D4Rat197 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Rat197

Symbol: D4Rat197
Previously known as: oxsts10918; R0241-C05; 
RGD ID: 40286
Expected Size: 97 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24149,614,933 - 149,615,026 (+)MAPPERmRatBN7.2
Rnor_6.04148,482,590 - 148,482,682NCBIRnor6.0
Rnor_5.04214,429,633 - 214,429,725UniSTSRnor5.0
RGSC_v3.44152,696,294 - 152,696,387RGDRGSC3.4
RGSC_v3.44152,696,295 - 152,696,387UniSTSRGSC3.4
RGSC_v3.14152,941,135 - 152,941,228RGD
Celera4138,498,760 - 138,498,852UniSTS
SHRSP x BN Map472.4899RGD
SHRSP x BN Map472.4899UniSTS
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines


 
Forward Primer CTTAGCTGGTTTCCACCCAG
Reverse Primer AGTGGTAGGGAGAGGGAGGA
 
Strain, Expected Size(s)

ACI/N 97 BBDP/Rhw 88 BBDR/Rhw 92
BC/CpbU 94 BDIX/Han 98 BDVII/Cub 94
BN-Lx/Cub 94 BN/SsNHsd 94 BP/Cub 98
BUF/Pit 98 DA/PitN 98 DON/Melb 98
F344/Pit 98 FHH/Eur 98 GH/Omr 98
GK/KyoSwe 96 IS/Kyo 100 LE/Mol 98
LEW/Pit 98 LH/Mav 94 LN/Mav 94
LOU/CHan 98 M520/N 98 MHS/Gib 98
MNR/N 82 MNRA/N 82 MNS/Gib 98
MR/Pit 82 NEDH/K 94 NP9 92
ODU/N 98 OKA/Wsl 97 OM/Ztm 98
P5C 92 PVG/Pit 99 SD/Rij 94
SHR/OlaHsd 98 SHRSP/Riv 98 SR/Jr 94
SS/Jr 94 WAG/RijKyo 94 WF/Pit 100
WKY/OlaHsd 100 WN/N 98


GenBank Nucleotide JH614790.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 51 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1582237Kidm34Kidney mass QTL 3440.0001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)4148090542168069246Rat
61446Coreg2Compensatory renal growth QTL 23.5kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)4148423102157580971Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4116179486151161268Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)426775591168368347Rat
631683Bp116Blood pressure QTL 1160.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4124303370169303370Rat
61451Ciaa4CIA Autoantibody QTL 43.1blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)4126395976167139601Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4138503169179293946Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
1549827Scl46Serum cholesterol level QTL 463.5blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)4132396220177396220Rat

1 to 10 of 51 rows