D5Mit18 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D5Mit18

Symbol: D5Mit18
Previously known as: oxsts9158; 
RGD ID: 34599
Expected Size: 232 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8521,987,274 - 21,987,506 (+)Marker Load Pipeline
mRatBN7.2517,189,698 - 17,189,930 (+)MAPPERmRatBN7.2
Rnor_6.0517,062,312 - 17,062,543NCBIRnor6.0
Rnor_5.0521,840,309 - 21,840,540UniSTSRnor5.0
RGSC_v3.4517,515,215 - 17,515,447RGDRGSC3.4
RGSC_v3.4517,515,216 - 17,515,447UniSTSRGSC3.4
RGSC_v3.1517,515,215 - 17,515,447RGD
Celera516,535,057 - 16,535,292UniSTS
RH 3.4 Map5100.6RGD
RH 2.0 Map5102.4RGD
Cytogenetic Map5q12UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Penk  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GCCCGAGATTGATCTCTCCTG
Reverse Primer AAAACCAAACAAAACAACCCC
 

Region

Nucleotide Sequences
GenBank Nucleotide X59136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2293666Bmd38Bone mineral density QTL 384.4femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)51373115343590997Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)5692228281330203Rat
1300117Hrtrt8Heart rate QTL 83.49heart pumping trait (VT:2000009)heart rate (CMO:0000002)5862723052665523Rat
7394712Emca13Estrogen-induced mammary cancer QTL 13mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)51460607859606078Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)51757663362576633Rat
1578774Tcas8Tongue tumor susceptibility QTL 83.47tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)51570745160707451Rat
1331771Rf35Renal function QTL 354.36965kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)51001906491770353Rat
2312562Pur18Proteinuria QTL 182.60.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)5692228237468560Rat
8662454Vetf3Vascular elastic tissue fragility QTL 327.4artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)5706553574335773Rat
1641903Alcrsp3Alcohol response QTL 3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)51748608062486080Rat
1331756Rf34Renal function QTL 344.16275kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)51001906487027358Rat
631827Alc4Alcohol consumption QTL 43.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)51297048025683802Rat
2303577Gluco47Glucose level QTL 473blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51652001961520019Rat
1641922Alcrsp8Alcohol response QTL 8alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)51748608062486080Rat
2313085Bss59Bone structure and strength QTL 592.90.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)5862723053627230Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 29237 UniSTS