| 3252 | Pam | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding; copper ion binding; identical protein binding; INVOLVED IN fatty acid primary amide biosynthetic process; heart development; lactation; PARTICIPATES IN melanocortin system pathway; ASSOCIATED WITH Brain Hypoxia; Experimental Arthritis; Hyperplasia ; FOUND IN cell surface; extracellular space; neuronal cell body; INTERACTS WITH (R)-noradrenaline; 1-naphthyl isothiocyanate; 17alpha-ethynylestradiol | 9 | 105445812 | 105719287 | Rat | 219 | symbol , PhenoGen | gene, protein-coding, PROVISIONAL [RefSeq] |
| 11056 | Pam | peptidylglycine alpha-amidating monooxygenase | Predicted to enable several functions, including metal ion binding activity; peptidylamidoglycolate lyase activity; and peptidylglycine monooxygenase activity. Predicted to be involved in several processes, including fatty acid primary amide biosynthetic process; peptide amidation; and response to z inc ion. Predicted to be located in several cellular components, including perikaryon; secretory granule membrane; and trans-Golgi network. Predicted to be active in extracellular region. Is expressed in several structures, including alimentary system; central nervous system; forelimb bud; limb interdigital region; and sensory organ. Orthologous to human PAM (peptidylglycine alpha-amidating monooxygenase). [provided by Alliance of Genome Resources, Apr 2025] | 1 | 97748816 | 98023578 | Mouse | 248 | symbol , old_gene_name , PhenoGen , description | gene, protein-coding, VALIDATED [RefSeq] |
| 735807 | PAM | peptidylglycine alpha-amidating monooxygenase | This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016] | 5 | 102754783 | 103031105 | Human | 210 | symbol , COSMIC , Human Proteome Map , old_gene_symbol | gene, protein-coding, REVIEWED [RefSeq] |
| 8797280 | Pam | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding (ortholog); chromatin binding (ortholog); copper ion binding (ortholog); INVOLVED IN fatty acid primary amide biosynthetic process (ortholog); heart development (ortholog); lactation (ortholog); PARTICIPATES IN melanocortin system pathway; ASSOCIAT ED WITH anxiety disorder (ortholog); Brain Hypoxia (ortholog); Experimental Arthritis (ortholog); FOUND IN cell surface (ortholog); chromatin (ortholog); condensed chromosome (ortholog) | NW_004955418 | 10953044 | 11107668 | Chinchilla | 64 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 11676949 | PAM | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding (ortholog); chromatin binding (ortholog); copper ion binding (ortholog); INVOLVED IN fatty acid primary amide biosynthetic process (ortholog); heart development (ortholog); lactation (ortholog); PARTICIPATES IN melanocortin system pathway; ASSOCIAT ED WITH anxiety disorder (ortholog); Brain Hypoxia (ortholog); Experimental Arthritis (ortholog); FOUND IN cell surface (ortholog); chromatin (ortholog); condensed chromosome (ortholog) | 5 | 98104058 | 98385157 | Bonobo | 75 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 12183875 | PAM | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding (ortholog); chromatin binding (ortholog); copper ion binding (ortholog); INVOLVED IN fatty acid primary amide biosynthetic process (ortholog); heart development (ortholog); lactation (ortholog); PARTICIPATES IN melanocortin system pathway; ASSOCIAT ED WITH anxiety disorder (ortholog); Brain Hypoxia (ortholog); Experimental Arthritis (ortholog); FOUND IN cell surface (ortholog); chromatin (ortholog); condensed chromosome (ortholog) | 3 | 8141508 | 8312081 | Dog | 75 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 12618422 | Pam | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding (ortholog); chromatin binding (ortholog); copper ion binding (ortholog); INVOLVED IN fatty acid primary amide biosynthetic process (ortholog); heart development (ortholog); lactation (ortholog); PARTICIPATES IN melanocortin system pathway; ASSOCIAT ED WITH anxiety disorder (ortholog); Brain Hypoxia (ortholog); Experimental Arthritis (ortholog); FOUND IN cell surface (ortholog); chromatin (ortholog); condensed chromosome (ortholog) | NW_004936523 | 1492795 | 1786942 | Squirrel | 75 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 14185783 | PAM | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding (ortholog); chromatin binding (ortholog); copper ion binding (ortholog); INVOLVED IN fatty acid primary amide biosynthetic process (ortholog); heart development (ortholog); lactation (ortholog); PARTICIPATES IN melanocortin system pathway; ASSOCIAT ED WITH anxiety disorder (ortholog); Brain Hypoxia (ortholog); Experimental Arthritis (ortholog); FOUND IN cell surface (ortholog); chromatin (ortholog); condensed chromosome (ortholog) | | | | Pig | 75 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 18430150 | PAM | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding (ortholog); chromatin binding (ortholog); copper ion binding (ortholog); INVOLVED IN fatty acid primary amide biosynthetic process (ortholog); heart development (ortholog); lactation (ortholog); PARTICIPATES IN melanocortin system pathway; ASSOCIAT ED WITH anxiety disorder (ortholog); Brain Hypoxia (ortholog); Experimental Arthritis (ortholog); FOUND IN cell surface (ortholog); chromatin (ortholog); condensed chromosome (ortholog) | | | | Green Monkey | 75 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 18910445 | Pam | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding (ortholog); chromatin binding (ortholog); copper ion binding (ortholog); INVOLVED IN fatty acid primary amide biosynthetic process (ortholog); heart development (ortholog); lactation (ortholog); PARTICIPATES IN melanocortin system pathway; ASSOCIAT ED WITH anxiety disorder (ortholog); Brain Hypoxia (ortholog); Experimental Arthritis (ortholog); FOUND IN cell surface (ortholog); chromatin (ortholog); condensed chromosome (ortholog) | | | | Naked Mole-Rat | 72 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 155240754 | pam | | | | | | Tropical Clawed Frog | | symbol | gene, null |
