D8Rat161 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D8Rat161

Symbol: D8Rat161
Previously known as: oxsts11528; R0097-B06; 
RGD ID: 40860
Expected Size: 132 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2843,604,498 - 43,604,640 (+)MAPPERmRatBN7.2
Rnor_6.0847,521,855 - 47,521,996NCBIRnor6.0
Rnor_5.0845,990,738 - 45,990,879UniSTSRnor5.0
RGSC_v3.4846,234,997 - 46,235,139RGDRGSC3.4
RGSC_v3.4846,234,998 - 46,235,139UniSTSRGSC3.4
RGSC_v3.1846,243,764 - 46,243,905RGD
Celera843,194,410 - 43,194,497UniSTS
RH 3.4 Map8411.0RGD
RH 3.4 Map8411.0UniSTS
RH 2.0 Map8325.8RGD
SHRSP x BN Map833.5RGD
Cytogenetic Map8q22UniSTS
Is Marker For: Strains:   AVN/Orl   BBDR/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Oaf  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer CTGTGCCACACATACATGCA
Reverse Primer GCAGATGAAAACTGAGGGGA
 
Strain, Expected Size(s)

ACI/N 145 AVN/Orl 145 BBDR/Rhw 145
BC/CpbU 145 BDIX/Han 145 BN-Lx/Cub 145
BN/SsNHsd 143 BP/Cub 145 BUF/Pit 145
COP/OlaHsd 145 DA/PitN 145 DON/Melb 145
F344/Pit 145 GH/Omr 145 GK/KyoSwe 145
IS/Kyo 145 LE/Mol 145 LEW/Pit 145
LH/Mav 145 LN/Mav 145 LOU/CHan 145
M520/N 143 MHS/Gib 145 MNR/N 145
MNRA/N 145 MNS/Gib 145 MR/Pit 145
NEDH/K 145 NP9 145 ODU/N 136
OKA/Wsl 145 OM/Ztm 145 P5C 145
PVG/Pit 145 SD/Rij 145 SHR/OlaHsd 145
SR/Jr 145 SS/Jr 145 WAG/RijKyo 145
WF/Pit 145 WIST/Nhg 145 WKY/OlaHsd 145
WN/N 143 WTC/Kyo 145


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
1305890Oafout at first homolog84359436243612334Rat
GenBank Nucleotide CH473975 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000238 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 64 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1298065Scl16Serum cholesterol level QTL 163.8blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)83085640475856404Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)830848154101699754Rat
1298079Activ2Activity QTL 29.50.000001voluntary movement trait (VT:0003491)rearing measurement (CMO:0001515)84186687686866876Rat
11556286Cm81Cardiac mass QTL 810.01heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)83084815461290444Rat
70161Bp62Blood pressure QTL 622.90.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)84269268490165460Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)830848154101699754Rat
1582222Epfw2Epididymal fat weight QTL 23.20.0005epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)83173772976737729Rat
1354627Despr14Despair related QTL 140.0056locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)8768895552688955Rat
61464Niddm11Non-insulin dependent diabetes mellitus QTL 113.10.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)83558203280582032Rat

1 to 10 of 64 rows


Database
Acc Id
Source(s)
NCBI Gene 315594 UniSTS