D16Arb9 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D16Arb9

Symbol:

D16Arb9

Previously known as:

oxsts7723; R0270-B03;

RGD ID:

42030

Expected Size:

218 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	16	17,724,066 - 17,724,284 (+)	Marker Load Pipeline
mRatBN7.2	16	17,690,039 - 17,690,257 (+)	MAPPER	mRatBN7.2
Rnor_6.0	16	19,391,435 - 19,391,652	NCBI	Rnor6.0
Rnor_5.0	16	19,249,766 - 19,249,983	UniSTS	Rnor5.0
RGSC_v3.4	16	18,114,538 - 18,114,756	RGD	RGSC3.4
RGSC_v3.4	16	18,114,539 - 18,114,756	UniSTS	RGSC3.4
RGSC_v3.1	16	18,114,536 - 18,114,754	RGD
Celera	16	17,904,676 - 17,904,893	UniSTS
SHRSP x BN Map	16	5.71	UniSTS
SHRSP x BN Map	16	5.71	RGD
FHH x ACI Map	16	12.1799	RGD
Cytogenetic Map	16	p14	UniSTS

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd
Genes: Tpm4

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4.	UniSTS Pipeline	RGD automated pipelines
5.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	GATACTGTGCAGTTGAGACCCC
Reverse Primer	AAGAAGACCAGGCATTCCAGGC

Strain Variation

Strain, Expected Size(s)

ACI/N	218
AVN/Orl	210
BBDP/Rhw	210
BBDR/Rhw	210
BC/CpbU	210
BDIX/Han	210
BDVII/Cub	210
BN-Lx/Cub	218
BN/SsNHsd	218
BP/Cub	210
BUF/Pit	210
COP/OlaHsd	210

DA/PitN	210
DON/Melb	210
F344/Pit	210
FHH/Eur	210
GH/Omr	210
GK/KyoSwe	210
IS/Kyo	210
LE/Mol	210
LEW/Pit	210
LH/Mav	210
LN/Mav	210
LOU/CHan	210

M520/N	218
MHS/Gib	210
MNR/N	210
MNRA/N	210
MNS/Gib	210
MR/Pit	210
NEDH/K	210
NP9	210
ODU/N	210
OKA/Wsl	210
OM/Ztm	210
P5C	210

PVG/Pit	210
SD/Rij	206
SHR/OlaHsd	210
SHRSP/Riv	210
SR/Jr	210
SS/Jr	210
WAG/RijKyo	210
WF/Pit	218
WIST/Nhg	210
WKY/OlaHsd	210
WTC/Kyo	210

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
402345550	LOC134482463	uncharacterized LOC134482463	16	17710238	17727193	Rat
3899	Tpm4	tropomyosin 4	16	17718442	17732483	Rat

Nucleotide Sequences


GenBank Nucleotide	JH618627.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	Y00169	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1549842	Bp248	Blood pressure QTL 248		0.01	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	16	387123	45387123	Rat
2307172	Activ4	Activity QTL 4	3.71	0.00023	locomotor behavior trait (VT:0001392)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	16	1	33425095	Rat
1354584	Despr6	Despair related QTL 6	3.1	0.0067	locomotor behavior trait (VT:0001392)	amount of time spent in voluntary immobility (CMO:0001043)	16	1	39568015	Rat
737819	Hcas4	Hepatocarcinoma susceptibility QTL 4	4.43		liver integrity trait (VT:0010547)	volume of individual liver tumorous lesion (CMO:0001078)	16	4234212	53708481	Rat
631517	Scl9	Serum cholesterol level QTL 9	3.3		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	16	15748006	25801629	Rat
1354625	Despr7	Despair related QTL 7	3.16	0.016	locomotor behavior trait (VT:0001392)	amount of time spent in voluntary immobility (CMO:0001043)	16	4744222	49744222	Rat
61405	Niddm6	Non-insulin dependent diabetes mellitus QTL 6	3.66	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	16	1	26734272	Rat
631830	Alc7	Alcohol consumption QTL 7	2.9		consumption behavior trait (VT:0002069)	ethanol drink intake rate (CMO:0001407)	16	1	26734272	Rat
7411664	Foco30	Food consumption QTL 30	11	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	16	4354822	49354822	Rat
1600378	Arunc4	Aerobic running capacity QTL 4		0.03	exercise endurance trait (VT:0002332)	maximum distance run on treadmill (CMO:0001406)	16	387123	45387123	Rat
70183	BpQTLcluster13	Blood pressure QTL cluster 13	3.654		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	16	4234212	49757901	Rat
737826	Alc11	Alcohol consumption QTL 11	3.2		consumption behavior trait (VT:0002069)	ethanol drink intake rate (CMO:0001407)	16	4234212	66955197	Rat
1600369	Hcas8	Hepatocarcinoma susceptibility QTL 8			liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	16	16278184	27244292	Rat
2303566	Bw90	Body weight QTL 90	2		body mass (VT:0001259)	body weight (CMO:0000012)	16	1	39568015	Rat
2312663	Slep9	Serum leptin concentration QTL 9		0.001	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	16	839086	66195506	Rat
2306902	Bp339	Blood pressure QTL 339		0.01	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	16	3386790	49757901	Rat
1300133	Rf24	Renal function QTL 24	3.64		blood creatinine amount (VT:0005328)	creatinine clearance (CMO:0000765)	16	3386790	26128267	Rat
2312660	Bw95	Body weight QTL 95		0.05	inguinal fat pad mass (VT:0010424)	inguinal fat pad weight to body weight ratio (CMO:0001253)	16	839086	66195506	Rat
2312666	Insul16	Insulin level QTL 16		0.01	blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	16	839086	66195506	Rat
634355	Rends4	Renal damage susceptibility QTL 4		0.05	kidney blood vessel morphology trait (VT:0000530)	organ lesion measurement (CMO:0000677)	16	1	26734272	Rat
61372	Bp40	Blood pressure QTL 40	2.2		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	16	4234333	17730812	Rat
2293343	Glom16	Glomerulus QTL 16	7.4		kidney glomerulus integrity trait (VT:0010546)	kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)	16	839086	52786090	Rat
2301406	Kidm39	Kidney mass QTL 39		0.002	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	16	15905802	60905802	Rat
2312669	Stl23	Serum triglyceride level QTL 23		0.01	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	16	839086	66195506	Rat
6903319	Bw114	Body weight QTL 114	2.7	0.0037	body mass (VT:0001259)	body weight (CMO:0000012)	16	3301683	48301683	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	24852	UniSTS
NCBI Nucleotide	Y00169

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D16Arb9