Rag2<sup>em1Iexas</sup> (recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Rag2em1Iexas (recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas) Rattus norvegicus
Analyze
Symbol: Rag2em1Iexas
Name: recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas
RGD ID: 38599191
Description: This mutation was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 1-bp insertion in Rag2 gene on chromosome 3.
Type: allele  of Rag2  
Previously known as: Rag2^[em1Iexas]
Is Marker For: Strains:   F344-Rag2em1Iexas   F344-Il2rgem1IexasRag2em1Iexas  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


References

Genomics


Related Rat Strains
The following Strains have been annotated to Rag2em1Iexas


Expression


Sequence

Nucleotide Sequences


Additional Information