D19Rat10 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D19Rat10

Symbol: D19Rat10
Previously known as: oxsts6487; R049-C12; R0049-C12; 
RGD ID: 37102
Expected Size: 232 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81955,107,208 - 55,107,440 (+)Marker Load Pipeline
mRatBN7.21938,197,791 - 38,198,023 (-)MAPPERmRatBN7.2
Rnor_6.01941,426,062 - 41,426,293NCBIRnor6.0
Rnor_5.01952,254,565 - 52,254,796UniSTSRnor5.0
RGSC_v3.41940,109,361 - 40,109,741UniSTSRGSC3.4
Celera1937,593,841 - 37,594,076UniSTS
RH 3.4 Map19462.7UniSTS
RH 3.4 Map19462.7RGD
RH 2.0 Map19517.5RGD
SHRSP x BN Map1927.9098RGD
FHH x ACI Map1930.2099RGD
Cytogenetic Map19q12UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Cmtr2  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer GACTTGATGTGGGTGGTTCC
Reverse Primer CCAGAACCTCAAGGTACATGC
 
Strain, Expected Size(s)

ACI/N 233 AVN/Orl 237 BBDP/Rhw 237
BBDR/Rhw 237 BC/CpbU 233 BDIX/Han 233
BDVII/Cub 229 BN-Lx/Cub 233 BP/Cub 233
BUF/Pit 237 COP/OlaHsd 231 DA/PitN 231
DON/Melb 235 F344/Pit 235 FHH/Eur 237
GH/Omr 237 GK/KyoSwe 237 IS/Kyo 237
LE/Mol 237 LEW/Pit 237 LH/Mav 237
LN/Mav 237 LOU/CHan 229 M520/N 235
MHS/Gib 229 MNR/N 237 MNRA/N 229
MNS/Gib 237 MR/Pit 237 NEDH/K 229
NP9 237 ODU/N 237 OKA/Wsl 233
OM/Ztm 233 P5C 237 PVG/Pit 237
SD/Rij 229 SHR/OlaHsd 233 SHRSP/Riv 237
SR/Jr 237 SS/Jr 229 WAG/RijKyo 237
WF/Pit 229 WIST/Nhg 237 WKY/OlaHsd 237
WN/N 237 WTC/Kyo 237


GenBank Nucleotide CH473972 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000249 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 18 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19231612147316121Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)193383821455283146Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
724518Uae19Urinary albumin excretion QTL 195.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19745724942983518Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
8694186Bw152Body weight QTL 1523.340.001body mass (VT:0001259)body weight gain (CMO:0000420)1956937445569374Rat
61423Cia14Collagen induced arthritis QTL 143joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)191082797043544039Rat

1 to 10 of 18 rows


Database
Acc Id
Source(s)
NCBI Gene 292016 UniSTS