| 625928716 | Pam | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding (ortholog); chromatin binding (ortholog); copper ion binding (ortholog); INVOLVED IN fatty acid primary amide biosynthetic process (ortholog); heart development (ortholog); lactation (ortholog); PARTICIPATES IN melanocortin system pathway; ASSOCIAT ED WITH anxiety disorder (ortholog); Brain Hypoxia (ortholog); Experimental Arthritis (ortholog); FOUND IN cell surface (ortholog); chromatin (ortholog); condensed chromosome (ortholog) | | | | Black Rat | 63 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 14375156 | pam-1 | | | | | | Roundworm | | symbol | gene, null |
| 155248783 | pam.L | | | | | | African Clawed Frog | | symbol | gene, null |
| 155240753 | pam.S | | | | | | African Clawed Frog | | symbol | gene, null |
| 41198727 | Pam-ps1 | peptidylglycine alpha-amidating monooxygenase, pseudogene 1 | | 4 | 167635182 | 167639475 | Rat | | symbol , PhenoGen | gene, pseudo, MODEL [RefSeq] |
| 1315362 | Mrfap1 | Morf4 family associated protein 1 | Predicted to enable identical protein binding activity. Predicted to be located in nucleoplasm. Is expressed in brain; genitourinary system; liver; lung; and spleen. Orthologous to several human genes including MRFAP1 (Morf4 family associated protein 1). [provided by Alliance of Genome Resources, Ju l 2025] | 5 | 36952211 | 36954098 | Mouse | 46 | old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1312048 | Mycbp2 | MYC binding protein 2 | ENCODES a protein that exhibits guanyl-nucleotide exchange factor activity (ortholog); identical protein binding (ortholog); small GTPase binding (ortholog); INVOLVED IN branchiomotor neuron axon guidance (ortholog); cell morphogenesis involved in neuron differentiation (ortholog); central nervous s ystem projection neuron axonogenesis (ortholog); ASSOCIATED WITH autosomal dominant intellectual developmental disorder 26 (ortholog); colon cancer (ortholog); Developmental Disabilities (ortholog); FOUND IN axon (ortholog); microtubule cytoskeleton (ortholog); nucleoplasm (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran | 15 | 86352061 | 86590126 | Rat | 178 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1323830 | MYCBP2 | MYC binding protein 2 | This gene encodes an E3 ubiquitin-protein ligase and member of the PHR (Phr1/MYCBP2, highwire and RPM-1) family of proteins. The encoded protein plays a role in axon guidance and synapse formation in the developing nervous system. In mammalian cells, this protein regulates the cAMP and mTOR signalin g pathways, and may additionally regulate autophagy. Reduced expression of this gene has been observed in acute lymphoblastic leukemia patients and a mutation in this gene has been identified in patients with a rare inherited vision defect. [provided by RefSeq, Mar 2017] | 13 | 77044657 | 77327094 | Human | 184 | old_gene_name , old_gene_symbol | gene, protein-coding, REVIEWED [RefSeq] |
| 1323831 | Mycbp2 | MYC binding protein 2, E3 ubiquitin protein ligase | Enables identical protein binding activity. Involved in several processes, including central nervous system projection neuron axonogenesis; circadian regulation of gene expression; and positive regulation of protein ubiquitination. Acts upstream of or within several processes, including branchiomoto r neuron axon guidance; negative regulation of protein catabolic process; and regulation of cytoskeleton organization. Located in axon and microtubule cytoskeleton. Is expressed in nervous system and neural retina. Orthologous to human MYCBP2 (MYC binding protein 2). [provided by Alliance of Genome Resources, Jul 2025] | 14 | 103350847 | 103584276 | Mouse | 233 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1348345 | F11R | F11 receptor | Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin su perfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008] | 1 | 160995211 | 161021152 | Human | 228 | old_gene_symbol | gene, protein-coding, REVIEWED [RefSeq] |
| 621329 | Rassf9 | Ras association domain family member 9 | ENCODES a protein that exhibits enzyme binding; protein domain specific binding; INVOLVED IN intracellular transport; FOUND IN cytosol; endosome; recycling endosome; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3,3',4,4',5-pentachlorobiphenyl; ammonium chloride | 7 | 39486257 | 39518090 | Rat | 87 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 731307 | RASSF9 | Ras association domain family member 9 | The protein encoded by this gene localizes to perinuclear endosomes. This protein associates with peptidylglycine alpha-amidating monooxygenase, and may be involved with the trafficking of this enzyme through secretory or endosomal pathways. [provided by RefSeq, Jul 2008] | 12 | 85800703 | 85836409 | Human | 80 | old_gene_name | gene, protein-coding, REVIEWED [RefSeq] |
