D3Mgh11 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D3Mgh11

Symbol: D3Mgh11
Previously known as: oxsts4945; R5890; 
RGD ID: 34507
Expected Size: 158 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr83126,773,960 - 126,774,118 (+)Marker Load Pipeline
mRatBN7.23106,320,129 - 106,320,287 (+)MAPPERmRatBN7.2
Rnor_6.03111,138,035 - 111,138,192NCBIRnor6.0
Rnor_5.03117,688,754 - 117,688,911UniSTSRnor5.0
RGSC_v3.43105,847,686 - 105,847,844RGDRGSC3.4
RGSC_v3.43105,847,687 - 105,847,844UniSTSRGSC3.4
RGSC_v3.13105,744,115 - 105,744,272RGD
Celera3105,233,403 - 105,233,560UniSTS
RH 3.4 Map3913.7UniSTS
RH 3.4 Map3913.7RGD
RH 2.0 Map3587.4RGD
FHH x ACI Map360.54RGD
Cytogenetic Map3q35UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   LN/Mav   GH/Omr   NEDH/K   SS/Jr  
Genes:   Dll4  


Annotation


#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database


 
Forward Primer GAGACACCCTGAGTTCCATACC
Reverse Primer CCCTTTCTTGGTGGTCCATA
 
Strain, Expected Size(s)

AVN/Orl 170 BBDP/Rhw 170 BBDR/Rhw 170
BC/CpbU 170 BDIX/Han 170 BDVII/Cub 170
BN/SsNHsd 158 BP/Cub 158 BUF/Pit 160
DA/PitN 154 DON/Melb 160 F344/Pit 160
FHH/Eur 148 GH/Omr 148 GK/KyoSwe 170
IS/Kyo 160 LE/Mol 154 LEW/Pit 160
LH/Mav 148 LN/Mav 148 LOU/CHan 160
M520/N 148 MHS/Gib 156 MNR/N 170
MNRA/N 172 MNS/Gib 156 MR/Pit 170
NEDH/K 148 NP9 156 ODU/N 170
OKA/Wsl 148 OM/Ztm 156 P5C 170
PVG/Pit 158 SD/Rij 154 SHR/OlaHsd 148
SHRSP/Riv 148 SR/Jr 146 SS/Jr 148
WAG/RijKyo 170 WF/Pit 160 WIST/Nhg 170
WKY/OlaHsd 148 WN/N 160 WTC/Kyo 148


The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD ID
Symbol
Name
Chr
Start
Stop
Species
1309740Dll4delta like canonical Notch ligand 43106317114106327004Rat
GenBank Nucleotide DH560117 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH566813 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 40 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
1582216Bw65Body weight QTL 656.3body mass (VT:0001259)body weight (CMO:0000012)3102200529115665732Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat

1 to 10 of 40 rows


Note Type Note Reference
Database
Acc Id
Source(s)
NCBI Gene 311332 UniSTS