DXMgh12 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXMgh12

Symbol: DXMgh12
Previously known as: oxsts9240; 
RGD ID: 34559
Expected Size: 199 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X31,706,553 - 31,706,766 (+)MAPPERmRatBN7.2
Rnor_6.0X33,443,848 - 33,444,058NCBIRnor6.0
Rnor_5.0X33,791,311 - 33,791,521UniSTSRnor5.0
RGSC_v3.4X52,447,478 - 52,447,691RGDRGSC3.4
RGSC_v3.4X52,447,479 - 52,447,691UniSTSRGSC3.4
RGSC_v3.1X52,500,947 - 52,501,160RGD
CeleraX32,020,448 - 32,020,650UniSTS
RH 3.4 MapX443.0UniSTS
RH 3.4 MapX443.0RGD
RH 2.0 Map21334.2RGD
Cytogenetic MapXq21UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Bp64  
Genes:   S100g   Ctps2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CTGAGCTACAGCCACAATCC
Reverse Primer TGAGCAGGATGTAAAGTGAATAAG
 

Region

Nucleotide Sequences
GenBank Nucleotide J04133 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X16635 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 24249 UniSTS
  326491 UniSTS
  619580 UniSTS