| 731308 | Rassf9 | Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 | Predicted to enable enzyme binding activity and protein domain specific binding activity. Predicted to be involved in intracellular transport. Predicted to be located in endosome. Predicted to be active in cytosol; recycling endosome; and trans-Golgi network transport vesicle membrane. Is expressed in several structures, including metanephros; renal large blood vessel; respiratory system; sensory organ; and tooth. Orthologous to human RASSF9 (Ras association domain family member 9). [provided by Alliance of Genome Resources, Apr 2025] | 10 | 102348083 | 102385598 | Mouse | 111 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2968 | Uhmk1 | U2AF homology motif kinase 1 | ENCODES a protein that exhibits enzyme binding; protein serine/threonine kinase activity; splicing factor binding; INVOLVED IN peptidyl-serine phosphorylation; neuron projection development (ortholog); positive regulation of translational initiation (ortholog); ASSOCIATED WITH Cerebral Visual Impair ment and Intellectual Disability (ortholog); FOUND IN cytoplasm; nucleus; axon (ortholog); INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; acetamide | 13 | 84929418 | 84949194 | Rat | 120 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1344907 | UHMK1 | U2AF homology motif kinase 1 | The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and th e gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010] | 1 | 162497174 | 162529631 | Human | 123 | old_gene_name | gene, protein-coding, REVIEWED [RefSeq] |
| 1550948 | Uhmk1 | U2AF homology motif (UHM) kinase 1 | Enables ribonucleoprotein complex binding activity. Involved in neuron projection development and positive regulation of translational initiation. Located in axon; dendrite cytoplasm; and neuronal ribonucleoprotein granule. Is expressed in several structures, including central nervous system; heart; liver; metanephros; and retina. Orthologous to human UHMK1 (U2AF homology motif kinase 1). [provided by Alliance of Genome Resources, Jul 2025] | 1 | 170020989 | 170043466 | Mouse | 134 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 621865 | Kalrn | kalirin, RhoGEF kinase | ENCODES a protein that exhibits enzyme binding; guanyl-nucleotide exchange factor activity (ortholog); INVOLVED IN axonogenesis; intracellular signal transduction; nervous system development; PARTICIPATES IN ephrin - ephrin receptor bidirectional signaling axis; ASSOCIATED WITH cerebral atherosclero sis (ortholog); cerebral infarction (ortholog); coronary artery disease (ortholog); FOUND IN glutamatergic synapse; neuronal cell body; perinuclear region of cytoplasm; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 2,6-dinitrotoluene | 11 | 79703345 | 80309210 | Rat | 202 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1561897 | Uhmk1l1 | U2AF homology motif kinase 1l1 | ENCODES a protein that exhibits ATP binding (inferred); kinase activity (inferred); nucleic acid binding (inferred); FOUND IN nucleus (inferred); INTERACTS WITH 17alpha-ethynylestradiol; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 17 | 43147379 | 43149342 | Rat | 22 | old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 626467889 | Hspa8em1Opu | heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaa atatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. | | | | Rat | | description | gene, allele |
| 626467891 | Hspa8em2Opu | heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM style='font-weight:700;'>PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). | | | | Rat | | description | gene, allele |
| 1557778 | Pam16 | presequence translocase-asssociated motor 16 | Acts upstream of or within DNA biosynthetic process and negative regulation of apoptotic signaling pathway. Located in mitochondrion. Part of PAM complex, Tim23 associated import motor. Is expressed in several structures, including alimentary system; central ner vous system; egg cylinder; genitourinary system; and lung. Human ortholog(s) of this gene implicated in spondylometaphyseal dysplasia Megarbane-Dagher-Melike type. Orthologous to human PAM16 (presequence translocase associated motor 16). [provided by Alliance of Genome Resources, Jul 2025] | 16 | 4434330 | 4442810 | Mouse | 76 | symbol , old_gene_name , PhenoGen , description | gene, protein-coding, VALIDATED [RefSeq] |
