibits hepatic stellate cell activation and proliferation by targeting ZEB2 through Wnt/β-catenin pathway.
Zhou DD, etal., Mol Immunol. 2016 Jul;75:151-60. doi: 10.1016/j.molimm.2016.05.018. Epub 2016 Jun 9.
Mir145 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 57,369,983 - 57,370,070 (-) NCBI GRCr8 mRatBN7.2 18 55,099,640 - 55,099,727 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 55,099,640 - 55,099,727 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 57,193,356 - 57,193,443 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 57,907,967 - 57,908,054 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 55,723,506 - 55,723,593 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 56,969,907 - 56,969,994 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 56,969,907 - 56,969,994 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 56,198,820 - 56,198,907 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 18 53,250,138 - 53,250,225 (-) NCBI Celera Cytogenetic Map 18 q12.1 NCBI
MIR145 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 5 149,430,646 - 149,430,733 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 5 149,430,646 - 149,430,733 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 5 148,810,209 - 148,810,296 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 5 148,790,401 - 148,790,488 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 5 144,892,189 - 144,892,276 (+) NCBI Celera Cytogenetic Map 5 q32 NCBI HuRef 5 143,956,545 - 143,956,632 (+) NCBI HuRef CHM1_1 5 148,242,644 - 148,242,731 (+) NCBI CHM1_1 T2T-CHM13v2.0 5 149,965,492 - 149,965,579 (+) NCBI T2T-CHM13v2.0
Mir145a Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 18 61,780,896 - 61,780,965 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 18 61,780,896 - 61,780,965 (-) Ensembl GRCm39 Ensembl GRCm38 18 61,647,825 - 61,647,894 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 18 61,647,825 - 61,647,894 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 18 61,807,479 - 61,807,548 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 18 62,930,620 - 62,930,689 (-) NCBI Celera Cytogenetic Map 18 E1 NCBI cM Map 18 34.64 NCBI
MIR145 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 4 59,533,128 - 59,533,210 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 4 59,533,128 - 59,533,210 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 4 59,298,427 - 59,298,509 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 4 60,015,687 - 60,015,769 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 4 60,015,687 - 60,015,769 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 4 59,802,584 - 59,802,666 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 4 59,917,043 - 59,917,125 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 4 60,447,590 - 60,447,672 (-) NCBI UU_Cfam_GSD_1.0
MIR145 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 150,580,126 - 150,580,211 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 150,580,126 - 150,580,211 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 157,346,127 - 157,346,212 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Confirmed Targets
Sod2 rno-miR-145-5p Mirtarbase external_info qRT-PCR//Western blot//Microarray Functional MTI 19142192 Klf5 rno-miR-145-5p Mirtarbase external_info Luciferase reporter assay//qRT-PCR//Western blot// Functional MTI 19542014 Bnip3 rno-miR-145-5p Mirtarbase external_info Luciferase reporter assay//Western blot Functional MTI 23028672 Myocd rno-miR-145-5p Mirtarbase external_info qRT-PCR Functional MTI (Weak) 19542014
Predicted Targets
Count of predictions: 9286 Count of gene targets: 5816 Count of transcripts: 6254 Interacting mature miRNAs: rno-miR-145-3p, rno-miR-145-5p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
