Symbol:
STX1A
Name:
syntaxin 1A
RGD ID:
18558032
Description:
ENCODES a protein that exhibits ATP-dependent protein binding (ortholog); calcium-dependent protein binding (ortholog); myosin binding (ortholog); INVOLVED IN modulation of excitatory postsynaptic potential (ortholog); positive regulation of calcium ion-dependent exocytosis (ortholog); positive regulation of catecholamine secretion (ortholog); PARTICIPATES IN insulin secretion pathway; ASSOCIATED WITH autism spectrum disorder (ortholog); autistic disorder (ortholog); Creutzfeldt-Jakob disease (ortholog); FOUND IN acrosomal vesicle (ortholog); actomyosin (ortholog); glutamatergic synapse (ortholog)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
syntaxin-1A
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
STX1A (syntaxin 1A) NCBI
Ortholog
Mus musculus (house mouse):
Stx1a (syntaxin 1A (brain)) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Rattus norvegicus (Norway rat):
Stx1a (syntaxin 1A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Stx1a (syntaxin 1A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
STX1A (syntaxin 1A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
STX1A (syntaxin 1A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Stx1a (syntaxin 1A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
STX1A (syntaxin 1A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Stx1a (syntaxin 1A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 28 9,347,495 - 9,367,948 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 28 9,347,532 - 9,368,585 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666070 7,135,019 - 7,155,486 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
STX1A Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 28 9,347,495 - 9,367,948 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 28 9,347,532 - 9,368,585 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666070 7,135,019 - 7,155,486 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
STX1A Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 7 73,699,210 - 73,719,669 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 7 73,699,206 - 73,719,672 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 7 73,113,540 - 73,133,999 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 7 72,751,476 - 72,771,924 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 7 72,558,190 - 72,578,613 NCBI Celera 7 68,591,739 - 68,612,223 (-) NCBI Celera Cytogenetic Map 7 q11.23 NCBI HuRef 7 68,995,950 - 69,016,432 (-) NCBI HuRef CHM1_1 7 73,259,272 - 73,279,754 (-) NCBI CHM1_1 T2T-CHM13v2.0 7 74,900,126 - 74,920,586 (-) NCBI T2T-CHM13v2.0 CRA_TCAGchr7v2 7 72,446,607 - 72,467,089 (-) NCBI
Stx1a Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 135,051,473 - 135,079,954 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 135,052,336 - 135,079,954 (+) Ensembl GRCm39 Ensembl GRCm38 5 135,023,482 - 135,051,100 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 135,023,482 - 135,051,100 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 135,499,442 - 135,526,969 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 135,308,199 - 135,335,726 (+) NCBI MGSCv36 mm8 Celera 5 132,033,901 - 132,061,428 (+) NCBI Celera Cytogenetic Map 5 G2 NCBI cM Map 5 74.95 NCBI
Stx1a Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 12 27,278,517 - 27,306,547 (-) NCBI GRCr8 mRatBN7.2 12 21,641,971 - 21,670,022 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 12 21,641,969 - 21,669,930 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 12 22,782,666 - 22,810,512 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 12 23,394,983 - 23,422,828 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 12 22,463,210 - 22,491,166 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 12 24,682,050 - 24,710,002 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 12 24,682,041 - 24,710,019 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 12 26,682,320 - 26,710,272 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 12 22,737,112 - 22,765,064 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 12 23,405,260 - 23,432,900 (-) NCBI Celera Cytogenetic Map 12 q12 NCBI
Stx1a Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955456 14,030,226 - 14,046,456 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955456 14,030,233 - 14,046,456 (+) NCBI ChiLan1.0 ChiLan1.0
STX1A Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 6 91,180,408 - 91,200,924 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 7 139,445,039 - 139,465,555 (+) NCBI NHGRI_mPanPan1 PanPan1.1 7 80,852,495 - 80,871,635 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 7 80,852,495 - 80,862,255 (-) Ensembl panpan1.1 panPan2
STX1A Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 6 6,574,616 - 6,583,002 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 6 6,574,631 - 6,581,833 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 6 8,263,577 - 8,280,400 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 6 6,381,214 - 6,398,029 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 6 6,381,225 - 6,398,461 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 6 6,370,709 - 6,387,529 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 6 6,318,461 - 6,335,266 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 6 6,482,166 - 6,498,979 (+) NCBI UU_Cfam_GSD_1.0
Stx1a Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 131,118,736 - 131,127,007 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936543 2,909,552 - 2,918,770 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936543 2,909,560 - 2,918,175 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
STX1A Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 10,974,127 - 10,991,873 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 10,974,127 - 10,991,846 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 10,670,296 - 10,688,032 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Stx1a
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000016277 ⟹ ENSCSAP00000014197
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 28 9,347,532 - 9,368,585 (+) Ensembl
RefSeq Acc Id:
XM_008018337 ⟹ XP_008016528
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 28 9,347,686 - 9,367,948 (+) NCBI Vero_WHO_p1.0 NW_023666070 7,135,019 - 7,155,342 (-) NCBI
Sequence:
GGCCACTCCTGCGCCCCCAGCCGCGGCTGGAGGGAGCGGGGCGAGCCGGGGACCCTGACCCCCTCCGGGTTCCGCCCCTCGGACCCACTCGGGGTCACGGGCTCGCGTGAGCTCGGCCGCGCTGACAA
hide sequence
RefSeq Acc Id:
XM_008018340 ⟹ XP_008016531
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 28 9,347,495 - 9,367,948 (+) NCBI Vero_WHO_p1.0 NW_023666070 7,135,024 - 7,155,486 (-) NCBI
Sequence:
TGCGCAGCCGCGGGGCGGCCGTCGCGCATGCGGGGCTCACACGGCTGCAGCCGGCGCCGCTGCCACTCCCGGGAGCATGAAGGACCGAACCCAGGAGCTCCGCACGGCCAAGGACAGCGATGATGATG
hide sequence
RefSeq Acc Id:
XR_005237921
Type:
NON-CODING
Position:
Green Monkey Assembly Chr Position (strand) Source Vero_WHO_p1.0 NW_023666070 7,135,024 - 7,155,350 (-) NCBI
RefSeq Acc Id:
XP_008016531 ⟸ XM_008018340
- Peptide Label:
isoform X2
- UniProtKB:
A0A0D9S008 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_008016528 ⟸ XM_008018337
- Peptide Label:
isoform X1
Ensembl Acc Id:
ENSCSAP00000014197 ⟸ ENSCSAT00000016277