| 1598163 | Pam16 | presequence translocase associated motor 16 | INVOLVED IN negative regulation of apoptotic DNA fragmentation; negative regulation of apoptotic process; negative regulation of release of cytochrome c from mitochondria; PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIATED WITH Desbuquois dysplasia (ortholog); Rubinstein -Taybi syndrome (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN cytoplasm (ortholog); matrix side of mitochondrial inner membrane (ortholog); mitochondrial matrix (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3-chloropropane-1,2-diol; 6-propyl-2-thiouracil | 10 | 11449316 | 11457071 | Rat | 73 | symbol , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1603048 | PAM16 | presequence translocase associated motor 16 | This gene encodes a mitochondrial protein involved in granulocyte-macrophage colony-stimulating factor (GM-CSF) signaling. This protein also plays a role in the import of nuclear-encoded mitochondrial proteins into the mitochondrial matrix and may be important in reactive oxygen species (ROS) homeos tasis. Mutations in this gene cause Megarbane-Dagher-Melike type spondylometaphyseal dysplasia, an early lethal skeletal dysplasia characterized by short stature, developmental delay and other skeletal abnormalities. [provided by RefSeq, May 2017] | 16 | 4340251 | 4351321 | Human | 165 | symbol , old_gene_name , COSMIC , Human Proteome Map | gene, protein-coding, REVIEWED [RefSeq] |
| 8920424 | Pam16 | presequence translocase associated motor 16 | INVOLVED IN DNA biosynthetic process (ortholog); negative regulation of apoptotic DNA fragmentation (ortholog); negative regulation of apoptotic process (ortholog); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIATED WITH Desbuquois dysplasia (ortholog); Rubinstein-Taybi syndrome (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN cytoplasm (ortholog); matrix side of mitochondrial inner membrane (ortholog); mitochondrial matrix (ortholog) | NW_004955442 | 13087082 | 13097048 | Chinchilla | 23 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 12417576 | PAM16 | presequence translocase associated motor 16 | ENCODES a protein that exhibits actin binding (inferred); INVOLVED IN DNA biosynthetic process (ortholog); negative regulation of apoptotic DNA fragmentation (ortholog); negative regulation of apoptotic process (ortholog); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIAT ED WITH Desbuquois dysplasia (ortholog); Rubinstein-Taybi syndrome (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN matrix side of mitochondrial inner membrane (ortholog); mitochondrial matrix (ortholog); mitochondrion (ortholog) | 6 | 37040484 | 37047708 | Dog | 48 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 12564059 | Pam16 | presequence translocase associated motor 16 | INVOLVED IN DNA biosynthetic process (ortholog); negative regulation of apoptotic DNA fragmentation (ortholog); negative regulation of apoptotic process (ortholog); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIATED WITH Desbuquois dysplasia (ortholog); Rubinstein-Taybi syndrome (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN cytoplasm (ortholog) | NW_004936694 | 153958 | 161635 | Squirrel | 27 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 14373672 | PAM16 | | | | | | Yeast | | symbol | gene, null |
| 18420498 | PAM16 | presequence translocase associated motor 16 | INVOLVED IN DNA biosynthetic process (ortholog); negative regulation of apoptotic DNA fragmentation (ortholog); negative regulation of apoptotic process (ortholog); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIATED WITH Desbuquois dysplasia (ortholog); Rubinstein-Taybi syndrome (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN cytoplasm (ortholog); matrix side of mitochondrial inner membrane (ortholog); mitochondrial matrix (ortholog) | | | | Green Monkey | 23 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 18908760 | Pam16 | presequence translocase associated motor 16 | INVOLVED IN DNA biosynthetic process (ortholog); negative regulation of apoptotic DNA fragmentation (ortholog); negative regulation of apoptotic process (ortholog); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIATED WITH Desbuquois dysplasia (ortholog); Rubinstein-Taybi syndrome (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN cytoplasm (ortholog); matrix side of mitochondrial inner membrane (ortholog); mitochondrial matrix (ortholog) | | | | Naked Mole-Rat | 27 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 32731473 | PAM16 | presequence translocase associated motor 16 | ENCODES a protein that exhibits actin binding (inferred); INVOLVED IN DNA biosynthetic process (ortholog); negative regulation of apoptotic DNA fragmentation (ortholog); negative regulation of apoptotic process (ortholog); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIAT ED WITH Desbuquois dysplasia (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN matrix side of mitochondrial inner membrane (ortholog); mitochondrial matrix (ortholog); mitochondrion (ortholog) | 16 | 3243435 | 3248815 | Bonobo | 43 | symbol | gene, protein-coding, MODEL [RefSeq] |
| 155231560 | pam16 | | | | | | Tropical Clawed Frog | | symbol | gene, null |
| 14381304 | PAM18 | | | | | | Yeast | | symbol | gene, null |
| 1308745 | Pamr1 | peptidase domain containing associated with muscle regeneration 1 | ENCODES a protein that exhibits calcium ion binding (inferred); serine-type endopeptidase activity (inferred); INVOLVED IN proteolysis (inferred); ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog); FOUND IN extracellular region (inferred); INTERACTS WITH 1-naphthyl isothiocyanate; 17alpha-ethynylestradiol; 17beta-estradiol | 3 | 109340411 | 109443595 | Rat | 108 | symbol , old_gene_name , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1332113 | Pamr1 | peptidase domain containing associated with muscle regeneration 1 | Predicted to enable calcium ion binding activity. Predicted to be located in extracellular region. Is expressed in several structures, including alimentary system; brain ventricular layer; limb; metanephros; and skeleton. Orthologous to human PAMR1 (peptidase do main containing associated with muscle regeneration 1). [provided by Alliance of Genome Resources, Jul 2025] | 2 | 102380325 | 102473386 | Mouse | 115 | symbol , old_gene_name , PhenoGen , description | gene, protein-coding, VALIDATED [RefSeq] |