1331733 Bp233 Blood pressure QTL 233 3.97196 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 24796977 79788953 Rat 1358358 Sradr6 Stress Responsive Adrenal Weight QTL 6 2.49 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 18 11944299 59330563 Rat 1331730 Scl27 Serum cholesterol level QTL 27 3.826 blood HDL cholesterol amount (VT:0000184) serum high density lipoprotein cholesterol level (CMO:0000361) 18 52292875 59796643 Rat 1331741 Bp232 Blood pressure QTL 232 3.59112 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 21372893 83213037 Rat 1331742 Bp228 Blood pressure QTL 228 3.88752 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 1298072 Cia26 Collagen induced arthritis QTL 26 3.6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 18 54709769 83828827 Rat 1331736 Bp227 Blood pressure QTL 227 2.791 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 46718763 59796643 Rat 1300125 Rf26 Renal function QTL 26 3.2 urine potassium amount (VT:0010539) urine potassium excretion rate (CMO:0000761) 18 52539863 65844950 Rat 6893683 Bw110 Body weight QTL 110 2.7 0.002 body mass (VT:0001259) body weight (CMO:0000012) 18 43345022 83828827 Rat 1331727 Bp237 Blood pressure QTL 237 3.053 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 61698465 Rat 9589041 Epfw12 Epididymal fat weight QTL 12 17.08 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 18 46640675 83828827 Rat 8694432 Bw165 Body weight QTL 165 3.81 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 18 46640675 83828827 Rat 9589816 Gluco68 Glucose level QTL 68 7.25 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 18 29792965 74792965 Rat 1331774 Bp226 Blood pressure QTL 226 4.41065 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 61360 Eaey Experimental allergic encephalomyelitis QTL y 3 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis duration (CMO:0001424) 18 46988939 60377753 Rat 2300177 Bmd65 Bone mineral density QTL 65 19.7 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 18 28964853 73964853 Rat 1578667 Bss21 Bone structure and strength QTL 21 3.5 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 18 11791518 83218561 Rat 2303120 Mamtr8 Mammary tumor resistance QTL 8 0.001 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 18 31359408 83218561 Rat 12880368 Bw187 Body weight QTL 187 0.045 body mass (VT:0001259) body weight (CMO:0000012) 18 52539763 76104388 Rat 61367 Iddm4 Insulin dependent diabetes mellitus QTL 4 2.33 0.0074 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 18 38192455 83192455 Rat 2293658 Bmd23 Bone mineral density QTL 23 7.3 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 18 51464733 63636873 Rat 1359020 Ppulsi2 Prepulse inhibition QTL 2 2.71 prepulse inhibition trait (VT:0003088) acoustic startle response measurement (CMO:0001519) 18 52292875 73997283 Rat 2299160 Iddm35 Insulin dependent diabetes mellitus QTL 35 2.79 blood glucose amount (VT:0000188) age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) 18 4207941 60377792 Rat 9590318 Scort22 Serum corticosterone level QTL 22 7.64 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 18 29792965 74792965 Rat 1331752 Bw27 Body weight QTL 27 2.963 body mass (VT:0001259) body weight (CMO:0000012) 18 52292875 65845095 Rat 1578661 Bss20 Bone structure and strength QTL 20 3.7 femur morphology trait (VT:0000559) femoral neck cross-sectional area (CMO:0001697) 18 11791518 83218561 Rat 1331754 Bp230 Blood pressure QTL 230 4.61609 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 29792965 74792965 Rat 12904069 Cm123 Cardiac mass QTL 123 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 18 52539763 76104388 Rat 1331798 Bp224 Blood pressure QTL 224 3.53873 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359408 59796643 Rat 12904070 Cm124 Cardiac mass QTL 124 0.01 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 18 52539763 76104388 Rat 2303584 Gluco55 Glucose level QTL 55 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 18 48520044 83828827 Rat 12904071 Am18 Aortic mass QTL 18 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 18 52539763 76104388 Rat 61383 Bp47 Blood pressure QTL 47 17.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 31271681 60377755 Rat 12904067 Cm122 Cardiac mass QTL 122 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 18 52539763 76104388 Rat 1331806 Bp229 Blood pressure QTL 229 4.36484 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718763 57867167 Rat 2301417 Bp319 Blood pressure QTL 319 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 52539763 76104388 Rat 12904073 Kidm71 Kidney mass QTL 71 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 18 52539763 76104388 Rat 1331780 Bp238 Blood pressure QTL 238 3.269 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718763 59796643 Rat 738008 Hcar14 Hepatocarcinoma resistance QTL 14 4.3 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion number (CMO:0001462) 18 51464733 83218561 Rat 1331776 Bp225 Blood pressure QTL 225 2.829 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 18 31359408 59796643 Rat 6903359 Bp355 Blood pressure QTL 355 3.