D18Mit7 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D18Mit7

Symbol: D18Mit7
Also known as: R1094; MIT1094; oxsts5719; 
RGD ID: 33971
Expected Size: 204 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21812,874,620 - 12,874,824 (+)MAPPER
Rnor_6.01812,597,179 - 12,597,382NCBIRnor6.0
Rnor_5.01812,385,472 - 12,385,675UniSTSRnor5.0
RGSC_v3.41813,239,641 - 13,239,845RGDRGSC3.4
RGSC_v3.41813,239,642 - 13,239,845UniSTSRGSC3.4
RGSC_v3.11813,266,288 - 13,266,491RGD
Celera1812,856,104 - 12,856,307UniSTS
RH 3.4 Map18133.6UniSTS
RH 3.4 Map18133.6RGD
RH 2.0 Map18752.7RGD
Cytogenetic Map18p12UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   WN/N   WKY/OlaHsd   MNR/N   ODU/N   WF/Pit   SR/Jr   MNS/Gib   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHRSP/Riv   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   WAG/RijKyo   MNRA/N   WTC/Kyo   MR/Pit   WIST/Nhg   NP9   OKA/Wsl   SHR/OlaHsd  
QTLs:   Bp2   Eaez  
Genes:   Klhl14   LOC685114  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TGTCGTGAATCAAGCTTTGG
Reverse Primer TGAAAGGAAACAGAACCCAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1566178Klhl14kelch-like family member 14181252662712640381Rat

Nucleotide Sequences
GenBank Nucleotide AU027045 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH619161 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590248Scort10Serum corticosterone level QTL 1019.710.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)18125999214Rat
8552968Pigfal19Plasma insulin-like growth factor 1 level QTL 1911.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)18125999214Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135097280Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18138195967Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18138195967Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18138753381Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor surface area measurement (CMO:0002078)18247709623184414Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)18247709623184414Rat
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18371954732487870Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18440751362570466Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18543013441781619Rat
2301409Cm70Cardiac mass QTL 700.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)18705776915274626Rat
11565454Kidm59Kidney mass QTL 590.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)18705776915274626Rat
12904714Cm131Cardiac mass QTL 1310.002heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)18705776915274626Rat
12904715Cm132Cardiac mass QTL 1320.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)18705776915274626Rat
12904716Am21Aortic mass QTL 210.005aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)18705776915274626Rat
70178EaezExperimental allergic encephalomyelitis QTL z2.4nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)181259717915099007Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326398 UniSTS
  326504 UniSTS
  364823 UniSTS
  685114 UniSTS
UniSTS 119535 UniSTS