| 1604026 | PAMR1 | peptidase domain containing associated with muscle regeneration 1 | Predicted to enable calcium ion binding activity and serine-type endopeptidase activity. Predicted to be involved in proteolysis. Predicted to be located in extracellular region. [provided by Alliance of Genome Resources, Jul 2025] | 11 | 35431827 | 35530300 | Human | 110 | symbol , old_gene_name , COSMIC , Human Proteome Map | gene, protein-coding, VALIDATED [RefSeq] |
| 9051909 | Pamr1 | peptidase domain containing associated with muscle regeneration 1 | ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog) | NW_004955422 | 10734673 | 10913258 | Chinchilla | 4 | symbol , old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 12031301 | PAMR1 | peptidase domain containing associated with muscle regeneration 1 | ENCODES a protein that exhibits calcium ion binding (inferred); serine-type endopeptidase activity (inferred); INVOLVED IN proteolysis (inferred); ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog); FOUND IN extracellular region (inferred) | 11 | 35404636 | 35498705 | Bonobo | 8 | symbol , old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 12420390 | PAMR1 | peptidase domain containing associated with muscle regeneration 1 | ENCODES a protein that exhibits calcium ion binding (inferred); serine-type endopeptidase activity (inferred); INVOLVED IN proteolysis (inferred); ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog); FOUND IN extracellular region (inferred) | 18 | 32476285 | 32548486 | Dog | 8 | symbol , old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 12719227 | Pamr1 | peptidase domain containing associated with muscle regeneration 1 | ENCODES a protein that exhibits calcium ion binding (inferred); hydrolase activity (inferred); peptidase activity (inferred); INVOLVED IN proteolysis (inferred); ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog); FOUND I N extracellular region (inferred) | NW_004936533 | 2684826 | 2764682 | Squirrel | 12 | symbol , old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 13872858 | PAMR1 | peptidase domain containing associated with muscle regeneration 1 | ENCODES a protein that exhibits calcium ion binding (inferred); peptidase activity (inferred); serine-type endopeptidase activity (inferred); INVOLVED IN proteolysis (inferred); ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (or tholog); FOUND IN extracellular region (inferred) | | | | Pig | 10 | symbol , old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 18669167 | PAMR1 | peptidase domain containing associated with muscle regeneration 1 | ENCODES a protein that exhibits calcium ion binding (inferred); serine-type endopeptidase activity (inferred); INVOLVED IN proteolysis (inferred); ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog); FOUND IN extracellular region (inferred) | | | | Green Monkey | 8 | symbol , old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 18933594 | Pamr1 | peptidase domain containing associated with muscle regeneration 1 | ENCODES a protein that exhibits calcium ion binding (inferred); hydrolase activity (inferred); peptidase activity (inferred); INVOLVED IN proteolysis (inferred); ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog); FOUND I N extracellular region (inferred) | | | | Naked Mole-Rat | 12 | symbol , old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 284661968 | pamr1 | | | | | | Tropical Clawed Frog | | symbol | gene, null |
| 625902083 | Pamr1 | peptidase domain containing associated with muscle regeneration 1 | ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog) | | | | Black Rat | 4 | symbol , old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 2295510 | Pam16l | presequence translocase associated motor 16 like | Predicted to be involved in ossification. [provided by Alliance of Genome Resources, Apr 2025] | 10 | 43400080 | 43400613 | Mouse | | symbol , PhenoGen | gene, pseudo, INFERRED [RefSeq] |
| 14386218 | pamn-1 | | | | | | Roundworm | | symbol | gene, null |
| 155231559 | pam16.L | | | | | | African Clawed Frog | | symbol | gene, null |
| 155249840 | pam16.S | | | | | | African Clawed Frog | | symbol | gene, null |
| 6904359 | CORO7-PAM16 | CORO7-PAM16 readthrough | This locus represents naturally occurring read-through transcription between the neighboring CORO7 (coronin 7) and PAM16 (presequence translocase-associated motor 16) genes on chromosome 16. The read-through transcript encodes a fusion protein that shares sequen ce identity with each individual gene product. [provided by RefSeq, Jan 2011] | 16 | 4340251 | 4416596 | Human | 20 | symbol , COSMIC , name , description , Human Proteome Map | gene, protein-coding, VALIDATED [RefSeq] |