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 18 11944544 59796478 Rat 631518 Bw11 Body weight QTL 11 2.8 body mass (VT:0001259) body weight (CMO:0000012) 18 35870723 80870723 Rat 6903345 Bp349 Blood pressure QTL 349 3.9 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 2313082 Bss85 Bone structure and strength QTL 85 0.8 0.0001 long bone metaphysis morphology trait (VT:0000133) tibia midshaft total cross-sectional area (CMO:0001715) 18 14951337 59951337 Rat 6903347 Bp350 Blood pressure QTL 350 4.4 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 31359530 59796478 Rat 8694366 Abfw8 Abdominal fat weight QTL 8 6.38 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 18 46640675 83828827 Rat 6903349 Bp351 Blood pressure QTL 351 3.5 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 631509 Sald2 Serum aldosterone level QTL 2 2.9 blood aldosterone amount (VT:0005346) serum aldosterone level (CMO:0000487) 18 52539763 69140759 Rat 2300157 Bmd66 Bone mineral density QTL 66 13.1 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 18 28964853 73964853 Rat 738005 Anxrr11 Anxiety related response QTL 11 3.4 exploratory behavior trait (VT:0010471) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 18 30039813 75039813 Rat 6903351 Bp352 Blood pressure QTL 352 3.3 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 46718935 59796478 Rat 631274 Sprol1 Serum protein level QTL 1 5.3 blood total protein amount (VT:0005567) serum total protein level (CMO:0000661) 18 31393320 77209694 Rat 1358193 Emca2 Estrogen-induced mammary cancer QTL 2 1.6 mammary gland integrity trait (VT:0010552) post-insult time to mammary tumor formation (CMO:0000345) 18 18007599 63571040 Rat 2293704 Bss35 Bone structure and strength QTL 35 4.59 0.0002 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 18 28964853 73964853 Rat 2325839 Bp348 Blood pressure QTL 348 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 18 25570985 70570985 Rat 1600373 Mamtr6 Mammary tumor resistance QTL 6 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 18 19278901 83218561 Rat 2293708 Bss46 Bone structure and strength QTL 46 8.8 0.0001 lumbar vertebra morphology trait (VT:0010494) lumbar vertebra cortical cross-sectional area (CMO:0001690) 18 11791518 63636873 Rat 8694378 Bw157 Body weight QTL 157 3.59 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 18 29792965 74792965 Rat 1600375 Mcs22 Mammary carcinoma susceptibility QTL 22 3.3 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 18 52539763 63933058 Rat 2303571 Bw92 Body weight QTL 92 3 body mass (VT:0001259) body weight (CMO:0000012) 18 48520044 83828827 Rat 1598826 Anxrr20 Anxiety related response QTL 20 3.04 body movement coordination trait (VT:0005424) number of rearing movements in an experimental apparatus (CMO:0001752) 18 41432971 83828827 Rat 61429 Cia17 Collagen induced arthritis QTL 17 4.6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 18 31359408 70263868 Rat 7411719 Strs5 Sensitivity to stroke QTL 5 9.4 cerebrum integrity trait (VT:0010549) percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932) 18 49999958 65845095 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
3
10
43
59
35
38
19
19
19
132
72
51
30
37
19
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000053597
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 18 55,099,640 - 55,099,727 (-) Ensembl Rnor_6.0 Ensembl 18 56,969,907 - 56,969,994 (-) Ensembl
RefSeq Acc Id:
NR_031891
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 18 57,369,983 - 57,370,070 (-) NCBI mRatBN7.2 18 55,099,640 - 55,099,727 (-) NCBI Rnor_6.0 18 56,969,907 - 56,969,994 (-) NCBI Rnor_5.0 18 56,198,820 - 56,198,907 (-) NCBI Celera 18 53,250,138 - 53,250,225 (-) NCBI
Sequence:
CACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTGGATGCTAAGATGGGGATTCCTGGAAATACTGTTCTTGAGGTCATGGCT
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2013-08-14
Mir145
microRNA 145
Mir145
microRNA mir-145
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2010-06-02
Mir145
microRNA mir-145
Symbol and Name status set to provisional
70820 PROVISIONAL
