D15Mgh4 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D15Mgh4

Symbol: D15Mgh4
Previously known as: oxsts5593; R1103-A06; 
RGD ID: 34357
Expected Size: 106 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81582,713,931 - 82,714,037 (+)Marker Load Pipeline
mRatBN7.21576,306,099 - 76,306,205 (+)MAPPERmRatBN7.2
Rnor_6.01583,947,714 - 83,947,819NCBIRnor6.0
Rnor_5.01587,456,591 - 87,456,696UniSTSRnor5.0
RGSC_v3.41583,349,371 - 83,349,477RGDRGSC3.4
RGSC_v3.41583,349,372 - 83,349,477UniSTSRGSC3.4
RGSC_v3.11583,365,152 - 83,365,257RGD
Celera1575,545,830 - 75,545,935UniSTS
RH 3.4 Map15528.0UniSTS
RH 3.4 Map15528.0RGD
RH 2.0 Map15405.8RGD
SHRSP x BN Map1548.3298RGD
Cytogenetic Map4q34UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Gcs1   Eae19   Schws6  
Genes:   Mogs  


Annotation


1 to 9 of 9 rows
#
Reference Title
Reference Citation
1. Correlation between genetic and cytogenetic maps of the rat. Andoh Y, etal., Mamm Genome 1998 Apr;9(4):287-93.
2. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
5. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
6. UniSTS Pipeline RGD automated pipelines
7. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
8. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
9. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database
1 to 9 of 9 rows


 
Forward Primer GCCCAGAACCAGAAATCAAA
Reverse Primer GCTACAAGAAACCTACCTGTAGGG
 
Strain, Expected Size(s)

ACI/N 122 AVN/Orl 106 BBDP/Rhw 122
BDIX/Han 122 BN-Lx/Cub 106 BN/SsNHsd 106
BP/Cub 122 BUF/Pit 106 COP/OlaHsd 122
DA/PitN 124 DON/Melb 120 F344/Pit 120
FHH/Eur 120 GH/Omr 120 IS/Kyo 130
LE/Mol 122 LEW/Pit 122 LH/Mav 124
LN/Mav 124 LOU/CHan 124 M520/N 120
MHS/Gib 122 MNR/N 122 MR/Pit 122
NEDH/K 106 NP9 122 ODU/N 122
OKA/Wsl 122 OM/Ztm 122 P5C 122
PVG/Pit 106 SD/Rij 124 SHR/OlaHsd 122
SHRSP/Riv 122 SR/Jr 124 SS/Jr 124
WAG/RijKyo 106 WF/Pit 122 WIST/Nhg 106
WKY/OlaHsd 122 WTC/Kyo 122


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
7653320LOC102553927uncharacterized LOC102553927157627260276347580Rat
GenBank Nucleotide CH473951 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000245 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 25 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1575788062101769107Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1576306099101769107Rat
1582227Gluco30Glucose level QTL 303.60.0003blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)152803066582262678Rat
1582228Epfw3Epididymal fat weight QTL 34.10.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
631516Gluco31Glucose level QTL 317blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)155559608995018120Rat
1331724Bp223Blood pressure QTL 2233.53715arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)157369051895018228Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1575788062101769107Rat

1 to 10 of 25 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 100303183 UniSTS
  100303383 UniSTS
  474369 UniSTS
  78947 UniSTS