| 730917 | ADM | adrenomedullin | The protein encoded by this gene is a preprohormone which is cleaved to form two biologically active peptides, adrenomedullin and proadrenomedullin N-terminal 20 peptide. Adrenomedullin is a 52 aa peptide with several functions, including vasodilation, regulation of hormone secretion, promotion of a ngiogenesis, and antimicrobial activity. The antimicrobial activity is antibacterial, as the peptide has been shown to kill E. coli and S. aureus at low concentration. [provided by RefSeq, Aug 2014] | 11 | 10305073 | 10307397 | Human | 475 | old_gene_symbol | gene, protein-coding, REVIEWED [RefSeq] |
| 1309676 | Prxl2a | peroxiredoxin like 2A | ENCODES a protein that exhibits antioxidant activity (ortholog); INVOLVED IN regulation of osteoclast differentiation (ortholog); FOUND IN cytoplasm (ortholog); INTERACTS WITH 1-naphthyl isothiocyanate; 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran | 16 | 16900697 | 16920521 | Rat | 145 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1320148 | PRXL2A | peroxiredoxin like 2A | Enables antioxidant activity. Involved in regulation of osteoclast differentiation. Located in cytoplasm. [provided by Alliance of Genome Resources, Jul 2025] | 10 | 80407829 | 80437115 | Human | 142 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1320149 | Prxl2a | peroxiredoxin like 2A | Predicted to enable antioxidant activity. Predicted to be involved in regulation of osteoclast differentiation. Located in mitochondrion. Is expressed in several structures, including alimentary system; ganglia; lung; sensory organ; and urinary system. Orthologous to human PRXL2A (peroxiredoxin like 2A). [provided by Alliance of Genome Resources, Jul 2025] | 14 | 40715692 | 40735790 | Mouse | 150 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 733459 | YME1L1 | YME1 like 1 ATPase | The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be in volved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] | 10 | 27110111 | 27154384 | Human | 177 | old_gene_symbol | gene, protein-coding, REVIEWED [RefSeq] |
| 11912424 | CORO7 | coronin 7 | ENCODES a protein that exhibits actin binding (inferred); INVOLVED IN actin filament organization (ortholog); cell migration (ortholog); establishment of cell polarity (ortholog); FOUND IN cytoplasm (inferred); cytoplasmic vesicle (inferred); cytosol (inferred) | 16 | 3281481 | 3342937 | Bonobo | 31 | old_gene_symbol | gene, protein-coding, MODEL [RefSeq] |
| 1603908 | DNAJC19 | DnaJ heat shock protein family (Hsp40) member C19 | The protein encoded by this gene is thought to be part of a complex involved in the ATP-dependent transport of transit peptide-containing proteins from the inner cell membrane to the mitochondrial matrix. Defects in this gene are a cause of 3-methylglutaconic aciduria type 5 (MGA5), also known as di lated cardiomyopathy with ataxia (DCMA). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 2, 6, 10, 14 and 19. [provided by RefSeq, Jan 2012] | 3 | 180983709 | 180989838 | Human | 204 | old_gene_symbol | gene, protein-coding, REVIEWED [RefSeq] |
| 14149516 | LOC100513346 | mitochondrial import inner membrane translocase subunit TIM16 | ENCODES a protein that exhibits actin binding (inferred); INVOLVED IN DNA biosynthetic process (ortholog); negative regulation of apoptotic DNA fragmentation (ortholog); negative regulation of apoptotic process (ortholog); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIAT ED WITH Desbuquois dysplasia (ortholog); Rubinstein-Taybi syndrome (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN matrix side of mitochondrial inner membrane (ortholog); mitochondrial matrix (ortholog); mitochondrion (ortholog); INTERACTS WITH ethanol | | | | Pig | 52 | ensembl_gene_symbol , old_gene_symbol | gene, protein-coding, MODEL [RefSeq] |
| 18920048 | LOC101717279 | coronin-7 | ENCODES a protein that exhibits actin binding (inferred); INVOLVED IN actin cytoskeleton organization (inferred); actin filament organization (inferred); protein transport (inferred); FOUND IN cytoplasm (inferred); cytoplasmic vesicle (inferred); cytosol (inferred) | | | | Naked Mole-Rat | 13 | old_gene_symbol | gene, protein-coding, MODEL [RefSeq] |
| 1606988 | MRFAP1 | Morf4 family associated protein 1 | This gene encodes an intracellular protein that interacts with members of the MORF4/MRG (mortality factor on chromosome 4/MORF4 related gene) family and the tumor suppressor Rb (retinoblastoma protein.) The protein may play a role in senescence, cell growth and immortalization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013] | 4 | 6640685 | 6642729 | Human | 44 | old_gene_symbol | gene, protein-coding, REVIEWED [RefSeq] |
| 12175881 | RASSF9 | Ras association domain family member 9 | ENCODES a protein that exhibits enzyme binding (ortholog); protein domain specific binding (ortholog); INVOLVED IN intracellular transport (ortholog); FOUND IN endosome (ortholog); recycling endosome (ortholog) | 15 | 27304618 | 27331876 | Dog | 19 | old_gene_symbol | gene, protein-coding, MODEL [RefSeq] |
| 1343302 | RPS23 | ribosomal protein S23 | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S12P family of ribosomal proteins. It is located in the cytoplasm. The protein shares significant amino acid similarity with S. cerevisiae ribosomal protein S28. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008] | 5 | 82273320 | 82278354 | Human | 162 | old_gene_symbol | gene, protein-coding, REVIEWED [RefSeq] |
