D3Rat127 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D3Rat127

Symbol: D3Rat127
Previously known as: oxsts6933; R0059-A11; 
RGD ID: 37614
Expected Size: 139 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr83109,767,361 - 109,767,500 (+)Marker Load Pipeline
mRatBN7.2389,312,399 - 89,312,538 (+)MAPPERmRatBN7.2
Rnor_6.0392,851,616 - 92,851,754NCBIRnor6.0
Rnor_5.0399,493,588 - 99,493,726UniSTSRnor5.0
RGSC_v3.4388,178,203 - 88,178,342RGDRGSC3.4
RGSC_v3.4388,178,204 - 88,178,342UniSTSRGSC3.4
RGSC_v3.1388,074,632 - 88,074,770RGD
Celera388,391,487 - 88,391,625UniSTS
RH 3.4 Map3669.1UniSTS
RH 3.4 Map3669.1RGD
SHRSP x BN Map347.2698UniSTS
SHRSP x BN Map347.2698RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines


 
Forward Primer AAGAGACCAATTCTGGGGAT
Reverse Primer CCTCTTCGAGACTTGGCTTTT
 
Strain, Expected Size(s)

ACI/N 141 AVN/Orl 143 BBDP/Rhw 143
BBDR/Rhw 143 BC/CpbU 151 BDIX/Han 141
BDVII/Cub 141 BN-Lx/Cub 141 BN/SsNHsd 141
BP/Cub 133 BUF/Pit 141 COP/OlaHsd 151
DA/PitN 141 DON/Melb 141 F344/Pit 141
FHH/Eur 141 GH/Omr 141 IS/Kyo 151
LE/Mol 141 LEW/Pit 143 LH/Mav 143
LN/Mav 141 LOU/CHan 141 M520/N 143
MHS/Gib 143 MNR/N 133 MNRA/N 141
MNS/Gib 143 MR/Pit 141 NEDH/K 137
NP9 145 ODU/N 151 OKA/Wsl 147
OM/Ztm 143 P5C 143 PVG/Pit 151
SD/Rij 143 SHR/OlaHsd 141 SHRSP/Riv 147
SR/Jr 141 SS/Jr 141 WAG/RijKyo 141
WF/Pit 141 WIST/Nhg 141 WKY/OlaHsd 139
WN/N 143 WTC/Kyo 139


GenBank Nucleotide CH473949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000233 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 36 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1300178Hrtrt4Heart rate QTL 43.74heart pumping trait (VT:2000009)heart rate (CMO:0000002)34382736490905114Rat
61377Edpm3Estrogen-dependent pituitary mass QTL 37.050.038pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)35318469289878207Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat

1 to 10 of 36 rows