D4Mgh12 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D4Mgh12

Symbol: D4Mgh12
Previously known as: oxsts9094; R5805; 
RGD ID: 34477
Expected Size: 116 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr84181,024,547 - 181,024,663 (+)Marker Load Pipeline
mRatBN7.24179,293,830 - 179,293,946 (+)MAPPERmRatBN7.2
Rnor_6.04180,689,009 - 180,689,124NCBIRnor6.0
Rnor_5.04244,849,397 - 244,849,512UniSTSRnor5.0
RGSC_v3.44183,954,704 - 183,954,820RGDRGSC3.4
RGSC_v3.44183,954,705 - 183,954,820UniSTSRGSC3.4
RGSC_v3.14184,199,829 - 184,199,944RGD
Celera4167,791,605 - 167,791,720UniSTS
RH 3.4 Map41076.3RGD
RH 3.4 Map41076.3UniSTS
Cytogenetic Map4q44UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Bp209  
Genes:   Itpr2  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer TAAAAAAATCACTTAAAGCCCCC
Reverse Primer CGGCTTTACTGTACGAATTAATTG
 
Strain, Expected Size(s)

ACI/N 117 AVN/Orl 113 BBDP/Rhw 117
BBDR/Rhw 117 BC/CpbU 117 BDIX/Han 119
BDVII/Cub 117 BN-Lx/Cub 113 BN/SsNHsd 113
BP/Cub 117 BUF/Pit 113 COP/OlaHsd 117
DA/PitN 113 DON/Melb 117 F344/Pit 117
FHH/Eur 117 GH/Omr 113 GK/KyoSwe 117
IS/Kyo 121 LE/Mol 117 LEW/Pit 107
LH/Mav 107 LN/Mav 107 LOU/CHan 113
M520/N 113 MHS/Gib 117 MNR/N 113
MNRA/N 113 MNS/Gib 117 MR/Pit 113
NEDH/K 117 NP9 117 ODU/N 117
OKA/Wsl 117 OM/Ztm 113 P5C 117
PVG/Pit 117 SD/Rij 117 SHR/OlaHsd 117
SHRSP/Riv 117 SR/Jr 107 SS/Jr 117
WAG/RijKyo 113 WF/Pit 117 WIST/Nhg 117
WKY/OlaHsd 117 WN/N 117 WTC/Kyo 117


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
69649Itpr2inositol 1,4,5-trisphosphate receptor, type 24179028594179434657Rat
GenBank Nucleotide JH614879.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 13 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4144639524182687754Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (CMO:0000132)4135204660180204660Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)4135699135180699135Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4138503169179293946Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4155561574182687754Rat
2293659Bmd35Bone mineral density QTL 354.50.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)4137755016181392681Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4145568712182687754Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat

1 to 10 of 13 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 544358 UniSTS
  81678 UniSTS