| 1320019 | TUBGCP2 | tubulin gamma complex component 2 | Predicted to enable gamma-tubulin binding activity. Predicted to contribute to microtubule minus-end binding activity. Involved in brain development and neuron migration. Located in centrosome; ciliary basal body; and nucleoplasm. Implicated in pachygyria, microcephaly, developmental delay, and dysm orphic facies, with or without seizures. [provided by Alliance of Genome Resources, Jul 2025] | 10 | 133278635 | 133312337 | Human | 120 | old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 19165134 | C3em1Linf | complement C3; CRISPR/Cas9 system induced mutant 1, Linf | ASSOCIATED WITH increased mechanical nociceptive threshold | | | | Rat | 2 | description | gene, allele |
| 14985211 | Cyfip1em1Sage | cytoplasmic FMR1 interacting protein 1; CRISPR/Cas9 induced mutant 1, Sage | ASSOCIATED WITH abnormal brain white matter morphology; decreased myelin sheath thickness; decreased oligodendrocyte number | | | | Rat | 3 | description | gene, allele |
| 11928444 | DNAJC15 | DnaJ heat shock protein family (Hsp40) member C15 | ENCODES a protein that exhibits ATPase activator activity (inferred); INVOLVED IN cellular response to starvation (ortholog); negative regulation of mitochondrial electron transport, NADH to ubiquinone (ortholog); negative regulation of protein-containing complex assembly (ortholog); ASSOCIATED WITH melanoma (ortholog); FOUND IN mitochondrial inner membrane (inferred); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | 13 | 24193185 | 24276813 | Bonobo | 14 | description | gene, protein-coding, MODEL [RefSeq] |
| 12701312 | Dnajc15 | DnaJ heat shock protein family (Hsp40) member C15 | ENCODES a protein that exhibits ATPase activator activity (inferred); INVOLVED IN cellular response to starvation (ortholog); negative regulation of mitochondrial electron transport, NADH to ubiquinone (ortholog); negative regulation of protein-containing complex assembly (ortholog); ASSOCIATED WITH melanoma (ortholog); FOUND IN mitochondrial inner membrane (inferred); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | NW_004936747 | 800070 | 864299 | Squirrel | 14 | description | gene, protein-coding, MODEL [RefSeq] |
| 18370561 | DNAJC15 | DnaJ heat shock protein family (Hsp40) member C15 | ENCODES a protein that exhibits ATPase activator activity (inferred); INVOLVED IN cellular response to starvation (ortholog); negative regulation of mitochondrial electron transport, NADH to ubiquinone (ortholog); negative regulation of protein-containing complex assembly (ortholog); ASSOCIATED WITH melanoma (ortholog); FOUND IN mitochondrial inner membrane (inferred); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | | | | Green Monkey | 14 | description | gene, protein-coding, MODEL [RefSeq] |
| 11900086 | GRPEL1 | GrpE like 1, mitochondrial | ENCODES a protein that exhibits ATPase activator activity (ortholog); ATPase binding (ortholog); identical protein binding (ortholog); INVOLVED IN protein folding (inferred); protein import into mitochondrial matrix (inferred); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASS OCIATED WITH human immunodeficiency virus infectious disease (ortholog); middle cerebral artery infarction (ortholog); FOUND IN mitochondrial matrix (inferred); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | | | | Bonobo | 22 | description | gene, protein-coding, MODEL [RefSeq] |
| 12602498 | Grpel1 | GrpE like 1, mitochondrial | ENCODES a protein that exhibits ATPase activator activity (ortholog); ATPase binding (ortholog); identical protein binding (ortholog); INVOLVED IN protein folding (inferred); protein import into mitochondrial matrix (inferred); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASS OCIATED WITH human immunodeficiency virus infectious disease (ortholog); middle cerebral artery infarction (ortholog); FOUND IN mitochondrial matrix (inferred); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | NW_004936477 | 18883556 | 18891108 | Squirrel | 22 | description | gene, protein-coding, MODEL [RefSeq] |
| 18375777 | GRPEL1 | GrpE like 1, mitochondrial | ENCODES a protein that exhibits ATPase activator activity (ortholog); ATPase binding (ortholog); identical protein binding (ortholog); INVOLVED IN protein folding (inferred); protein import into mitochondrial matrix (inferred); PARTICIPATES IN presequence pathway of mitochondrial protein import; ASS OCIATED WITH human immunodeficiency virus infectious disease (ortholog); middle cerebral artery infarction (ortholog); FOUND IN mitochondrial matrix (inferred); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | | | | Green Monkey | 22 | description | gene, protein-coding, MODEL [RefSeq] |
| 11760871 | GRPEL2 | GrpE like 2, mitochondrial | ENCODES a protein that exhibits adenyl-nucleotide exchange factor activity (inferred); protein homodimerization activity (inferred); protein-folding chaperone binding (inferred); INVOLVED IN protein folding (inferred); protein import into mitochondrial matrix (inferred); PARTICIPATES IN presequence pathway of mitochondrial protein import; FOUND IN mitochondrial matrix (inferred); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | 5 | 144771261 | 144780987 | Bonobo | 13 | description | gene, protein-coding, MODEL [RefSeq] |
| 12555491 | Grpel2 | GrpE like 2, mitochondrial | ENCODES a protein that exhibits adenyl-nucleotide exchange factor activity (inferred); protein homodimerization activity (inferred); protein-folding chaperone binding (inferred); INVOLVED IN protein folding (inferred); protein import into mitochondrial matrix (inferred); PARTICIPATES IN presequence pathway of mitochondrial protein import; FOUND IN mitochondrial matrix (inferred); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | NW_004936504 | 5511203 | 5522553 | Squirrel | 13 | description | gene, protein-coding, MODEL [RefSeq] |
| 13464264 | Il2rgem1Iexas | interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, Iexas | This mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was perfo rmed by electroporation. This resulting mutation was 5-bp deletion in Il2rg gene on X chromosome. | | | | Rat | | description | gene, allele |
| 598132327 | LOC140711790 | grpE protein homolog 1, mitochondrial | ENCODES a protein that exhibits adenyl-nucleotide exchange factor activity (inferred); identical protein binding (inferred); protein homodimerization activity (inferred); INVOLVED IN protein folding (inferred); protein import into mitochondrial matrix (inferred); FOUND IN mitochondrial matrix (infer red); mitochondrion (inferred); PAM complex, Tim23 associated import motor (inferred) | | | | Green Monkey | 14 | description | gene, protein-coding, MODEL [RefSeq] |
| 1564452 | Magmas-ps1 | mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction, pseudogene 1 | INVOLVED IN ossification (ortholog); FOUND IN mitochondrial inner membrane (inferred); PAM complex, Tim23 associated import motor (inferred); TIM23 mitochondrial import inner membrane translocase complex (inferred); INTERACTS WITH flutamide; leflunomide; nefazod one | 10 | 89102411 | 89102931 | Rat | 12 | description | gene, pseudo, INFERRED [RefSeq] |
| 38599191 | Rag2em1Iexas | recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas | This mutation was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by elect roporation. This resulting mutation was 1-bp insertion in Rag2 gene on chromosome 3. | | | | Rat | | description | gene, allele |
| 1353654 | TLR2 | toll like receptor 2 | The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-s urface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016] | 4 | 153684280 | 153710637 | Human | 812 | description | gene, protein-coding, REVIEWED [RefSeq] |
| 1320607 | TLR1 | toll like receptor 1 | The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen- associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008] | 4 | 38787569 | 38805644 | Human | 204 | description | gene, protein-coding, REVIEWED [RefSeq] |
| 1323096 | TLR10 | toll like receptor 10 | The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen- associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is most highly expressed in lymphoid tissues such as spleen, lymph node, thymus, and tonsil. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2010] | 4 | 38772238 | 38782990 | Human | 60 | description | gene, protein-coding, REVIEWED [RefSeq] |
| 1343581 | TLR3 | toll like receptor 3 | The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen- associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It thus plays a role in host defense against multiple viruses. [provided by RefSeq, Jul 2021] | 4 | 186069156 | 186088073 | Human | 445 | description | gene, protein-coding, REVIEWED [RefSeq] |
| 1344850 | TLR6 | toll like receptor 6 | The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen- associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011] | 4 | 38822897 | 38868390 | Human | 206 | description | gene, protein-coding, REVIEWED [RefSeq] |
| 1353456 | TLR7 | toll like receptor 7 | The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. The human TLR family com prises 11 members. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. For the recognition of structural components in foreign microorganisms, the various TLRs exhibit different patterns of expression as well; in this way for example, TLR-3, -7, and -8 are essential in the recognition of single-stranded RNA viruses. TLR7 senses single-stranded RNA oligonucleotides containing guanosine- and uridine-rich sequences from RNA viruses, a recognition occuring in the endosomes of plasmacytoid dendritic cells and B cells. This gene is predominantly expressed in lung, placenta, and spleen, and is phylogenetically related and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Aug 2020] | X | 12867072 | 12890361 | Human | 256 | description | gene, protein-coding, REVIEWED [RefSeq] |
| 1605396 | TLR8 | toll like receptor 8 | The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen- associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung and peripheral blood leukocytes, and lies in close proximity to another family member, TLR7, on chromosome X. [provided by RefSeq, Jul 2008] | X | 12906620 | 12923169 | Human | 161 | description | gene, protein-coding, REVIEWED [RefSeq] |
| 1346715 | TLR9 | toll like receptor 9 | The protein encoded by this gene is a member of the Toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen -associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Aug 2017] | 3 | 52221080 | 52225645 | Human | 349 | description | gene, protein-coding, REVIEWED [RefSeq] |
